Details of Virus RNA
Strain Information | Strain Name |
Hepatitis E virus
|
|||||||
---|---|---|---|---|---|---|---|---|---|
Strain Family |
Hepeviridae
|
||||||||
RNA Binding Site |
3'UTR
|
||||||||
Virus Information | Virus Name |
Hepatitis E virus (HEV)
|
|||||||
Taxonomy ID | 291484 |
Full list of proteins interacting with the 3'UTR of this Strain
Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
---|---|---|---|---|---|---|---|---|---|---|
26S proteasome non-ATPase regulatory subunit 7 | P51665 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
26S proteasome non-ATPase regulatory subunit 8 | P48556 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Adenylate kinase isoenzyme 1 | P00568 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Aldo-keto reductase family 1 member A1 | P14550 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Aldo-keto reductase family 1 member B1 | P15121 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Aldo-keto reductase family 1 member C4 | P17516 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
AN1-type zinc finger protein 1 | Q8TCF1 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Barrier-to-autointegration factor | O75531 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Cofilin-2 | Q9Y281 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
CTP synthase 2 | Q9NRF8 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Dephospho-CoA kinase domain-containing protein | Q8WVC6 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
DnaJ homolog subfamily C member 7 | Q99615 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
F-actin-capping protein subunit beta | P47756 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Far upstream element-binding protein 3 | Q96I24 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Fragile X messenger ribonucleoprotein 1 | Q06787 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Heat shock protein 105 kDa | Q92598 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Heterogeneous nuclear ribonucleoprotein D-like | O14979 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Histidine--tRNA ligase | P49590 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Histone H3.1 | P68431 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Hypoxanthine-guanine phosphoribosyltransferase | P00492 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Importin subunit alpha-3 | O00629 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Importin subunit alpha-6 | O15131 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Keratin | Q14532 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
L-lactate dehydrogenase C chain | P07864 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
