Details of Virus RNA

  Strain Information Strain Name
Hepatitis B virus (strain ayw)
Strain Family
Hepadnaviridae
RNA Binding Site
5'UTR - 3'UTR
  Virus Information Virus Name
Hepatitis B virus (HBV genotype D)
Taxonomy ID 10407

Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain

Protein Name Uniprot ID Host Species Pro Info Detection Method Infection Cell Cell ID Cell Originated Tissue Infection Time Interaction Score Fold Change
40S ribosomal protein S27 P42677 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 5.63E-05 .
40S ribosomal protein S27-like Q71UM5 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 5.63E-05 .
60S ribosomal protein L13 P26373 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.47E-05 .
60S ribosomal protein L23 P62829 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.39E-03 .
60S ribosomal protein L24 P83731 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 3.27E-03 .
60S ribosomal protein L27a P46776 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 2.17E-05 .
60S ribosomal protein L29 P47914 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 4.89E-03 .
60S ribosomal protein L36a P83881 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.08E-03 .
60S ribosomal protein L36a-like Q969Q0 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.08E-03 .
Aldo-keto reductase family 1 member C1 Q04828 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.99E-04 .
Alpha-enolase P06733 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 5.90E-04 .
apurinic or apyrimidinic site P27695 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.84E-03 .
ATP-dependent RNA helicase DDX1 Q92499 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 9.57E-04 .
ATP-dependent RNA helicase DDX50 Q9BQ39 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 4.62E-04 .
ATP-dependent RNA helicase DHX15 O43143 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 2.39E-03 .
Beta-chimaerin P52757 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 3.33E-03 .
Cofilin-1 P23528 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 6.14E-03 .
Cold-inducible RNA-binding protein Q14011 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.17E-03 .
Cysteine and glycine-rich protein 1 P21291 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 9.31E-05 .
DNA topoisomerase 1 P11387 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 2.64E-03 .
DnaJ homolog subfamily B member 6 O75190 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.13E-06 .
Dual specificity protein kinase CLK3 P49761 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 5.72E-04 .
Endothelial differentiation-related factor 1 O60869 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 4.44E-03 .
Filamin-B O75369 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 3.49E-03 .
Galectin-3-binding protein Q08380 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 3.85E-04 .
Heterogeneous nuclear ribonucleoprotein A0 Q13151 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.17E-04 .
Heterogeneous nuclear ribonucleoproteins C1/C2 P07910 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.16E-03 .
High mobility group protein B1 P09429 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.11E-04 .
Interleukin enhancer-binding factor 2 Q12905 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 4.51E-03 .
Luc7-like protein 3 O95232 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 4.88E-04 .
Mapmodulin P39687 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.72E-03 .
Myeloid leukemia factor 2 Q15773 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 3.51E-07 .
NMN/NaMN adenylyltransferase 1 Q9HAN9 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 4.51E-04 .
PDZ domain-containing protein GIPC1 O14908 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 5.55E-05 .
Peptidyl-prolyl cis-trans isomerase A P62937 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.37E-03 .
Peptidyl-prolyl cis-trans isomerase G Q13427 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 6.18E-03 .
Peptidyl-prolyl cis-trans isomerase Pin1 Q13526 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 8.07E-04 .
Peptidyl-prolyl cis-trans isomerase-like 4 Q8WUA2 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.11E-03 .
Phosphatidylethanolamine-binding protein 1 P30086 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 4.20E-03 .
Phosphoglycerate kinase 1 P00558 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 1.90E-03 .
Poly [ADP-ribose] polymerase 1 P09874 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 3.50E-04 .
Polyubiquitin-B P0CG47 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 2.24E-05 .
Polyubiquitin-C P0CG48 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 2.24E-05 .
Positive cofactor 4 P53999 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 4.83E-04 .
Pre-mRNA-splicing factor 38B Q5VTL8 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.97E-04 .
Probable ATP-dependent RNA helicase DDX17 Q92841 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.56E-03 .
Protein FAM98B Q52LJ0 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 3.97E-04 .
Protein mago nashi homolog P61326 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 2.60E-03 .
Putative RNA-binding protein Luc7-like 2 Q9Y383 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.82E-05 .
RNA binding motif protein Q96E39 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 3.62E-04 .
RNA-binding motif protein P38159 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 6.57E-05 .
RNA-binding protein 39 Q14498 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 5.06E-04 .
RNA-binding protein with serine-rich domain 1 Q15287 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 4.10E-03 .
RNA-splicing ligase RtcB homolog Q9Y3I0 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 4.65E-04 .
SAFB-like transcription modulator Q9NWH9 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 5.88E-03 .
Serine/arginine-rich splicing factor 1 Q07955 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.01E-06 .
Serine/arginine-rich splicing factor 10 O75494 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 2.65E-08 .
Serine/arginine-rich splicing factor 2 Q01130 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 7.53E-04 .
Serine/arginine-rich splicing factor 5 Q13243 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 2.61E-04 .
Serine/arginine-rich splicing factor 6 Q13247 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 5.87E-04 .
Serine/arginine-rich splicing factor 7 Q16629 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 1.33E-04 .
Serine/arginine-rich splicing factor 9 Q13242 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 4.69E-03 .
Signal recognition particle 9 kDa protein P49458 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 7.44E-03 .
Small ubiquitin-related modifier 2 P61956 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.80E-06 .
Small ubiquitin-related modifier 3 P55854 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.80E-06 .
Small ubiquitin-related modifier 4 Q6EEV6 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 1.80E-06 .
Transformer-2 protein homolog alpha Q13595 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 4.12E-04 .
Transformer-2 protein homolog beta P62995 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 2.29E-05 .
Transketolase P29401 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 8.61E-05 .
U3 snoRNA-associated protein 11 Q9Y3A2 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (+ Benzonase) = 4.75E-05 .
Ubiquitin-40S ribosomal protein S27a P62979 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 2.24E-05 .
Ubiquitin-60S ribosomal protein L40 P62987 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 2.24E-05 .
WD40 repeat-containing protein SMU1 Q2TAY7 Homo sapiens Pro Info Co-immunoprecipitation mass spectrometry (Co-IP/MS) HepaRG Cell (Human bipotent progenitor cell line) . Liver 1 h P-value (- Benzonase) = 9.06E-05 .

Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain

GO Term GO Category GO ID Adjusted P-value Odds Ratio Combined Score
RNA Binding Molecular Function GO:0003723 1.07E-44 38.89306908 4116.573232
mRNA Binding Molecular Function GO:0003729 2.93E-07 12.86846804 243.8088395
mRNA 3'-UTR Binding Molecular Function GO:0003730 0.000753191 16.57670455 177.166824
Supercoiled DNA Binding Molecular Function GO:0097100 0.003229155 187.0798122 1673.309215
pre-mRNA Binding Molecular Function GO:0036002 0.003493761 31.58730159 272.9919365
Ubiquitin-Like Protein Ligase Binding Molecular Function GO:0044389 0.010785693 6.216127841 45.58221338
DNA Binding, Bending Molecular Function GO:0008301 0.024393567 37.39342723 237.9211228
Cyclosporin A Binding Molecular Function GO:0016018 0.039148915 26.70154259 153.6957045
Single-Stranded DNA Binding Molecular Function GO:0003697 0.057511117 9.140092166 48.01904885
Cadherin Binding Molecular Function GO:0045296 0.061426878 4.592778194 23.34253131
Damaged DNA Binding Molecular Function GO:0003684 0.097228554 13.02587619 57.87972502
DNA Binding Molecular Function GO:0003677 0.097228554 2.803598311 12.45051109
Myosin Binding Molecular Function GO:0017022 0.11373976 10.76652221 44.1005339
Ubiquitin Protein Ligase Binding Molecular Function GO:0031625 0.11373976 4.268577322 17.31851184
Nuclease Activity Molecular Function GO:0004518 0.11373976 9.995472837 39.59412434
Nucleosome Binding Molecular Function GO:0031491 0.11373976 9.327230047 35.77949571
Mitogen-Activated Protein Kinase Kinase Binding Molecular Function GO:0031434 0.11373976 55.33888889 211.9631207
Signal Recognition Particle Binding Molecular Function GO:0005047 0.11373976 55.33888889 211.9631207
Double-Stranded RNA Binding Molecular Function GO:0003725 0.11373976 8.881734854 33.28658961
Phosphatidylethanolamine Binding Molecular Function GO:0008429 0.11373976 46.11342593 169.6014749
Nucleus Cellular Component GO:0005634 3.80E-15 7.589342584 283.9075392
Intracellular Membrane-Bounded Organelle Cellular Component GO:0043231 8.96E-13 6.278685048 196.2252441
Large Ribosomal Subunit Cellular Component GO:0015934 5.72E-07 38.70408825 665.3874592
Cytosolic Large Ribosomal Subunit Cellular Component GO:0022625 5.72E-07 38.70408825 665.3874592
Nucleolus Cellular Component GO:0005730 4.84E-05 5.479265611 68.35719615
Nuclear Lumen Cellular Component GO:0031981 4.84E-05 5.412429379 66.8395147
Cytosolic Small Ribosomal Subunit Cellular Component GO:0022627 0.000137838 31.16333725 346.2872601
Small Ribosomal Subunit Cellular Component GO:0015935 0.000137838 30.34172387 334.2043919
Intracellular Non-Membrane-Bounded Organelle Cellular Component GO:0043232 0.00016522 4.108781414 44.02847902
Vesicle Cellular Component GO:0031982 0.001459752 7.703056769 64.94906672
