Strain Information Strain Name
Poliovirus
Strain Family
Picornaviridae
RNA Binding Site
5'UTR - 3'UTR
  Virus Information Virus Name
Poliovirus (PV)
Taxonomy ID 12637
GeneBank ID KF907503

Protein Name Uniprot ID Host Species Pro Info Detection Method Infection Cell Cell ID Cell Originated Tissue Infection Time Interaction Score Fold Change
A-kinase anchor protein 8 O43823 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
ATP-dependent RNA helicase A Q08211 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Bcl-2-associated transcription factor 1 Q9NYF8 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Cold shock domain-containing protein E1 O75534 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Cyclic AMP-responsive element-binding protein 1 P16220 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
DBIRD complex subunit ZNF326 Q5BKZ1 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Dystrophin P11532 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
E1B-55 kDa-associated protein 5 Q9BUJ2 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
eIF-4-gamma 1 Q04637 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
eIF-4-gamma 3 O43432 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
Eukaryotic initiation factor 4A-I P60842 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
Far upstream element-binding protein 2 Q92945 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
GAP-associated tyrosine phosphoprotein p62 Q07666 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Helicase with 2 CARD domains Q9BYX4 Homo sapiens Pro Info . B95a Cells (Marmoset lymphoblastoid cell line) . . . . .
Heterogeneous nuclear ribonucleoprotein A0 Q13151 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Heterogeneous nuclear ribonucleoprotein A3 P51991 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Heterogeneous nuclear ribonucleoprotein D-like O14979 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Heterogeneous nuclear ribonucleoprotein D0 Q14103 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Heterogeneous nuclear ribonucleoprotein K P61978 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Heterogeneous nuclear ribonucleoprotein L P14866 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Heterogeneous nuclear ribonucleoprotein L-like Q8WVV9 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Heterogeneous nuclear ribonucleoprotein Q O60506 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Heterogeneous nuclear ribonucleoprotein R O43390 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Heterogeneous nuclear ribonucleoprotein U Q00839 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Heterogeneous nuclear ribonucleoproteins C1/C2 P07910 Homo sapiens Pro Info UV cross-linking (UVX) and liquid chromatography-tandem mass spectrometry (LC-MS/MS) HeLa Cells (Human cervical carcinoma cell) . Cervix . . .
Heterogeneous nuclear ribonucleoproteins C1/C2 P07910 Homo sapiens Pro Info UV cross-linking (UVX) and liquid chromatography-tandem mass spectrometry (LC-MS/MS) HeLa Cells (Human cervical carcinoma cell) . Cervix . . .
Heterogeneous nuclear ribonucleoproteins C1/C2 P07910 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Histone H2B type 1-D P58876 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Importin subunit alpha-1 P52292 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Interleukin enhancer-binding factor 2 Q12905 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Interleukin enhancer-binding factor 3 Q12906 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
La-related protein 1 Q6PKG0 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Lupus La protein P05455 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
Lupus La protein P05455 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Microtubule-associated protein 4 P27816 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
Myb-binding protein 1A Q9BQG0 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
NonO protein Q15233 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Nucleolar protein 1 P46087 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Nucleolar RNA helicase 2 Q9NR30 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Nucleolin P19338 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Nucleolysin TIA-1 isoform p40 P31483 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Nucleolysin TIAR Q01085 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
PAI1 RNA-binding protein 1 Q8NC51 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Peptidyl-prolyl cis-trans isomerase A P62937 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Poly(rC)-binding protein 1 Q15365 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
Poly(rC)-binding protein 1 Q15365 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Poly(rC)-binding protein 2 Q15366 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
Poly(rC)-binding protein 2 Q15366 Homo sapiens Pro Info Electrophoretic mobility shift assay (EMSA) HeLa Cells (Human cervical carcinoma cell) . Cervix . . .
Poly(rC)-binding protein 2 Q15366 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Polyadenylate-binding protein 1 P11940 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
Polyadenylate-binding protein 1 P11940 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Polypyrimidine tract-binding protein 1 P26599 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
Polypyrimidine tract-binding protein 1 P26599 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Polypyrimidine tract-binding protein 1 P26599 Homo sapiens Pro Info UV cross-linking (UVX) HeLa S3 Cells (Human cervical carcinoma cell) . Cervix . . .
