Home
Search 
BLAST
Manual
DownloadDetails of Virus RNA
| Strain Information | Strain Name |
Dengue virus 2 (strain D2/SG/05K3295DK1/2005)
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Flaviviridae
|
||||||||
| RNA Binding Site |
3'UTR
|
||||||||
| Virus Information | Virus Name |
Dengue virus 2 (DENV2)
|
|||||||
| Taxonomy ID | 11060 | ||||||||
Full list of proteins interacting with the 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 28 kDa heat- and acid-stable phosphoprotein | Q13442 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S10 | P82664 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S11 | P82912 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S14 | O60783 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S17 | Q9Y2R5 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S2 | Q9Y399 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S22 | P82650 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S23 | Q9Y3D9 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S25 | P82663 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S28 | Q9Y2Q9 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S29 | P51398 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S31 | Q92665 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S33 | Q9Y291 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S35 | P82673 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S39 | Q96EY7 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 28S ribosomal protein S6 | P82932 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 39S ribosomal protein L1 | Q9BYD6 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 39S ribosomal protein L12 | P52815 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 39S ribosomal protein L27 | Q9P0M9 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 39S ribosomal protein L37 | Q9BZE1 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 39S ribosomal protein L43 | Q8N983 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 39S ribosomal protein L47 | Q9HD33 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 39S ribosomal protein L48 | Q96GC5 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 39S ribosomal protein L53 | Q96EL3 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 39S ribosomal protein L55 | Q7Z7F7 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 39S ribosomal protein S18a | Q9NVS2 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 60S ribosomal export protein NMD3 | Q96D46 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| 7SK snRNA methylphosphate capping enzyme | Q7L2J0 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Apoptotic chromatin condensation inducer in the nucleus | Q9UKV3 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| ASC-1 complex subunit p100 | Q9H1I8 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| ATPase family AAA domain-containing protein 3A | Q9NVI7 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| ATPase family AAA domain-containing protein 3B | Q5T9A4 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Caprin-1 | Q14444 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Chromodomain-helicase-DNA-binding protein 4 | Q14839 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Chromodomain-helicase-DNA-binding protein 9 | Q3L8U1 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Coiled-coil domain-containing protein 124 | Q96CT7 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| CPSF 100 kDa subunit | Q9P2I0 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Cytoplasmic dynein 1 light intermediate chain 1 | Q9Y6G9 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| DNA-directed RNA polymerase I subunit RPA1 | O95602 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| DNA-directed RNA polymerases I | P52434 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Dynein light chain 2 | Q96FJ2 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| E3 ubiquitin-protein ligase TRIM71 | Q2Q1W2 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| eIF-1A X isoform | P47813 