Spliceosomal snRNP Complex Cellular Component GO:0097525 0.006895574 15.77222222 106.2731092
Prespliceosome Cellular Component GO:0071010 0.006895574 43.15059588 285.511046
U2-type Prespliceosome Cellular Component GO:0071004 0.006895574 43.15059588 285.511046
Ribosome Cellular Component GO:0005840 0.006903202 14.68152709 96.03781835
U1 snRNP Cellular Component GO:0005685 0.00864668 35.05457746 218.993737
Small-Subunit Processome Cellular Component GO:0032040 0.010117237 12.15734694 73.2555351
Organelle Outer Membrane Cellular Component GO:0031968 0.013702343 6.900995285 39.07114205
U2-type Spliceosomal Complex Cellular Component GO:0005684 0.016252374 9.773399015 53.10705846
Polysomal Ribosome Cellular Component GO:0042788 0.016472255 21.56121343 115.704618
Ficolin-1-Rich Granule Lumen Cellular Component GO:1904813 0.034591865 7.073928571 32.34976218
Regulation Of mRNA Splicing, Via Spliceosome Biological Process GO:0048024 2.62E-18 64.97599302 3046.093002
mRNA Splicing, Via Spliceosome Biological Process GO:0000398 1.25E-17 33.46321244 1493.416104
mRNA Processing Biological Process GO:0006397 3.47E-16 30.40337201 1243.416567
RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile Biological Process GO:0000377 4.77E-16 33.826273 1362.894764
RNA Processing Biological Process GO:0006396 1.62E-14 30.4171798 1111.467625
RNA Splicing Biological Process GO:0008380 6.09E-12 40.45977011 1231.249873
mRNA Splice Site Recognition Biological Process GO:0006376 7.35E-12 116.6652015 3510.357678
Negative Regulation Of mRNA Splicing, Via Spliceosome Biological Process GO:0048025 4.22E-10 222.9738806 5775.965351
protein-RNA Complex Assembly Biological Process GO:0022618 4.65E-10 25.2573683 648.8768577
Negative Regulation Of mRNA Processing Biological Process GO:0050686 5.62E-10 198.1890547 5033.261171
Regulation Of Alternative mRNA Splicing, Via Spliceosome Biological Process GO:0000381 9.01E-10 54.37811966 1350.111211
Negative Regulation Of RNA Splicing Biological Process GO:0033119 2.51E-09 137.1802526 3253.565811
Spliceosomal Complex Assembly Biological Process GO:0000245 2.83E-09 45.29458689 1065.118549
Cytoplasmic Translation Biological Process GO:0002181 7.25E-08 28.73049774 580.3516452
Positive Regulation Of mRNA Splicing, Via Spliceosome Biological Process GO:0048026 7.22E-07 81.32761438 1450.235076
mRNA Metabolic Process Biological Process GO:0016071 9.50E-07 26.98970474 472.1234403
Positive Regulation Of mRNA Processing Biological Process GO:0050685 1.83E-06 63.63171355 1067.379855
Gene Expression Biological Process GO:0010467 3.95E-06 10.9007659 173.8752065
Positive Regulation Of RNA Splicing Biological Process GO:0033120 6.15E-06 47.19165085 729.2334765
Peptide Biosynthetic Process Biological Process GO:0043043 5.31E-05 13.89042745 183.9829667

Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain

Pathways Category Adjusted P-value Odds Ratio Combined Score
Spliceosome KEGG Pathway 2.68E-16 37.91570881 1500.226511
Ribosome KEGG Pathway 2.52E-10 23.87316217 599.7518875
Coronavirus disease KEGG Pathway 1.04E-08 15.82002627 332.1115326
Mitophagy KEGG Pathway 0.00114263 17.99184783 163.7564075
Base excision repair KEGG Pathway 0.001929209 28.42428571 237.4786323
RNA transport KEGG Pathway 0.004056443 8.02161196 59.59465176
Ubiquitin mediated proteolysis KEGG Pathway 0.010088188 8.436061381 53.68753311
Kaposi sarcoma-associated herpesvirus infection KEGG Pathway 0.027921318 6.054136953 31.5571605
Herpes simplex virus 1 infection KEGG Pathway 0.043949359 3.53749545 16.41774539
Shigellosis KEGG Pathway 0.048670214 4.715534795 20.64944772
Parkinson disease KEGG Pathway 0.048670214 4.657083703 20.20412827
Fluid shear stress and atherosclerosis KEGG Pathway 0.048996552 6.236659664 26.47256693
Necroptosis KEGG Pathway 0.064475265 5.431593407 21.1294216
Glycolysis / Gluconeogenesis KEGG Pathway 0.073034359 8.607583965 31.77351908
mRNA surveillance pathway KEGG Pathway 0.136370861 5.818955399 17.44464085
HIF-1 signaling pathway KEGG Pathway 0.154359083 5.217849151 14.65932298
Protein export KEGG Pathway 0.194644645 12.56628788 31.62857298
Pathways of neurodegeneration KEGG Pathway 0.217735693 2.394658297 5.621876256
Pentose phosphate pathway KEGG Pathway 0.224353091 9.529693487 21.57205509
Nicotinate and nicotinamide metabolism KEGG Pathway 0.246467279 8.12622549 17.2143184