Polyubiquitin-B P0CG47 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
POU domain P14859 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
Probable ATP-dependent RNA helicase DDX17 Q92841 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Probable ATP-dependent RNA helicase DDX5 P17844 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Proliferation-associated protein 2G4 Q9UQ80 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Protein FAM98A Q8NCA5 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Ras GTPase-activating protein-binding protein 2 Q9UN86 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Ribonucleases P/MRP protein subunit POP1 Q99575 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Ribosomal L1 domain-containing protein 1 O76021 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
RNA-binding motif protein P38159 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
RNA-binding protein 28 Q9NW13 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
RNA-binding protein 39 Q14498 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
RNA-binding protein 4 Q9BWF3 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
RNA-binding protein 47 A0AV96 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
RNA-binding protein EWS Q01844 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
RNA-binding protein FUS P35637 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
RNA-binding protein FXR1 P51114 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
RNA-binding protein FXR2 P51116 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
RNA-binding protein Raly Q9UKM9 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
rRNA 2'-O-methyltransferase fibrillarin P22087 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
SAFB-like transcription modulator Q9NWH9 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Scaffold-attachment factor A2 Q1KMD3 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Serine/arginine-rich splicing factor 1 Q07955 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Serine/arginine-rich splicing factor 10 O75494 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Serine/arginine-rich splicing factor 2 Q01130 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Serine/arginine-rich splicing factor 3 P84103 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Serine/arginine-rich splicing factor 5 Q13243 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Serine/arginine-rich splicing factor 6 Q13247 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Serine/arginine-rich splicing factor 7 Q16629 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Serine/arginine-rich splicing factor 9 Q13242 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Splicing factor P23246 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Splicing factor 3B subunit 4 Q15427 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Splicing factor U2AF 65 kDa subunit P26368 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
TATA-binding protein-associated factor 2N Q92804 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
TATA-box-binding protein P20226 Homo sapiens Pro Info Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting with anti-PCBP polyclonal anti serum HeLa Cells (Human cervical carcinoma cell) . Cervix 7 h . .