OGCP | Q02978 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Omega-amidase NIT2 | Q9NQR4 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Parvulin-14 | Q9Y237 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Phosphopentomutase | Q96G03 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Poly [ADP-ribose] polymerase tankyrase-2 | Q9H2K2 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Rho GDP-dissociation inhibitor 1 | P52565 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
RNA-binding protein 27 | Q9P2N5 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
RuvB-like 2 | Q9Y230 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Septin-11 | Q9NVA2 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Septin-14 | Q6ZU15 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Septin-7 | Q16181 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Sorting nexin-2 | O60749 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Sterol carrier protein 2 | P22307 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Superoxide dismutase [Cu-Zn] | P00441 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
T-complex protein 1 subunit theta | P50990 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Tight junction protein ZO-1 | Q07157 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Transcription factor p65 | Q04206 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Transmembrane emp24 domain-containing protein 9 | Q9BVK6 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Transportin-1 | Q92973 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Transportin-2 | O14787 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Tropomyosin alpha-1 chain | P09493 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Tropomyosin beta chain | P07951 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Tubulin alpha-3C chain | P0DPH7 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Uncharacterized protein C6orf132 | Q5T0Z8 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Uncharacterized protein KIAA1143 | Q96AT1 | Homo sapiens | Pro Info | RNA-protein interaction detection (RaPID) assay coupled to liquid chromatography with tandem mass spectrometry (LC-MS/MS) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | . | . | . |
Functional Go Enrichment analysis of those proteins interacting with the 3'UTR of this Strain
Functional KEGG Enrichment analysis of those proteins interacting with the 3'UTR of this Strain
Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
---|---|---|---|---|
Glycolysis / Gluconeogenesis | KEGG Pathway | 0.00410419 | 25.24825397 | 261.2633067 |
Primary bile acid biosynthesis | KEGG Pathway | 0.060680845 | 51.10512821 | 355.7433228 |
Pathogenic Escherichia coli infection | KEGG Pathway | 0.068086521 | 8.187772021 | 51.02612332 |