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| eIF3c | Q99613 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| eIF3e | P60228 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| eIF3h | O15372 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| eIF3i | Q13347 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| eIF3k | Q9UBQ5 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| eIF3l | Q9Y262 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| eIF3m | Q7L2H7 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Elongation factor p18 | Q9D1M4 | Mus musculus | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Enhancer of mRNA-decapping protein 3 | Q96F86 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Enhancer of rudimentary homolog | P84090 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| ER membrane protein complex subunit 1 | Q8N766 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| ESF1 homolog | Q9H501 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Exosome complex component CSL4 | Q9Y3B2 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Exosome complex component RRP4 | Q13868 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Exosome complex component RRP41 | Q9NPD3 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| FERM and PDZ domain-containing protein 4 | Q14CM0 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| G-rich sequence factor 1 | Q12849 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Glutamate-rich WD repeat-containing protein 1 | Q9BQ67 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Glycogenin-1 | P46976 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Golgin subfamily B member 1 | Q14789 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| HBS1-like protein | Q9Y450 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| HDGF-related protein 2 | Q7Z4V5 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A/B | Q99729 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Heterogeneous nuclear ribonucleoprotein D-like | O14979 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Heterogeneous nuclear ribonucleoprotein H3 | P31942 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| High mobility group protein HMG-I/HMG-Y | P17096 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| High mobility group protein HMGI-C | P52926 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| HIV Tat-specific factor 1 | O43719 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| IGF2 mRNA-binding protein 1 | Q9NZI8 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| IGF2 mRNA-binding protein 2 | Q9Y6M1 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| IGF2 mRNA-binding protein 3 | O00425 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Inosine-5'-monophosphate dehydrogenase 1 | P20839 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Keratin-14 | P02533 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| La-related protein 7 | Q4G0J3 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| LANP-like protein | Q9BTT0 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Lysosomal protective protein | P10619 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| M2 antigen complex 70 kDa subunit | P10515 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Melanoma-associated antigen B1 | P43366 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Melanoma-associated antigen B2 | O15479 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Microtubule-associated protein 1A | P78559 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| MRP-S37 | Q96BP2 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| NAD(P)H-hydrate epimerase | Q8NCW5 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Nuclear cap-binding protein subunit 2 | P52298 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Nucleolar and coiled-body phosphoprotein 1 | Q14978 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Nucleolar protein 6 | Q9H6R4 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| O-phosphoseryl-tRNA(Sec) selenium transferase | Q9HD40 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Parafibromin | Q6P1J9 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Partner of Y14 and mago | Q9BRP8 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Peptidyl-prolyl cis-trans isomerase H | O43447 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Polyadenylate-binding protein 2 | Q86U42 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Probable ATP-dependent RNA helicase DDX6 | P26196 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Programmed cell death protein 10 | Q9BUL8 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Prohibitin-2 | Q99623 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Proteasome subunit beta type-4 | P28070 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Protein CMSS1 | Q9BQ75 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Protein IWS1 homolog | Q96ST2 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Protein S100-P | P25815 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Protein SET | Q01105 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Putative RNA-binding protein Luc7-like 2 | Q9Y383 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Putative TGFB1-induced anti-apoptotic factor 1 | O95411 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Ras GTPase-activating protein-binding protein 1 | Q13283 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Ras GTPase-activating protein-binding protein 2 | Q9UN86 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Ribosomal RNA processing protein 1 homolog B | Q14684 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Ribosomal RNA-processing protein 7 homolog A | Q9Y3A4 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Ribosome biogenesis inhibitor MINAS-60 | P0DW28 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| RNA-binding protein 42 | Q9BTD8 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| SAP30-binding protein | Q9UHR5 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| SART-3 | Q15020 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Selenoprotein H | Q8IZQ5 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Sequestosome-1 | Q13501 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Signal recognition particle 14 kDa protein | P37108 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Signal recognition particle 19 kDa protein | P09132 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Signal recognition particle 9 kDa protein | P49458 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Signal recognition particle subunit SRP54 | P61011 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Signal recognition particle subunit SRP68 | Q9UHB9 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Signal recognition particle subunit SRP72 | O76094 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Small nuclear ribonucleoprotein Sm D2 | P62316 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Small nuclear ribonucleoprotein Sm D3 | P62318 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Something about silencing protein 10 | Q9NQZ2 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Splicing factor 3A subunit 1 | Q15459 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Surfeit locus protein 2 | Q15527 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| SWI/SNF complex subunit SMARCC1 | Q92922 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Syndapin-2 | Q9UNF0 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| THO complex subunit 2 | Q8NI27 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| THO complex subunit 4 | Q86V81 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Transcription activator BRG1 | P51532 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Transcription elongation factor SPT4 | P63272 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Transcription elongation factor SPT6 | Q7KZ85 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Transcription factor A | Q00059 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Transcription intermediary factor 