Transcriptional activator protein Pur-alpha Q00577 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Transformer-2 protein homolog beta P62995 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Ubiquitin-associated protein 2-like Q14157 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
X-ray repair cross-complementing protein 5 P13010 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
X-ray repair cross-complementing protein 6 P12956 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Y-box-binding protein 1 P67809 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Zinc finger CCCH-type antiviral protein 1 Q7Z2W4 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Zinc finger protein 638 Q14966 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Zinc finger protein 9 P62633 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
Zinc finger RNA-binding protein Q96KR1 Homo sapiens Pro Info Thiouracil cross-linking mass spectrometry (TUX-MS) HeLa Cells (Human cervical carcinoma cell) . Cervix 5 h . .
GO Term GO Category GO ID Adjusted P-value Odds Ratio Combined Score
RNA Binding Molecular Function GO:0003723 8.68E-88 196.0527506 40239.05798
mRNA Binding Molecular Function GO:0003729 2.29E-43 56.03427031 5730.503074
mRNA 3'-UTR Binding Molecular Function GO:0003730 1.34E-21 60.77469358 3144.563174
Single-Stranded RNA Binding Molecular Function GO:0003727 1.03E-13 75.29166667 2507.193464
pre-mRNA Binding Molecular Function GO:0036002 1.58E-13 105.2328042 3435.376165
Poly-Pyrimidine Tract Binding Molecular Function GO:0008187 2.63E-10 93.2021419 2334.401902
DNA Binding Molecular Function GO:0003677 1.42E-08 6.601176064 137.9970921
Double-Stranded RNA Binding Molecular Function GO:0003725 2.47E-07 28.86663897 517.112978
poly Binding Molecular Function GO:0008143 1.08E-06 58.5 954.805852
Poly-Purine Tract Binding Molecular Function GO:0070717 3.04E-06 44.98642534 682.9021227
Telomeric DNA Binding Molecular Function GO:0042162 3.83E-06 41.76890756 620.3961591
poly RNA Binding Molecular Function GO:0008266 2.61E-05 51.4005168 660.3085935
mRNA 3'-UTR AU-rich Region Binding Molecular Function GO:0035925 2.91E-05 48.69277846 616.3884551
mRNA 5'-UTR Binding Molecular Function GO:0048027 3.23E-05 46.25581395 577.2651762
Double-Stranded Telomeric DNA Binding Molecular Function GO:0003691 3.85E-05 137.2758621 1679.650581
Basal RNA Polymerase II Transcription Machinery Binding Molecular Function GO:0001099 0.000150445 28.89244186 312.2825049
Regulatory RNA Binding Molecular Function GO:0061980 0.00026357 24.32313341 247.7822161
Single-Stranded DNA Binding Molecular Function GO:0003697 0.000482839 12.81124758 122.0217328
RNA Cap Binding Molecular Function GO:0000339 0.000507585 42.875 403.9052768
miRNA Binding Molecular Function GO:0035198 0.001760111 26.37135279 214.2875424
Nucleus Cellular Component GO:0005634 5.38E-28 13.11110317 880.0242076
Intracellular Membrane-Bounded Organelle Cellular Component GO:0043231 3.12E-24 10.84006352 626.1498496
Cytoplasmic Stress Granule Cellular Component GO:0010494 2.00E-14 47.70673077 1658.932537
Nuclear Lumen Cellular Component GO:0031981 8.19E-14 9.758023434 322.7766086
Nucleolus Cellular Component GO:0005730 4.91E-13 9.328465377 289.7750253