Alzheimer disease | KEGG Pathway | 0.068086521 | 5.48945952 | 31.64528123 |
Galactose metabolism | KEGG Pathway | 0.068086521 | 26.41511936 | 152.0405762 |
HIF-1 signaling pathway | KEGG Pathway | 0.068086521 | 11.0099889 | 63.27712357 |
Pentose and glucuronate interconversions | KEGG Pathway | 0.069447201 | 23.93509615 | 133.3976779 |
Salmonella infection | KEGG Pathway | 0.072759121 | 6.432979592 | 34.68407435 |
Purine metabolism | KEGG Pathway | 0.072759121 | 9.253034547 | 48.81352036 |
Prion disease | KEGG Pathway | 0.076332203 | 5.851895911 | 29.66236621 |
Proteasome | KEGG Pathway | 0.076332203 | 17.39685315 | 86.66326217 |
Pyruvate metabolism | KEGG Pathway | 0.076332203 | 17.00940171 | 84.02277023 |
Pathways of neurodegeneration | KEGG Pathway | 0.085248998 | 4.228397742 | 19.91848207 |
Huntington disease | KEGG Pathway | 0.085248998 | 5.203708609 | 24.32812794 |
Glycerolipid metabolism | KEGG Pathway | 0.100919295 | 12.96414602 | 57.52728575 |
Epithelial cell signaling in Helicobacter pylori infection | KEGG Pathway | 0.120931801 | 11.24321267 | 46.9456383 |
Amyotrophic lateral sclerosis | KEGG Pathway | 0.120931801 | 4.352444444 | 17.80986585 |
Epstein-Barr virus infection | KEGG Pathway | 0.120931801 | 5.837126811 | 23.69391643 |
Pertussis | KEGG Pathway | 0.120931801 | 10.32848233 | 41.52173636 |
Peroxisome | KEGG Pathway | 0.132504595 | 9.550961538 | 37.03324157 |
Full list of Host ncRNAs interacting with the Virus RNA
HncRNA | Host Species | HncRNA Detail | PMID | Source | Target Gene | Target Gene ID | Target Gene Source | PMID | Source |
---|---|---|---|---|---|---|---|---|---|
hsa-miR-298 | Homo sapiens | HncRNA Info | 32751663 | ViRBase | CDKN1A | . | miRSponge | 20190813 | miRSponge |
hsa-miR-328-5p | Homo sapiens | HncRNA Info | 32751663 | ViRBase | CD44 | . | miRTarBase | 27923017 | miRTarBase |
hsa-miR-539-5p | Homo sapiens | HncRNA Info | 32751663 | ViRBase | ZEB1 | . | miRTarBase | 23105110 | miRTarBase |
Host ncRNA GO Enrichment
Host ncRNA KEGG Pathway Enrichment
Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
---|---|---|---|---|
MicroRNAs in cancer | KEGG Pathway | 0.000154904 | 59070 | 738987.7876 |
Prostate cancer | KEGG Pathway | 0.001462004 | 418.9894737 | 4010.763952 |
Transcriptional misregulation in cancer | KEGG Pathway | 0.002616879 | 208.4947368 | 1710.684814 |
Epstein-Barr virus infection | KEGG Pathway | 0.002616879 | 197.97 | 1604.242255 |
Proteoglycans in cancer | KEGG Pathway | 0.002616879 | 195.0147783 | 1574.550198 |
Thyroid cancer | KEGG Pathway | 0.028848074 | 277.2361111 | 1440.455342 |
Bladder cancer | KEGG Pathway | 0.028848074 | 249.4625 | 1270.591461 |
Endometrial cancer | KEGG Pathway | 0.028848074 | 174.9122807 | 830.3601395 |