1-beta | Q13263 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Transcriptional repressor CTCF | P49711 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Translation machinery-associated protein 16 | Q96EY4 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Treacle protein | Q13428 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Trip4 complex subunit p200 | Q8N3C0 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| tRNA (adenine(58)-N(1))-methyltransferase non-catalytic subunit TRM6 | Q9UJA5 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| U3 snoRNP protein IMP3 | Q9NV31 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| U4/U6 small nuclear ribonucleoprotein Prp4 | O43172 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Uncharacterized protein C7orf50 | Q9BRJ6 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Uncharacterized protein C9orf43 | Q8TAL5 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Zinc finger protein 265 | O95218 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Zinc finger protein 593 | O00488 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
| Zinc finger protein 9 | P62633 | Homo sapiens | Pro Info | RNA chromatography and quantitative mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | . |
Functional Go Enrichment analysis of those proteins interacting with the 3'UTR of this Strain
| GO Term | GO Category | GO ID | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|---|
| RNA Binding | Molecular Function |
GO:0003723
|
2.30E-65 | 20.57259762 | 3167.943348 |
| mRNA Binding | Molecular Function |
GO:0003729
|
6.16E-15 | 12.69235972 | 471.9136544 |
| Translation Initiation Factor Activity | Molecular Function |
GO:0003743
|
6.20E-08 | 31.59011164 | 652.3865248 |
| Ribosome Binding | Molecular Function |
GO:0043022
|
1.13E-06 | 15.49982572 | 270.5733449 |
| snRNA Binding | Molecular Function |
GO:0017069
|
1.61E-06 | 25.16848221 | 424.9376163 |
| mRNA 3'-UTR Binding | Molecular Function |
GO:0003730
|
0.00024401 | 10.50904393 | 121.2182017 |
| Signal Recognition Particle Binding | Molecular Function |
GO:0005047
|
0.00024401 | 126.3503185 | 1456.273616 |
| mRNA 5'-UTR Binding | Molecular Function |
GO:0048027
|
0.000783133 | 25.41025641 | 259.303385 |
| Small Ribosomal Subunit rRNA Binding | Molecular Function |
GO:0070181
|
0.000783133 | 63.1656051 | 638.4953311 |
| Chromatin DNA Binding | Molecular Function |
GO:0031490
|
0.000909974 | 9.999831337 | 98.23014353 |
| N6-methyladenosine-containing RNA Binding | Molecular Function |
GO:1990247
|
0.000909974 | 54.13921747 | 528.2628897 |
| U6 snRNA Binding | Molecular Function |
GO:0017070
|
0.001834665 | 37.89171975 | 337.4882649 |
| Nucleosome Binding | Molecular Function |
GO:0031491
|
0.001834665 | 11.19581211 | 99.52221274 |
| Nucleosomal DNA Binding | Molecular Function |
GO:0031492
|
0.001874879 | 16.93162393 | 148.8873092 |
| RNA Exonuclease Activity | Molecular Function |
GO:0004532
|
0.001977091 | 34.44528083 | 298.6877776 |
| rRNA Binding | Molecular Function |
GO:0019843
|
0.005358063 | 12.08669109 | 91.97797512 |
| U4 snRNA Binding | Molecular Function |
GO:0030621
|
0.006370715 | 83.70042194 | 617.3845045 |
| Minor Groove Of Adenine-Thymine-Rich DNA Binding | Molecular Function |
GO:0003680
|
0.008977756 | 62.7721519 | 437.8938355 |
| poly Binding | Molecular Function |
GO:0008143
|
0.009245827 | 17.21308628 | 118.6400876 |
| 7SK snRNA Binding | Molecular Function |
GO:0097322
|
0.010229602 | 50.21518987 | 333.6658128 |
| Mitochondrial Inner Membrane | Cellular Component |
GO:0005743
|
2.51E-16 | 11.5394682 | 470.3893758 |
| Organelle Inner Membrane | Cellular Component |
GO:0019866
|
8.05E-16 | 10.65324362 | 414.4834826 |
| Mitochondrial Membrane | Cellular Component |
GO:0031966
|
1.02E-12 | 7.648199446 | 239.8318021 |
| Nucleus | Cellular Component |
GO:0005634
|
6.97E-11 | 3.164718075 | 84.95391924 |
| Intracellular Membrane-Bounded Organelle | Cellular Component |
GO:0043231
|
1.37E-10 | 3.044032282 | 78.9764417 |
| Signal Recognition Particle, Endoplasmic Reticulum Targeting | Cellular Component |