Virus RNA Sequence Information

>NC_003977.2 Hepatitis B virus (strain ayw) genome AATTCCACAACCTTCCACCAAACTCTGCAAGATCCCAGAGTGAGAGGCCTGTATTTCCCTGCTGGTGGCT CCAGTTCAGGAACAGTAAACCCTGTTCTGACTACTGCCTCTCCCTTATCGTCAATCTTCTCGAGGATTGG GGACCCTGCGCTGAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTTCTCGTGTTACAGGCGGGG TTTTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTC TAGGGGGAACTACCGTGTGTCTTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTG TCCTCCAACTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTG CTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAG GATCCTCAACAACCAGCACGGGACCATGCCGGACCTGCATGACTACTGCTCAAGGAACCTCTATGTATCC CTCCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCCTGGGCTTTC GGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGT GGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCT GTACAGCATCTTGAGTCCCTTTTTACCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAACC CTAACAAAACAAAGAGATGGGGTTACTCTCTAAATTTTATGGGTTATGTCATTGGATGTTATGGGTCCTT GCCACAAGAACACATCATACAAAAAATCAAAGAATGTTTTAGAAAACTTCCTATTAACAGGCCTATTGAT TGGAAAGTATGTCAACGAATTGTGGGTCTTTTGGGTTTTGCTGCCCCTTTTACACAATGTGGTTATCCTG CGTTGATGCCTTTGTATGCATGTATTCAATCTAAGCAGGCTTTCACTTTCTCGCCAACTTACAAGGCCTT TCTGTGTAAACAATACCTGAACCTTTACCCCGTTGCCCGGCAACGGCCAGGTCTGTGCCAAGTGTTTGCT GACGCAACCCCCACTGGCTGGGGCTTGGTCATGGGCCATCAGCGCATGCGTGGAACCTTTTCGGCTCCTC TGCCGATCCATACTGCGGAACTCCTAGCCGCTTGTTTTGCTCGCAGCAGGTCTGGAGCAAACATTATCGG GACTGATAACTCTGTTGTCCTATCCCGCAAATATACATCGTTTCCATGGCTGCTAGGCTGTGCTGCCAAC TGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCTGCGGACGACCCTTCTCGGG GTCGCTTGGGACTCTCTCGTCCCCTTCTCCGTCTGCCGTTCCGACCGACCACGGGGCGCACCTCTCTTTA CGCGGACTCCCCGTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGCACGTCGCA TGGAGACCACCGTGAACGCCCACCAAATATTGCCCAAGGTCTTACATAAGAGGACTCTTGGACTCTCAGC AATGTCAACGACCGACCTTGAGGCATACTTCAAAGACTGTTTGTTTAAAGACTGGGAGGAGTTGGGGGAG GAGATTAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGCGCACCAGCACCATGCA ACTTTTTCACCTCTGCCTAATCATCTCTTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGG TGGCTTTGGGGCATGGACATCGACCCTTATAAAGAATTTGGAGCTACTGTGGAGTTACTCTCGTTTTTGC CTTCTGACTTCTTTCCTTCAGTACGAGATCTTCTAGATACCGCCTCAGCTCTGTATCGGGAAGCCTTAGA GTCTCCTGAGCATTGTTCACCTCACCATACTGCACTCAGGCAAGCAATTCTTTGCTGGGGGGAACTAATG ACTCTAGCTACCTGGGTGGGTGTTAATTTGGAAGATCCAGCGTCTAGAGACCTAGTAGTCAGTTATGTCA ACACTAATATGGGCCTAAAGTTCAGGCAACTCTTGTGGTTTCACATTTCTTGTCTCACTTTTGGAAGAGA AACAGTTATAGAGTATTTGGTGTCTTTCGGAGTGTGGATTCGCACTCCTCCAGCTTATAGACCACCAAAT GCCCCTATCCTATCAACACTTCCGGAGACTACTGTTGTTAGACGACGAGGCAGGTCCCCTAGAAGAAGAA CTCCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATG TTAGTATTCCTTGGACTCATAAGGTGGGGAACTTTACTGGGCTTTATTCTTCTACTGTACCTGTCTTTAA TCCTCATTGGAAAACACCATCTTTTCCTAATATACATTTACACCAAGACATTATCAAAAAATGTGAACAG TTTGTAGGCCCACTCACAGTTAATGAGAAAAGAAGATTGCAATTGATTATGCCTGCCAGGTTTTATCCAA AGGTTACCAAATATTTACCATTGGATAAGGGTATTAAACCTTATTATCCAGAACATCTAGTTAATCATTA CTTCCAAACTAGACACTATTTACACACTCTATGGAAGGCGGGTATATTATATAAGAGAGAAACAACACAT AGCGCCTCATTTTGTGGGTCACCATATTCTTGGGAACAAGATCTACAGCATGGGGCAGAATCTTTCCACC AGCAATCCTCTGGGATTCTTTCCCGACCACCAGTTGGATCCAGCCTTCAGAGCAAACACCGCAAATCCAG ATTGGGACTTCAATCCCAACAAGGACACCTGGCCAGACGCCAACAAGGTAGGAGCTGGAGCATTCGGGCT GGGTTTCACCCCACCGCACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATACTACAAACTTTG CCAGCAAATCCGCCTCCTGCCTCCACCAATCGCCAGTCAGGAAGGCAGCCTACCCCGCTGTCTCCACCTT TGAGAAACACTCATCCTCAGGCCATGCAGTGG
    Click to Show/Hide