Basal cell carcinoma | KEGG Pathway | 0.028848074 | 160.766129 | 749.9503377 |
Renal cell carcinoma | KEGG Pathway | 0.028848074 | 146.5367647 | 670.285691 |
Melanoma | KEGG Pathway | 0.028848074 | 140.3239437 | 635.916039 |
Non-small cell lung cancer | KEGG Pathway | 0.028848074 | 140.3239437 | 635.916039 |
p53 signaling pathway | KEGG Pathway | 0.028848074 | 138.3680556 | 625.1507651 |
Glioma | KEGG Pathway | 0.028848074 | 134.6148649 | 604.5687465 |
Pancreatic cancer | KEGG Pathway | 0.028848074 | 132.8133333 | 594.7253886 |
Chronic myeloid leukemia | KEGG Pathway | 0.028848074 | 132.8133333 | 594.7253886 |
ErbB signaling pathway | KEGG Pathway | 0.028848074 | 118.5297619 | 517.5526779 |
Colorectal cancer | KEGG Pathway | 0.028848074 | 117.1294118 | 510.0740472 |
ECM-receptor interaction | KEGG Pathway | 0.028848074 | 114.4252874 | 495.6790189 |
Small cell lung cancer | KEGG Pathway | 0.028848074 | 109.3736264 | 468.9557624 |
Virus RNA Sequence Information
>NC_001434.1 Hepatitis E virus, complete genome
GCCATGGAGGCCCATCAGTTTATTAAGGCTCCTGGCATCACTACTGCTATTGAGCAGGCTGCTCTAGCAG
CGGCCAACTCTGCCCTTGCGAATGCTGTGGTAGTTAGGCCTTTTCTCTCTCACCAGCAGATTGAGATCCT
TATTAACCTAATGCAACCTCGCCAGCTTGTTTTCCGCCCCGAGGTTTTCTGGAACCATCCCATCCAGCGT
GTTATCCATAATGAGCTGGAGCTTTACTGTCGCGCCCGTTCCGGCCGCTGCCTTGAAATTGGTGCCCACC
CCCGCTCAATAAATGATAACCCTAATGTGGTCCACCGCTGCTTCCTCCGCCCTGCCGGGCGTGATGTTCA
GCGTTGGTATACTGCCCCTACCCGCGGGCCGGCTGCTAATTGCCGGCGTTCCGCACTGCGCGGGCTCCCC
GCTGCTGACCGCACTTACTGCTTCGACGGGTTTTCTGGCTGTAACTTTCCCGCCGAGACTGGCGTCGCCC
TCTATTCTCTCCATGATATGTCACCATCTGATGTCGCCGAGGCTATGTTCCGCCATGGTATGACGCGGCT
TTACGCTGCCCTCCACCTCCCGCCTGAGGTCCTGTTGCCCCCTGGCACATACCGCACCGCGTCGTACTTG
CTGATCCATGACGGCAGGCGCGTTGTGGTGACGTATGAGGGTGACACTAGTGCTGGTTATAACCACGATG
TTTCCAACCTGCGCTCCTGGATTAGAACCACTAAGGTTACCGGAGACCATCCTCTCGTCATTGAGCGGGT
TAGGGCCATTGGCTGCCACTTTGTCCTCTTACTCACGGCAGCCCCGGAGCCATCACCTACGCCCTATGTT
CCTTACCCCCGGTCTACCGAGGTCTATGTCCGATCGATCTTCGGCCCGGGTGGTACCCCCTCCCTATTTC
CAACCTCATGCTCCACTAAGTCGACCTTCCATGCTGTCCCTGCCCATATCTGGGACCGTCTCATGTTGTT
CGGGGCCACCCTAGATGACCAAGCCTTTTGCTGCTCCCGCCTAATGACTTACCTCCGTGGCATTAGCTAC
AAGGTTACTGTGGGCACCCTTGTTGCCAATGAAGGCTGGAACGCCTCTGAGGTCGCTCTTACAGCTGTCA
TCACTGCCGCCTACCTTACCATCTGCCACCAGCGGTACCTCCGCACTCAGGCTATATCTAAGGGGATGCG
CCGTCTGGAGCGGGAGCATGCTCAGAAGTTTATAACACGCCTCTACAGTTGGCTCTTTGAGAAGTCCGGC
CGTGATTATATCCCCGGCCGTCAGTTGGAGTTCTACGCTCAGTGTAGGCGCTGGCTCTCGGCCGGCTTTC
ATCTTGACCCACGGGTGTTGGTTTTTGATGAGTCGGCCCCCTGCCACTGTAGGACTGCGATTCGTAAGGC
GGTCTCAAAGTTTTGCTGTTTTATGAAGTGGCTGGGCCAGGAGTGCACCTGTTTCCTACAACCTGCAGAA
GGCGCCGTCGGCGACCAGGGCCATGACAACGAGGCCTATGAGGGGTCTGATGTCGACCCCGCTGAATCCG
CTATTAGTGACATATCTGGGTCCTACGTCGTCCCTGGCACTGCCCTCCAACCGCTTTACCAAGCCCTTGA
CCTCCCCGCTGAGATTGTGGCTCGTGCAGGCCGGCTGACCGCCACAGTAAAGGTCTCCCAGGTCGACGGG
CGGATCGATTGTGAGACCCTTCTCGGTAATAAAACCTTCCGCACGTCGTTTGTTGACGGGGCGGTTTTAG