GO:0005786
|
6.51E-10 | 99200 | 2401080.668 |
| Nucleolus | Cellular Component |
GO:0005730
|
2.15E-07 | 4.510512639 | 82.31303285 |
| Nuclear Lumen | Cellular Component |
GO:0031981
|
2.35E-07 | 4.454715219 | 80.30515878 |
| Spliceosomal snRNP Complex | Cellular Component |
GO:0097525
|
2.35E-07 | 21.25778733 | 380.7165266 |
| P-body | Cellular Component |
GO:0000932
|
2.70E-07 | 15.92035081 | 281.2835613 |
| Intracellular Non-Membrane-Bounded Organelle | Cellular Component |
GO:0043232
|
3.09E-06 | 3.39412116 | 51.36677108 |
| U2-type Spliceosomal Complex | Cellular Component |
GO:0005684
|
6.62E-06 | 12.68164313 | 181.1490587 |
| Mitochondrial Ribosome | Cellular Component |
GO:0005761
|
7.09E-06 | 37.61480076 | 531.7112126 |
| U2 snRNP | Cellular Component |
GO:0005686
|
1.30E-05 | 31.96774194 | 430.0682116 |
| U2-type Precatalytic Spliceosome | Cellular Component |
GO:0071005
|
2.01E-05 | 17.93748112 | 231.3017988 |
| Cytoplasmic Stress Granule | Cellular Component |
GO:0010494
|
2.01E-05 | 13.10950081 | 168.9474981 |
| Precatalytic Spliceosome | Cellular Component |
GO:0071011
|
2.68E-05 | 16.76510446 | 210.2188011 |
| U4/U6 X U5 tri-snRNP Complex | Cellular Component |
GO:0046540
|
5.81E-05 | 21.30107527 | 249.3886904 |
| Spliceosomal tri-snRNP Complex | Cellular Component |
GO:0097526
|
6.35E-05 | 20.61290323 | 238.3823947 |
| U1 snRNP | Cellular Component |
GO:0005685
|
0.002383547 | 25.25477707 | 199.2000995 |
| Mitochondrial Gene Expression | Biological Process |
GO:0140053
|
2.87E-29 | 49.80015507 | 3604.700898 |
| Mitochondrial Translation | Biological Process |
GO:0032543
|
1.75E-28 | 50.14459665 | 3504.3009 |
| Translation | Biological Process |
GO:0006412
|
2.95E-21 | 19.25433148 | 1017.34451 |
| Gene Expression | Biological Process |
GO:0010467
|
3.21E-15 | 12.69550173 | 490.6755758 |
| RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile | Biological Process |
GO:0000377
|
1.37E-11 | 14.35106611 | 431.5083066 |
| mRNA Processing | Biological Process |
GO:0006397
|
1.54E-11 | 12.70451279 | 378.167 |
| protein-RNA Complex Assembly | Biological Process |
GO:0022618
|
1.16E-10 | 15.09961686 | 414.9811496 |
| mRNA Splicing, Via Spliceosome | Biological Process |
GO:0000398
|
1.16E-10 | 12.03885805 | 330.5879801 |
| Formation Of Cytoplasmic Translation Initiation Complex | Biological Process |
GO:0001732
|
5.23E-10 | 129.627451 | 3349.139405 |
| Cytoplasmic Translational Initiation | Biological Process |
GO:0002183
|
5.54E-09 | 47.41148325 | 1107.9989 |
| RNA Processing | Biological Process |
GO:0006396
|
1.79E-08 | 11.1613034 | 246.7044804 |
| Peptide Biosynthetic Process | Biological Process |
GO:0043043
|
2.98E-08 | 12.01196341 | 258.3190043 |
| Regulation Of Translation | Biological Process |
GO:0006417
|
5.56E-08 | 10.02360828 | 208.5091412 |
| Macromolecule Biosynthetic Process | Biological Process |
GO:0009059
|
1.56E-07 | 10.232493 | 201.5405046 |
| Cotranslational Protein Targeting To Membrane | Biological Process |
GO:0006613
|
1.96E-06 | 79.96774194 | 1367.132929 |
| Nucleosome Disassembly | Biological Process |
GO:0006337
|
1.18E-05 | 49.19851117 | 749.4243912 |
| protein-DNA Complex Disassembly | Biological Process |
GO:0032986
|
1.99E-05 | 42.6344086 | 624.7018894 |
| Ribosome Biogenesis | Biological Process |
GO:0042254
|
2.13E-05 | 9.055172414 | 131.5359126 |
| Spliceosomal Complex Assembly | Biological Process |
GO:0000245
|
2.57E-05 | 16.45811052 | 235.1140964 |
| CRD-mediated mRNA Stabilization | Biological Process |
GO:0070934
|
2.97E-05 | 84.76068376 | 1190.147026 |
Functional KEGG Enrichment analysis of those proteins interacting with the 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| Spliceosome | KEGG Pathway | 1.34E-08 | 12.71855604 | 281.761669 |
| Protein export | KEGG Pathway | 6.03E-07 | 45.43086325 | 802.0498159 |
| RNA transport | KEGG Pathway | 5.82E-06 | 8.295877277 | 124.2738333 |
| Ribosome | KEGG Pathway | 8.21E-06 | 8.87027027 | 127.2803106 |
| mRNA surveillance pathway | KEGG Pathway | 1.35E-05 | 11.5497076 | 157.4258128 |