Intracellular Non-Membrane-Bounded Organelle Cellular Component GO:0043232 1.07E-10 6.512858212 166.0781689
B-WICH Complex Cellular Component GO:0110016 0.003223191 113.1022727 918.6400252
Euchromatin Cellular Component GO:0000791 0.009701469 16.71068124 115.0826143
Filopodium Cellular Component GO:0030175 0.019808181 12.01028433 71.93351933
Endoribonuclease Complex Cellular Component GO:1902555 0.019808181 30.14393939 179.3506662
Chromosome Cellular Component GO:0005694 0.041012351 5.74127907 28.95937667
U12-type Spliceosomal Complex Cellular Component GO:0005689 0.041012351 17.38111888 86.20454429
Polysomal Ribosome Cellular Component GO:0042788 0.041012351 17.38111888 86.20454429
Secretory Granule Lumen Cellular Component GO:0034774 0.076403972 3.707017212 15.80448459
Cytoplasmic Vesicle Lumen Cellular Component GO:0060205 0.076736866 6.09544335 25.54025005
Ficolin-1-Rich Granule Lumen Cellular Component GO:1904813 0.085948601 5.686781609 22.81622337
Nuclear Stress Granule Cellular Component GO:0097165 0.099696171 55.91573034 212.6557985
Spliceosomal snRNP Complex Cellular Component GO:0097525 0.114980675 8.204545455 29.56387179
Ribosome Cellular Component GO:0005840 0.118112874 7.646764253 26.59593512
RISC-loading Complex Cellular Component GO:0070578 0.118112874 37.27340824 129.3803096
Regulation Of mRNA Splicing, Via Spliceosome Biological Process GO:0048024 1.35E-33 103.0649351 8475.857027
mRNA Splicing, Via Spliceosome Biological Process GO:0000398 1.99E-26 40.78577337 2652.577054
mRNA Processing Biological Process GO:0006397 7.54E-25 37.74162679 2302.177146
RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile Biological Process GO:0000377 1.45E-23 40.44527178 2335.769526
RNA Processing Biological Process GO:0006396 1.70E-23 39.68560468 2276.948956
Regulation Of Alternative mRNA Splicing, Via Spliceosome Biological Process GO:0000381 1.17E-21 104.5894737 5538.694392
mRNA Stabilization Biological Process GO:0048255 9.15E-18 83.86688312 3676.704166
Regulation Of RNA Splicing Biological Process GO:0043484 1.84E-15 41.49342105 1593.460438
Positive Regulation Of Translation Biological Process GO:0045727 3.76E-15 38.8331467 1458.945639
mRNA Metabolic Process Biological Process GO:0016071 5.01E-15 46.51767677 1729.370943
Regulation Of Translation Biological Process GO:0006417 4.57E-14 22.92821854 799.54299
Negative Regulation Of mRNA Catabolic Process Biological Process GO:1902373 1.19E-13 80.15725806 2711.647673
Negative Regulation Of mRNA Splicing, Via Spliceosome Biological Process GO:0048025 4.93E-12 239.7951807 7181.592131
Positive Regulation Of Cytoplasmic Translation Biological Process GO:2000767 4.93E-12 239.7951807 7181.592131
Negative Regulation Of mRNA Processing Biological Process GO:0050686 8.60E-12 209.810241 6152.448619
Regulation Of mRNA Stability Biological Process GO:0043488 5.06E-11 38.76171875 1065.425921
Negative Regulation Of RNA Splicing Biological Process GO:0033119 5.65E-11 139.8453815 3815.033805
CRD-mediated mRNA Stabilization Biological Process GO:0070934 5.65E-11 355.4642857 9689.658771
Negative Regulation Of Translation Biological Process GO:0017148 6.56E-11 28.73866034 777.5555097
RNA Metabolic Process Biological Process GO:0016070 9.38E-11 27.5835443 735.0213258