AGACTAATGGCCCAGAGCGCCACAATCTCTCTTTTGATGCCAGTCAGAGCACTATGGCCGCCGGCCCTTT
CAGTCTCACCTATGCCGCCTCTGCTGCTGGGCTGGAGGTGCGCTATGTCGCTGCCGGGCTTGACCACCGG
GCGGTTTTTGCCCCCGGCGTTTCACCCCGGTCAGCCCCTGGCGAGGTCACCGCCTTTTGTTCTGCCCTAT
ACAGGTTTAATCGCGAGGCCCAGCGCCTTTCGCTCACCGGTAATTTTTGGTTCCATCCTGAGGGGCTCCT
TGGCCCCTTTGCCCCGTTTTCCCCCGGGCATGTTTGGGAGTCGGCTAATCCATTCTGTGGAGAGAGCACA
CTTTACACCCGCACTTGGTCGGAGGTTGATGCTGTTTCTAGTCCAGCCCAGCCCGACTTAGGTTTTATAT
CTGAGCCTTCTATACCTAGTAGGGCCGCCACACTTACCCCGGCGGCCCCTCTACCCCCCCCTGCACCGGA
TCCTTCCCCTACTCCCTCTGCTCCGGCGCGTGGTGAGCCGGCTCCTGGCGCTACCGCCCGGGCCCCGGCC
ATAACCCACCAGGCGGCCCGGCATCGCCGCCTGCTCTTTACCTACCCGGATGGCTCTAAGGTATTCGCCG
GCTCGCTGTTTGAGTCGACATGTACCTGGCTCGTTAACGCGTCTAATGTTGACCACCGCCCTGGCGGTGG
GCTCTGTCATGCATTTTACCAAAGGTACCCCGCATCCTTTGATGCTGCCTCTTTTGTGATGCGCGACGGC
GCGGCCGCCTATACATTAACCCCCCGGCCAATAATTCACGCCGTCGCTCCTGATTATAGGTTGGAACATA
ACCCAAAGATGCTTGAGGCTGCCTACCGGGAGACTTGCTCCCGCCTCGGTACCGCTGCATACCCACTCCT
CGGGACCGGCATATACCAGGTGCCGATCGGTCCCAGTTTTGACGCCTGGGAGCGGAATCACCGCCCCGGG
GATGAGTTGTACCTTCCTGAGCTTGCTGCCAGATGGTTCGAGGCCAATAGGCCGACCTGCCCAACTCTCA
CTATAACTGAGGATGTTGCACGGACAGCAAATCTGGCTATCGAACTTGACTCAGCCACAGACGTCGGCCG
GGCCTGTGCCGGCTGTCGAGTCACCCCCGGCGTTGTGCAGTACCAGTTTACCGCAGGTGTGCCTGGATCC
GGCAAGTCCCGCTCTATTACCCAAGCCGACGTGGACGTTGTCGTGGTCCCGACCCGTGAGTTGCGTAATG
CCTGGCGCCGCCGCGGCTTCGCTGCTTTCACCCCGCACACTGCCGCCAGAGTCACCCAGGGGCGCCGGGT
TGTCATTGATGAGGCCCCGTCCCTTCCCCCTCACTTGCTGCTGCTCCACATGCAGCGGGCCGCCACCGTC
CACCTTCTTGGTGACCCGAATCAGATCCCAGCCATCGACTTTGAGCACGCCGGGCTCGTTCCCGCCATCA
GGCCCGATTTGGCCCCCACCTCCTGGTGGCATGTGACCCATCGCTGCCCTGCGGATGTATGTGAGCTGAT
CCGTGGCGCATACCCTATGATTCAGACCACTAGTCGGGTCCTCCGGTCGTTGTTCTGGGGTGAGCCTGCT
GTTGGGCAGAAACTAGTGTTCACCCAGGCAGCTAAGGCCGCCAACCCCGGTTCAGTGACGGTCCATGAGG
CACAGGGCGCTACCTACACAGAGACTACCATTATTGCCACGGCAGATGCTCGAGGCCTCATTCAGTCGTC
CCGAGCTCATGCCATTGTTGCCTTGACGCGCCACACTGAGAAGTGCGTCATCATTGACGCACCAGGCCTG
CTTCGCGAGGTGGGCATCTCCGATGCAATCGTTAATAACTTTTTCCTTGCTGGTGGCGAAATTGGCCACC
AGCGCCCATCTGTTATCCCTCGCGGCAATCCTGACGCCAATGTTGACACCTTGGCTGCCTTCCCGCCGTC
TTGCCAGATTAGCGCCTTCCATCAGTTGGCTGAGGAGCTTGGCCACAGACCTGCCCCTGTCGCGGCTGTT
CTACCGCCCTGCCCTGAGCTTGAACAGGGCCTTCTCTACCTGCCCCAAGAACTCACCACCTGTGATAGTG
TCGTAACATTTGAATTAACAGATATTGTGCACTGTCGTATGGCCGCCCCGAGCCAGCGCAAGGCCGTGCT
GTCCACGCTTGTGGGCCATTACGGCCGCCGCACAAAGCTCTACAATGCCTCCCACTCTGATGTTCGCGAC
TCTCTCGCCCGTTTTATCCCGGCCATTGGCCACGTACAGGTTACAACCTGTGAATTGTACGAGCTAGTGG
AGGCCATGGTCGAGAAGGGCCAGGACGGCTCCGCCGTCCTTGAGCTCGACCTTTGTAACCGCGACGTGTC
CAGGATCACCTTCTTCCAGAAAGATTGTAATAAATTCACCACGGGGGAGACCATCGCCCATGGTAAAGTG
GGCCAGGGCATTTCGGCCTGGAGTAAGACCTTCTGTGCCCTTTTCGGCCCCTGGTTCCGTGCTATTGAGA
AGGCTATCCTGGCCCTGCTCCCTCAGGGTGTGTTTTATGGGGATGCCTTTGATGACACCGTCTTCTCGGC
GGCTGTGGCCGCAGCAAGGGCATCCATGGTGTTTGAGAATGACTTTTCTGAGTTTGATTCCACCCAGAAT
AATTTTTCCTTGGGCCTAGAGTGTGCTATTATGGTGGAGTGTGGGATGCCGCAGTGGCTCATCCGCTTGT