| RNA degradation | KEGG Pathway | 0.004018421 | 8.616390584 | 66.78097754 |
| Ribosome biogenesis in eukaryotes | KEGG Pathway | 0.014153352 | 6.181334168 | 39.17263098 |
| RNA polymerase | KEGG Pathway | 0.177870141 | 8.647315583 | 31.7582323 |
| Vasopressin-regulated water reabsorption | KEGG Pathway | 0.300774492 | 5.966847498 | 18.0766934 |
| Selenocompound metabolism | KEGG Pathway | 0.71501988 | 7.79245283 | 16.03851626 |
| Renin-angiotensin system | KEGG Pathway | 0.85916233 | 5.665523156 | 10.0804037 |
| Citrate cycle | KEGG Pathway | 0.893974012 | 4.296464975 | 6.618813006 |
| Starch and sucrose metabolism | KEGG Pathway | 0.893974012 | 3.558849955 | 4.915208822 |
| Proteasome | KEGG Pathway | 0.893974012 | 2.766596785 | 3.247388193 |
| Pyruvate metabolism | KEGG Pathway | 0.893974012 | 2.706316653 | 3.128578227 |
| Salmonella infection | KEGG Pathway | 0.893974012 | 1.52198229 | 1.728898447 |
| Vibrio cholerae infection | KEGG Pathway | 0.893974012 | 2.540238737 | 2.807907538 |
| Cysteine and methionine metabolism | KEGG Pathway | 0.893974012 | 2.540238737 | 2.807907538 |
| Amyotrophic lateral sclerosis | KEGG Pathway | 0.893974012 | 1.387464387 | 1.526614624 |
| Legionellosis | KEGG Pathway | 0.893974012 | 2.221922731 | 2.222676934 |
Virus RNA Sequence Information
|
>U87411.1 Dengue virus type 2 (strain 16681) polyprotein mRNA, complete cds
AGTTGTTAGTCTACGTGGACCGACAAAGACAGATTCTTTGAGGGAGCTAAGCTCAACGTAGTTCTAACAG
TTTTTTAATTAGAGAGCAGATCTCTGATGAATAACCAACGGAAAAAGGCGAAAAACACGCCTTTCAATAT
GCTGAAACGCGAGAGAAACCGCGTGTCGACTGTGCAACAGCTGACAAAGAGATTCTCACTTGGAATGCTG
CAGGGACGAGGACCATTAAAACTGTTCATGGCCCTGGTGGCGTTCCTTCGTTTCCTAACAATCCCACCAA
CAGCAGGGATATTGAAGAGATGGGGAACAATTAAAAAATCAAAAGCTATTAATGTTTTGAGAGGGTTCAG
GAAAGAGATTGGAAGGATGCTGAACATCTTGAATAGGAGACGCAGATCTGCAGGCATGATCATTATGCTG
ATTCCAACAGTGATGGCGTTCCATTTAACCACACGTAACGGAGAACCACACATGATCGTCAGCAGACAAG
AGAAAGGGAAAAGTCTTCTGTTTAAAACAGAGGATGGCGTGAACATGTGTACCCTCATGGCCATGGACCT
TGGTGAATTGTGTGAAGACACAATCACGTACAAGTGTCCCCTTCTCAGGCAGAATGAGCCAGAAGACATA
GACTGTTGGTGCAACTCTACGTCCACGTGGGTAACTTATGGGACGTGTACCACCATGGGAGAACATAGAA
GAGAAAAAAGATCAGTGGCACTCGTTCCACATGTGGGAATGGGACTGGAGACACGAACTGAAACATGGAT
GTCATCAGAAGGGGCCTGGAAACATGTCCAGAGAATTGAAACTTGGATCTTGAGACATCCAGGCTTCACC
ATGATGGCAGCAATCCTGGCATACACCATAGGAACGACACATTTCCAAAGAGCCCTGATTTTCATCTTAC
TGACAGCTGTCACTCCTTCAATGACAATGCGTTGCATAGGAATGTCAAATAGAGACTTTGTGGAAGGGGT
TTCAGGAGGAAGCTGGGTTGACATAGTCTTAGAACATGGAAGCTGTGTGACGACGATGGCAAAAAACAAA
CCAACATTGGATTTTGAACTGATAAAAACAGAAGCCAAACAGCCTGCCACCCTAAGGAAGTACTGTATAG
AGGCAAAGCTAACCAACACAACAACAGAATCTCGCTGCCCAACACAAGGGGAACCCAGCCTAAATGAAGA
GCAGGACAAAAGGTTCGTCTGCAAACACTCCATGGTAGACAGAGGATGGGGAAATGGATGTGGACTATTT
GGAAAGGGAGGCATTGTGACCTGTGCTATGTTCAGATGCAAAAAGAACATGGAAGGAAAAGTTGTGCAAC
CAGAAAACTTGGAATACACCATTGTGATAACACCTCACTCAGGGGAAGAGCATGCAGTCGGAAATGACAC
AGGAAAACATGGCAAGGAAATCAAAATAACACCACAGAGTTCCATCACAGAAGCAGAATTGACAGGTTAT
GGCACTGTCACAATGGAGTGCTCTCCAAGAACGGGCCTCGACTTCAATGAGATGGTGTTGCTGCAGATGG
AAAATAAAGCTTGGCTGGTGCACAGGCAATGGTTCCTAGACCTGCCGTTACCATGGTTGCCCGGAGCGGA
CACACAAGGGTCAAATTGGATACAGAAAGAGACATTGGTCACTTTCAAAAATCCCCATGCGAAGAAACAG
GATGTTGTTGTTTTAGGATCCCAAGAAGGGGCCATGCACACAGCACTTACAGGGGCCACAGAAATCCAAA
TGTCATCAGGAAACTTACTCTTCACAGGACATCTCAAGTGCAGGCTGAGAATGGACAAGCTACAGCTCAA
AGGAATGTCATACTCTATGTGCACAGGAAAGTTTAAAGTTGTGAAGGAAATAGCAGAAACACAACATGGA
ACAATAGTTATCAGAGTGCAATATGAAGGGGACGGCTCTCCATGCAAGATCCCTTTTGAGATAATGGATT
TGGAAAAAAGACATGTCTTAGGTCGCCTGATTACAGTCAACCCAATTGTGACAGAAAAAGATAGCCCAGT
CAACATAGAAGCAGAACCTCCATTCGGAGACAGCTACATCATCATAGGAGTAGAGCCGGGACAACTGAAG
CTCAACTGGTTTAAGAAAGGAAGTTCTATCGGCCAAATGTTTGAGACAACAATGAGGGGGGCGAAGAGAA
TGGCCATTTTAGGTGACACAGCCTGGGATTTTGGATCCTTGGGAGGAGTGTTTACATCTATAGGAAAGGC
TCTCCACCAAGTCTTTGGAGCAATCTATGGAGCTGCCTTCAGTGGGGTTTCATGGACTATGAAAATCCTC
ATAGGAGTCATTATCACATGGATAGGAATGAATTCACGCAGCACCTCACTGTCTGTGACACTAGTATTGG
TGGGAATTGTGACACTGTATTTGGGAGTCATGGTGCAGGCCGATAGTGGTTGCGTTGTGAGCTGGAAAAA
CAAAGAACTGAAATGTGGCAGTGGGATTTTCATCACAGACAACGTGCACACATGGACAGAACAATACAAG
TTCCAACCAGAATCCCCTTCAAAACTAGCTTCAGCTATCCAGAAAGCCCATGAAGAGGGCATTTGTGGAA
TCCGCTCAGTAACAAGACTGGAGAATCTGATGTGGAAACAAATAACACCAGAATTGAATCACATTCTATC