Pathways Category Adjusted P-value Odds Ratio Combined Score
Spliceosome KEGG Pathway 8.95E-21 40.40436512 2039.608771
RNA transport KEGG Pathway 7.30E-05 10.81501781 142.2117188
Herpes simplex virus 1 infection KEGG Pathway 0.010122632 4.412860713 34.47263838
Non-homologous end-joining KEGG Pathway 0.028357578 41.11363636 266.9942047
Viral myocarditis KEGG Pathway 0.037580247 12.01028433 71.93351933
Transcriptional misregulation in cancer KEGG Pathway 0.122117348 4.879267689 21.97001732
Ribosome biogenesis in eukaryotes KEGG Pathway 0.122117348 6.50410509 28.34336567
Viral carcinogenesis KEGG Pathway 0.122117348 4.606988431 19.88024767
Ferroptosis KEGG Pathway 0.122117348 11.57983683 48.90207198
Basal transcription factors KEGG Pathway 0.131161776 10.50052854 42.48752004
Influenza A KEGG Pathway 0.290751023 4.027953479 12.70771314
mRNA surveillance pathway KEGG Pathway 0.450739312 4.690814394 12.33425062
Amyotrophic lateral sclerosis KEGG Pathway 0.472547616 2.525839793 6.320043977
Systemic lupus erythematosus KEGG Pathway 0.638196597 3.379528366 7.064644533
Circadian rhythm KEGG Pathway 0.638196597 7.445692884 15.15817559
Hepatitis B KEGG Pathway 0.638196597 2.805397727 5.049165535
Vasopressin-regulated water reabsorption KEGG Pathway 0.638196597 5.191272537 8.89703376
Cocaine addiction KEGG Pathway 0.638196597 4.649344569 7.51796421
Alcoholism KEGG Pathway 0.638196597 2.436511858 3.871464628
Kaposi sarcoma-associated herpesvirus infection KEGG Pathway 0.638196597 2.346382675 3.599475253

>NC_002058.3 Poliovirus, complete genome TTAAAACAGCTCTGGGGTTGTACCCACCCCAGAGGCCCACGTGGCGGCTAGTACTCCGGTATTGCGGTAC CCTTGTACGCCTGTTTTATACTCCCTTCCCGTAACTTAGACGCACAAAACCAAGTTCAATAGAAGGGGGT ACAAACCAGTACCACCACGAACAAGCACTTCTGTTTCCCCGGTGATGTCGTATAGACTGCTTGCGTGGTT GAAAGCGACGGATCCGTTATCCGCTTATGTACTTCGAGAAGCCCAGTACCACCTCGGAATCTTCGATGCG TTGCGCTCAGCACTCAACCCCAGAGTGTAGCTTAGGCTGATGAGTCTGGACATCCCTCACCGGTGACGGT GGTCCAGGCTGCGTTGGCGGCCTACCTATGGCTAACGCCATGGGACGCTAGTTGTGAACAAGGTGTGAAG AGCCTATTGAGCTACATAAGAATCCTCCGGCCCCTGAATGCGGCTAATCCCAACCTCGGAGCAGGTGGTC ACAAACCAGTGATTGGCCTGTCGTAACGCGCAAGTCCGTGGCGGAACCGACTACTTTGGGTGTCCGTGTT TCCTTTTATTTTATTGTGGCTGCTTATGGTGACAATCACAGATTGTTATCATAAAGCGAATTGGATTGGC CATCCGGTGAAAGTGAGACTCATTATCTATCTGTTTGCTGGATCCGCTCCATTGAGTGTGTTTACTCTAA GTACAATTTCAACAGTTATTTCAATCAGACAATTGTATCATAATGGGTGCTCAGGTTTCATCACAGAAAG TGGGCGCACATGAAAACTCAAATAGAGCGTATGGTGGTTCTACCATTAATTACACCACCATTAATTATTA TAGAGATTCAGCTAGTAACGCGGCTTCGAAACAGGACTTCTCTCAAGACCCTTCCAAGTTCACCGAGCCC ATCAAGGATGTCCTGATAAAAACAGCCCCAATGCTAAACTCGCCAAACATAGAGGCTTGCGGGTATAGCG ATAGAGTACTGCAATTAACACTGGGAAACTCCACTATAACCACACAGGAGGCGGCTAATTCAGTAGTCGC TTATGGGCGTTGGCCTGAATATCTGAGGGACAGCGAAGCCAATCCAGTGGACCAGCCGACAGAACCAGAC GTCGCTGCATGCAGGTTTTATACGCTAGACACCGTGTCTTGGACGAAAGAGTCGCGAGGGTGGTGGTGGA AGTTGCCTGATGCACTGAGGGACATGGGACTCTTTGGGCAAAATATGTACTACCACTACCTAGGTAGGTC CGGGTACACCGTGCATGTACAGTGTAACGCCTCCAAATTCCACCAGGGGGCACTAGGGGTATTCGCCGTA CCAGAGATGTGTCTGGCCGGGGATAGCAACACCACTACCATGCACACCAGCTATCAAAATGCCAATCCTG GCGAGAAAGGAGGCACTTTCACGGGTACGTTCACTCCTGACAACAACCAGACATCACCTGCCCGCAGGTT CTGCCCGGTGGATTACCTCCTTGGAAATGGCACGTTGTTGGGGAATGCCTTTGTGTTCCCGCACCAGATA ATAAACCTACGGACCAACAACTGTGCTACACTGGTACTCCCTTACGTGAACTCCCTCTCGATAGATAGTA TGGTAAAGCACAATAATTGGGGAATTGCAATATTACCATTGGCCCCATTAAATTTTGCTAGTGAGTCCTC CCCAGAGATTCCAATCACCTTGACCATAGCCCCTATGTGCTGTGAGTTCAATGGATTAAGAAACATCACC