ACCACCTTATAAGGTCTGCGTGGATTCTGCAGGCCCCGAAGGAGTCCCTGCGAGGGTTTTGGAAGAAACA
CTCCGGTGAGCCCGGCACCCTTCTATGGAATACAGTCTGGAACATGGCCGTTATCACCCACTGTTATGAT
TTCCGCGATCTGCAGGTGGCCGCCTTTAAAGGTGATGATTCGATAGTGCTTTGCAGTGAGTACCGTCAGA
GCCCAGGGGCTGCTGTCCTGATTGCTGGCTGTGGCCTAAAGTTGAAGGTGGATTTCCGTCCGATTGGTTT
GTATGCAGGTGTTGTGGTGGCCCCCGGCCTTGGCGCGCTTCCTGACGTCGTGCGCTTCGCCGGCCGGCTT
ACTGAGAAGAATTGGGGCCCTGGCCCCGAGCGGGCGAAGCAGCTCCGCCTCGCTGTGAGTGATTTTCTCC
GCAAGCTCACGAATGTAGCTCAGATGTGTGTGGATGTTGTCTCTCGTGTTTATGGGGTTTCCCCTGGACT
CGTTCATAACCTGATTGGCATGCTACAGGCTGTTGCTGACGGCAAGGCTCATTTCACTGAGTCAGTGAAG
CCAGTGCTCGACCTGACAAATTCAATCCTGTGTCGGGTGGAATGAATAACATGTCTTCTGCTGCGCCCAT
GGGTTCGCGACCATGCGCCCTCGGCCTATTTTGCTGTTGCTCCTCATGTTTCTGCCTATGCTGCCCGCGC
CACCGCCCGGTCAGCCGTCTGGCCGCCGCCGTGGGCGGCGCAGCGGCGGTTCCGGCGGTGGTTTCTGGGG
TGACCGGGCTGATTCTCAGCCCTTCGCAATCCCCTATATTCATCCAACCAACCCCTTCGCCCCCGATGTC
ACCGCTGCGGCCGGGGCTGGACCTCGTGTTCGCCAACCCGCCCGACCACTCGGCTCCGCTTGGCGTGACC
AGGCCCAGCGCCCCGCCGCTGCCTCACGTCGTAGACCTACCACAGCTGGGGCCGCGCCGCTAACCGCGGT
CGCTCCGGCCCATGACACCCCGCCAGTGCCTGATGTTGACTCCCGCGGCGCCATCCTGCGCCGGCAGTAT
AACCTATCAACATCTCCCCTTACCTCTTCCGTGGCCACCGGTACAAACTTGGTTCTTTACGCCGCTCCTC
TTAGCCCGCTTCTACCCCTCCAGGACGGCACCAATACTCATATAATGGCTACAGAAGCTTCTAATTATGC
CCAGTACCGGGTTGTTCGTGCTACAATTCGCTACCGCCCGCTGGTCCCCAACGCTGTTGGTGGCTACGCC
ATCTCCATCTCGTTCTGGCCACAGACCACCACCACCCCGACGTCCGTTGACATGAATTCAATAACCTCGA
CTGATGTTCGTATTTTAGTCCAGCCCGGCATAGCCTCCGAGCATGTTATCCCAAGTGAGCGCCTACACTA
TCGTAACCAAGGTTGGCGCTCTGTTGAGACCTCCGGGGTGGCGGAGGAGGAGGCCACCTCTGGTCTTGTT
ATGCTTTGCATACATGGCTCACTCGTAAACTCTTATACTAATACACCTTATACCGGTGCCCTCGGGCTGT
TGGACTTTGCCCTCGAACTTGAGTTCCGCAACCTCACCCCCGGTAATACCAACACGCGGGTCTCCCGTTA
CTCCAGCACTGCCCGTCACCGCCTTCGTCGCGGTGCAGATGGGACTGCCGAGCTCACCACCACGGCTGCT
ACCCGCTTCATGAAGGACCTCTATTTTACTAGTACTAATGGTGTCGGTGAGATCGGCCGCGGGATAGCGC
TTACCCTGTTTAACCTTGCTGACACCCTGCTTGGCGGTCTACCGACAGAATTGATTTCGTCGGCTGGTGG
CCAGCTGTTCTACTCTCGCCCCGTCGTCTCAGCCAATGGCGAGCCGACTGTTAAGCTGTATACATCTGTA
GAGAATGCTCAGCAGGATAAGGGTATTGCAATCCCGCATGACATCGACCTCGGGGAATCTCGTGTAGTTA
TTCAGGATTATGATAACCAACATGAGCAGGACCGACCGACACCTTCCCCAGCCCCATCGCGCCCCTTTTC
TGTCCTCCGAGCTAATGATGTGCTTTGGCTTTCTCTCACCGCTGCCGAGTATGACCAGTCCACTTACGGC
TCTTCGACCGGCCCAGTCTATGTCTCTGACTCTGTGACCTTGGTTAATGTAGCGACCGGCGCGCAGGCCG
TTGCCCGGTCGCTCGACTGGACCAAGGTCACACTTGATGGTCGCCCCCTTTCCACCACCCAGCAGTATTC
AAAGACCTTCTTTGTCCTGCCGCTCCGCGGTAAGCTCTCCTTTTGGGAGGCAGGTACTACTAAAGCCGGG
TACCCTTATAATTATAACACCACTGCTAGTGACCAACTGCTCGTTGAGAATGCCGCTGGGCATCGGGTTG
CTATTTCCACTTACACCACTAGCCTGGGTGCTGGCCCCGTCTCTATTTCCGCGGTTGCTGTTTTAGCCCC
CCACTCTGCGCTAGCATTGCTTGAGGATACCATGGACTACCCTGCCCGCGCCCATACTTTCGATGACTTC
TGCCCGGAGTGCCGCCCCCTTGGCCTCCAGGGCTGTGCTTTTCAGTCTACTGTCGCTGAGCTTCAGCGCC
TTAAGATGAAGGTGGGTAAAACTCGGGAGTTATAGTTTATTTGCTTGTGCCCCCCTTCTTTCTGTTGCTT
ATTTCTCATTTCTGCGTTCCGCGCTCCCTGAAAAAA
Click to Show/Hide
|