AGAAAATGAGGTGAAGTTAACTATTATGACAGGAGACATCAAAGGAATCATGCAGGCAGGAAAACGATCT
CTGCGGCCTCAGCCCACTGAGCTGAAGTATTCATGGAAAACATGGGGCAAAGCAAAAATGCTCTCTACAG
AGTCTCATAACCAGACCTTTCTCATTGATGGCCCCGAAACAGCAGAATGCCCCAACACAAATAGAGCTTG
GAATTCGTTGGAAGTTGAAGACTATGGCTTTGGAGTATTCACCACCAATATATGGCTAAAATTGAAAGAA
AAACAGGATGTATTCTGCGACTCAAAACTCATGTCAGCGGCCATAAAAGACAACAGAGCCGTCCATGCCG
ATATGGGTTATTGGATAGAAAGTGCACTCAATGACACATGGAAGATAGAGAAAGCCTCTTTCATTGAAGT
TAAAAACTGCCACTGGCCAAAATCACACACCCTCTGGAGCAATGGAGTGCTAGAAAGTGAGATGATAATT
CCAAAGAATCTCGCTGGACCAGTGTCTCAACACAACTATAGACCAGGCTACCATACACAAATAACAGGAC
CATGGCATCTAGGTAAGCTTGAGATGGACTTTGATTTCTGTGATGGAACAACAGTGGTAGTGACTGAGGA
CTGCGGAAATAGAGGACCCTCTTTGAGAACAACCACTGCCTCTGGAAAACTCATAACAGAATGGTGCTGC
CGATCTTGCACATTACCACCGCTAAGATACAGAGGTGAGGATGGGTGCTGGTACGGGATGGAAATCAGAC
CATTGAAGGAGAAAGAAGAGAATTTGGTCAACTCCTTGGTCACAGCTGGACATGGGCAGGTCGACAACTT
TTCACTAGGAGTCTTGGGAATGGCATTGTTCCTGGAGGAAATGCTTAGGACCCGAGTAGGAACGAAACAT
GCAATACTACTAGTTGCAGTTTCTTTTGTGACATTGATCACAGGGAACATGTCCTTTAGAGACCTGGGAA
GAGTGATGGTTATGGTAGGCGCCACTATGACGGATGACATAGGTATGGGCGTGACTTATCTTGCCCTACT
AGCAGCCTTCAAAGTCAGACCAACTTTTGCAGCTGGACTACTCTTGAGAAAGCTGACCTCCAAGGAATTG
ATGATGACTACTATAGGAATTGTACTCCTCTCCCAGAGCACCATACCAGAGACCATTCTTGAGTTGACTG
ATGCGTTAGCCTTAGGCATGATGGTCCTCAAAATGGTGAGAAATATGGAAAAGTATCAATTGGCAGTGAC
TATCATGGCTATCTTGTGCGTCCCAAACGCAGTGATATTACAAAACGCATGGAAAGTGAGTTGCACAATA
TTGGCAGTGGTGTCCGTTTCCCCACTGCTCTTAACATCCTCACAGCAAAAAACAGATTGGATACCATTAG
CATTGACGATCAAAGGTCTCAATCCAACAGCTATTTTTCTAACAACCCTCTCAAGAACCAGCAAGAAAAG
GAGCTGGCCATTAAATGAGGCTATCATGGCAGTCGGGATGGTGAGCATTTTAGCCAGTTCTCTCCTAAAA
AATGATATTCCCATGACAGGACCATTAGTGGCTGGAGGGCTCCTCACTGTGTGCTACGTGCTCACTGGAC
GATCGGCCGATTTGGAACTGGAGAGAGCAGCCGATGTCAAATGGGAAGACCAGGCAGAGATATCAGGAAG
CAGTCCAATCCTGTCAATAACAATATCAGAAGATGGTAGCATGTCGATAAAAAATGAAGAGGAAGAACAA
ACACTGACCATACTCATTAGAACAGGATTGCTGGTGATCTCAGGACTTTTTCCTGTATCAATACCAATCA
CGGCAGCAGCATGGTACCTGTGGGAAGTGAAGAAACAACGGGCCGGAGTATTGTGGGATGTTCCTTCACC
CCCACCCATGGGAAAGGCTGAACTGGAAGATGGAGCCTATAGAATTAAGCAAAAAGGGATTCTTGGATAT
TCCCAGATCGGAGCCGGAGTTTACAAAGAAGGAACATTCCATACAATGTGGCATGTCACACGTGGCGCTG
TTCTAATGCATAAAGGAAAGAGGATTGAACCATCATGGGCGGACGTCAAGAAAGACCTAATATCATATGG
AGGAGGCTGGAAGTTAGAAGGAGAATGGAAGGAAGGAGAAGAAGTCCAGGTATTGGCACTGGAGCCTGGA
AAAAATCCAAGAGCCGTCCAAACGAAACCTGGTCTTTTCAAAACCAACGCCGGAACAATAGGTGCTGTAT
CTCTGGACTTTTCTCCTGGAACGTCAGGATCTCCAATTATCGACAAAAAAGGAAAAGTTGTGGGTCTTTA
TGGTAATGGTGTTGTTACAAGGAGTGGAGCATATGTGAGTGCTATAGCCCAGACTGAAAAAAGCATTGAA
GACAACCCAGAGATCGAAGATGACATTTTCCGAAAGAGAAGACTGACCATCATGGACCTCCACCCAGGAG
CGGGAAAGACGAAGAGATACCTTCCGGCCATAGTCAGAGAAGCTATAAAACGGGGTTTGAGAACATTAAT
CTTGGCCCCCACTAGAGTTGTGGCAGCTGAAATGGAGGAAGCCCTTAGAGGACTTCCAATAAGATACCAG
ACCCCAGCCATCAGAGCTGAGCACACCGGGCGGGAGATTGTGGACCTAATGTGTCATGCCACATTTACCA
TGAGGCTGCTATCACCAGTTAGAGTGCCAAACTACAACCTGATTATCATGGACGAAGCCCATTTCACAGA
CCCAGCAAGTATAGCAGCTAGAGGATACATCTCAACTCGAGTGGAGATGGGTGAGGCAGCTGGGATTTTT
ATGACAGCCACTCCCCCGGGAAGCAGAGACCCATTTCCTCAGAGCAATGCACCAATCATAGATGAAGAAA
GAGAAATCCCTGAACGTTCGTGGAATTCCGGACATGAATGGGTCACGGATTTTAAAGGGAAGACTGTTTG
GTTCGTTCCAAGTATAAAAGCAGGAAATGATATAGCAGCTTGCCTGAGGAAAAATGGAAAGAAAGTGATA
CAACTCAGTAGGAAGACCTTTGATTCTGAGTATGTCAAGACTAGAACCAATGATTGGGACTTCGTGGTTA
CAACTGACATTTCAGAAATGGGTGCCAATTTCAAGGCTGAGAGGGTTATAGACCCCAGACGCTGCATGAA
ACCAGTCATACTAACAGATGGTGAAGAGCGGGTGATTCTGGCAGGACCTATGCCAGTGACCCACTCTAGT
GCAGCACAAAGAAGAGGGAGAATAGGAAGAAATCCAAAAAATGAGAATGACCAGTACATATACATGGGGG
AACCTCTGGAAAATGATGAAGACTGTGCACACTGGAAAGAAGCTAAAATGCTCCTAGATAACATCAACAC
GCCAGAAGGAATCATTCCTAGCATGTTCGAACCAGAGCGTGAAAAGGTGGATGCCATTGATGGCGAATAC
CGCTTGAGAGGAGAAGCAAGGAAAACCTTTGTAGACTTAATGAGAAGAGGAGACCTACCAGTCTGGTTGG
CCTACAGAGTGGCAGCTGAAGGCATCAACTACGCAGACAGAAGGTGGTGTTTTGATGGAGTCAAGAACAA
CCAAATCCTAGAAGAAAACGTGGAAGTTGAAATCTGGACAAAAGAAGGGGAAAGGAAGAAATTGAAACCC
AGATGGTTGGATGCTAGGATCTATTCTGACCCACTGGCGCTAAAAGAATTTAAGGAATTTGCAGCCGGAA
GAAAGTCTCTGACCCTGAACCTAATCACAGAAATGGGTAGGCTCCCAACCTTCATGACTCAGAAGGCAAG
AGACGCACTGGACAACTTAGCAGTGCTGCACACGGCTGAGGCAGGTGGAAGGGCGTACAACCATGCTCTC
AGTGAACTGCCGGAGACCCTGGAGACATTGCTTTTACTGACACTTCTGGCTACAGTCACGGGAGGGATCT
TTTTATTCTTGATGAGCGGAAGGGGCATAGGGAAGATGACCCTGGGAATGTGCTGCATAATCACGGCTAG
CATCCTCCTATGGTACGCACAAATACAGCCACACTGGATAGCAGCTTCAATAATACTGGAGTTTTTTCTC
ATAGTTTTGCTTATTCCAGAACCTGAAAAACAGAGAACACCCCAAGACAACCAACTGACCTACGTTGTCA
TAGCCATCCTCACAGTGGTGGCCGCAACCATGGCAAACGAGATGGGTTTCCTAGAAAAAACGAAGAAAGA
TCTCGGATTGGGAAGCATTGCAACCCAGCAACCCGAGAGCAACATCCTGGACATAGATCTACGTCCTGCA
TCAGCATGGACGCTGTATGCCGTGGCCACAACATTTGTTACACCAATGTTGAGACATAGCATTGAAAATT
CCTCAGTGAATGTGTCCCTAACAGCTATAGCCAACCAAGCCACAGTGTTAATGGGTCTCGGGAAAGGATG
GCCATTGTCAAAGATGGACATCGGAGTTCCCCTTCTCGCCATTGGATGCTACTCACAAGTCAACCCCATA
ACTCTCACAGCAGCTCTTTTCTTATTGGTAGCACATTATGCCATCATAGGGCCAGGACTCCAAGCAAAAG
CAACCAGAGAAGCTCAGAAAAGAGCAGCGGCGGGCATCATGAAAAACCCAACTGTCGATGGAATAACAGT
GATTGACCTAGATCCAATACCTTATGATCCAAAGTTTGAAAAGCAGTTGGGACAAGTAATGCTCCTAGTC
CTCTGCGTGACTCAAGTATTGATGATGAGGACTACATGGGCTCTGTGTGAGGCTTTAACCTTAGCTACCG
GGCCCATCTCCACATTGTGGGAAGGAAATCCAGGGAGGTTTTGGAACACTACCATTGCGGTGTCAATGGC
TAACATTTTTAGAGGGAGTTACTTGGCCGGAGCTGGACTTCTCTTTTCTATTATGAAGAACACAACCAAC
ACAAGAAGGGGAACTGGCAACATAGGAGAGACGCTTGGAGAGAAATGGAAAAGCCGATTGAACGCATTGG
GAAAAAGTGAATTCCAGATCTACAAGAAAAGTGGAATCCAGGAAGTGGATAGAACCTTAGCAAAAGAAGG
CATTAAAAGAGGAGAAACGGACCATCACGCTGTGTCGCGAGGCTCAGCAAAACTGAGATGGTTCGTTGAG
AGAAACATGGTCACACCAGAAGGGAAAGTAGTGGACCTCGGTTGTGGCAGAGGAGGCTGGTCATACTATT
GTGGAGGACTAAAGAATGTAAGAGAAGTCAAAGGCCTAACAAAAGGAGGACCAGGACACGAAGAACCCAT
CCCCATGTCAACATATGGGTGGAATCTAGTGCGTCTTCAAAGTGGAGTTGACGTTTTCTTCATCCCGCCA
GAAAAGTGTGACACATTATTGTGTGACATAGGGGAGTCATCACCAAATCCCACAGTGGAAGCAGGACGAA
CACTCAGAGTCCTTAACTTAGTAGAAAATTGGTTGAACAACAACACTCAATTTTGCATAAAGGTTCTCAA
CCCATATATGCCCTCAGTCATAGAAAAAATGGAAGCACTACAAAGGAAATATGGAGGAGCCTTAGTGAGG
AATCCACTCTCACGAAACTCCACACATGAGATGTACTGGGTATCCAATGCTTCCGGGAACATAGTGTCAT
CAGTGAACATGATTTCAAGGATGTTGATCAACAGATTTACAATGAGATACAAGAAAGCCACTTACGAGCC
GGATGTTGACCTCGGAAGCGGAACCCGTAACATCGGGATTGAAAGTGAGATACCAAACCTAGATATAATT
GGGAAAAGAATAGAAAAAATAAAGCAAGAGCATGAAACATCATGGCACTATGACCAAGACCACCCATACA
AAACGTGGGCATACCATGGTAGCTATGAAACAAAACAGACTGGATCAGCATCATCCATGGTCAACGGAGT
GGTCAGGCTGCTGACAAAACCTTGGGACGTCGTCCCCATGGTGACACAGATGGCAATGACAGACACGACT
CCATTTGGACAACAGCGCGTTTTTAAAGAGAAAGTGGACACGAGAACCCAAGAACCGAAAGAAGGCACGA
AGAAACTAATGAAAATAACAGCAGAGTGGCTTTGGAAAGAATTAGGGAAGAAAAAGACACCCAGGATGTG
CACCAGAGAAGAATTCACAAGAAAGGTGAGAAGCAATGCAGCCTTGGGGGCCATATTCACTGATGAGAAC
AAGTGGAAGTCGGCACGTGAGGCTGTTGAAGATAGTAGGTTTTGGGAGCTGGTTGACAAGGAAAGGAATC
TCCATCTTGAAGGAAAGTGTGAAACATGTGTGTACAACATGATGGGAAAAAGAGAGAAGAAGCTAGGGGA
ATTCGGCAAGGCAAAAGGCAGCAGAGCCATATGGTACATGTGGCTTGGAGCACGCTTCTTAGAGTTTGAA
GCCCTAGGATTCTTAAATGAAGATCACTGGTTCTCCAGAGAGAACTCCCTGAGTGGAGTGGAAGGAGAAG
GGCTGCACAAGCTAGGTTACATTCTAAGAGACGTGAGCAAGAAAGAGGGAGGAGCAATGTATGCCGATGA
CACCGCAGGATGGGATACAAGAATCACACTAGAAGACCTAAAAAATGAAGAAATGGTAACAAACCACATG
GAAGGAGAACACAAGAAACTAGCCGAGGCCATTTTCAAACTAACGTACCAAAACAAGGTGGTGCGTGTGC
AAAGACCAACACCAAGAGGCACAGTAATGGACATCATATCGAGAAGAGACCAAAGAGGTAGTGGACAAGT
TGGCACCTATGGACTCAATACTTTCACCAATATGGAAGCCCAACTAATCAGACAGATGGAGGGAGAAGGA
GTCTTTAAAAGCATTCAGCACCTAACAATCACAGAAGAAATCGCTGTGCAAAACTGGTTAGCAAGAGTGG
GGCGCGAAAGGTTATCAAGAATGGCCATCAGTGGAGATGATTGTGTTGTGAAACCTTTAGATGACAGGTT
CGCAAGCGCTTTAACAGCTCTAAATGACATGGGAAAGATTAGGAAAGACATACAACAATGGGAACCTTCA
AGAGGATGGAATGATTGGACACAAGTGCCCTTCTGTTCACACCATTTCCATGAGTTAATCATGAAAGACG
GTCGCGTACTCGTTGTTCCATGTAGAAACCAAGATGAACTGATTGGCAGAGCCCGAATCTCCCAAGGAGC
AGGGTGGTCTTTGCGGGAGACGGCCTGTTTGGGGAAGTCTTACGCCCAAATGTGGAGCTTGATGTACTTC
CACAGACGCGACCTCAGGCTGGCGGCAAATGCTATTTGCTCGGCAGTACCATCACATTGGGTTCCAACAA
GTCGAACAACCTGGTCCATACATGCTAAACATGAATGGATGACAACGGAAGACATGCTGACAGTCTGGAA
CAGGGTGTGGATTCAAGAAAACCCATGGATGGAAGACAAAACTCCAGTGGAATCATGGGAGGAAATCCCA
TACTTGGGGAAAAGAGAAGACCAATGGTGCGGCTCATTGATTGGGTTAACAAGCAGGGCCACCTGGGCAA
AGAACATCCAAGCAGCAATAAATCAAGTTAGATCCCTTATAGGCAATGAAGAATACACAGATTACATGCC
ATCCATGAAAAGATTCAGAAGAGAAGAGGAAGAAGCAGGAGTTCTGTGGTAGAAAGCAAAACTAACATGA
AACAAGGCTAGAAGTCAGGTCGGATTAAGCCATAGTACGGAAAAAACTATGCTACCTGTGAGCCCCGTCC
AAGGACGTTAAAAGAAGTCAGGCCATCATAAATGCCATAGCTTGAGTAAACTATGCAGCCTGTAGCTCCA
CCTGAGAAGGTGTAAAAAATCCGGGAGGCCACAAACCATGGAAGCTGTACGCATGGCGTAGTGGACTAGC
GGTTAGAGGAGACCCCTCCCTTACAAATCGCAGCAACAATGGGGGCCCAAGGCGAGATGAAGCTGTAGTC
TCGCTGGAAGGACTAGAGGTTAGAGGAGACCCCCCCGAAACAAAAAACAGCATATTGACGCTGGGAAAGA
CCAGAGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAATGGTGCTGTTGA
ATCAACAGGTTCT
Click to Show/Hide
|