CTGCCACGCTTACAGGGCCTGCCGGTCATGAACACCCCTGGTAGCAATCAATATCTTACTGCAGACAACT TCCAGTCACCGTGTGCGCTGCCTGAATTTGATGTGACCCCACCTATTGACATACCCGGTGAAGTAAAGAA CATGATGGAATTGGCAGAAATCGACACCATGATTCCCTTTGACTTAAGTGCCACAAAAAAGAACACCATG GAAATGTATAGGGTTCGGTTAAGTGACAAACCACATACAGACGATCCCATACTCTGCCTGTCACTCTCTC CAGCTTCAGATCCTAGGTTGTCACATACTATGCTTGGAGAAATCCTAAATTACTACACACACTGGGCAGG ATCCCTGAAGTTCACGTTTCTGTTCTGTGGATTCATGATGGCAACTGGCAAACTGTTGGTGTCATACGCG CCTCCTGGAGCCGACCCACCAAAGAAGCGTAAGGAGGCGATGTTGGGAACACATGTGATCTGGGACATAG GACTGCAGTCCTCATGTACTATGGTAGTGCCATGGATTAGCAACACCACGTATCGGCAAACCATAGATGA TAGTTTCACCGAAGGCGGATACATCAGCGTCTTCTACCAAACTAGAATAGTCGTCCCTCTTTCGACACCC AGAGAGATGGACATCCTTGGTTTTGTGTCAGCGTGTAATGACTTCAGCGTGCGCTTGTTGCGAGATACCA CACATATAGAGCAAAAAGCGCTAGCACAGGGGTTAGGTCAGATGCTTGAAAGCATGATTGACAACACAGT CCGTGAAACGGTGGGGGCGGCAACATCTAGAGACGCTCTCCCAAACACTGAAGCCAGTGGACCAACACAC TCCAAGGAAATTCCGGCACTCACCGCAGTGGAAACTGGGGCCACAAATCCACTAGTCCCTTCTGATACAG TGCAAACCAGACATGTTGTACAACATAGGTCAAGGTCAGAGTCTAGCATAGAGTCTTTCTTCGCGCGGGG TGCATGCGTGACCATTATGACCGTGGATAACCCAGCTTCCACCACGAATAAGGATAAGCTATTTGCAGTG TGGAAGATCACTTATAAAGATACTGTCCAGTTACGGAGGAAATTGGAGTTCTTCACCTATTCTAGATTTG ATATGGAACTTACCTTTGTGGTTACTGCAAATTTCACTGAGACTAACAATGGGCATGCCTTAAATCAAGT GTACCAAATTATGTACGTACCACCAGGCGCTCCAGTGCCCGAGAAATGGGACGACTACACATGGCAAACC TCATCAAATCCATCAATCTTTTACACCTACGGAACAGCTCCAGCCCGGATCTCGGTACCGTATGTTGGTA TTTCGAACGCCTATTCACACTTTTACGACGGTTTTTCCAAAGTACCACTGAAGGACCAGTCGGCAGCACT AGGTGACTCCCTTTATGGTGCAGCATCTCTAAATGACTTCGGTATTTTGGCTGTTAGAGTAGTCAATGAT CACAACCCGACCAAGGTCACCTCCAAAATCAGAGTGTATCTAAAACCCAAACACATCAGAGTCTGGTGCC CGCGTCCACCGAGGGCAGTGGCGTACTACGGCCCTGGAGTGGATTACAAGGATGGTACGCTTACACCCCT CTCCACCAAGGATCTGACCACATATGGATTCGGACACCAAAACAAAGCGGTGTACACTGCAGGTTACAAA ATTTGCAACTACCACTTGGCCACTCAGGATGATTTGCAAAACGCAGTGAACGTCATGTGGAGTAGAGACC TCTTAGTCACAGAATCAAGAGCCCAGGGCACCGATTCAATCGCAAGGTGCAATTGCAACGCAGGGGTGTA CTACTGCGAGTCTAGAAGGAAATACTACCCAGTATCCTTCGTTGGCCCAACGTTCCAGTACATGGAGGCT AATAACTATTACCCAGCTAGGTACCAGTCCCATATGCTCATTGGCCATGGATTCGCATCTCCAGGGGATT GTGGTGGCATACTCAGATGTCACCACGGGGTGATAGGGATCATTACTGCTGGTGGCGAAGGGTTGGTTGC ATTTTCAGACATTAGAGACTTGTATGCCTACGAAGAAGAAGCCATGGAACAAGGCATCACCAATTACATA GAGTCACTTGGGGCCGCATTTGGAAGTGGATTTACTCAGCAGATTAGCGACAAAATAACAGAGTTGACCA ATATGGTGACCAGTACCATCACTGAAAAGCTACTTAAGAACTTGATCAAGATCATATCCTCACTAGTTAT TATAACTAGGAACTATGAAGACACCACAACAGTGCTCGCTACCCTGGCCCTTCTTGGGTGTGATGCTTCA CCATGGCAGTGGCTTAGAAAGAAAGCATGCGATGTTCTGGAGATACCTTATGTCATCAAGCAAGGTGACA GTTGGTTGAAGAAGTTTACTGAAGCATGCAACGCAGCTAAGGGACTGGAGTGGGTGTCAAACAAAATCTC AAAATTCATTGATTGGCTCAAGGAGAAAATTATCCCACAAGCTAGAGATAAGTTGGAATTTGTAACAAAA CTTAGACAACTAGAAATGCTGGAAAACCAAATCTCAACTATACACCAATCATGCCCTAGTCAGGAACACC AGGAAATTCTATTCAATAATGTCAGATGGTTATCCATCCAGTCTAAGAGGTTTGCCCCTCTTTACGCAGT GGAAGCCAAAAGAATACAGAAACTAGAGCATACTATTAACAACTACATACAGTTCAAGAGCAAACACCGT ATTGAACCAGTATGTTTGCTAGTACATGGCAGCCCCGGAACAGGTAAATCTGTAGCAACCAACCTGATTG CTAGAGCCATAGCTGAAAGAGAAAACACGTCCACGTACTCGCTACCCCCGGATCCATCACACTTCGACGG ATACAAACAACAGGGAGTGGTGATTATGGACGACCTGAATCAAAACCCAGATGGTGCGGACATGAAGCTG TTCTGTCAGATGGTATCAACAGTGGAGTTTATACCACCCATGGCATCCCTGGAGGAGAAAGGAATCCTGT TTACTTCAAATTACGTTCTAGCATCCACAAACTCAAGCAGAATTTCCCCCCCCACTGTGGCACACAGTGA TGCATTAGCCAGGCGCTTTGCGTTCGACATGGACATTCAGGTCATGAATGAGTATTCTAGAGATGGGAAA TTGAACATGGCCATGGCTACTGAAATGTGTAAGAACTGTCACCAACCAGCAAACTTTAAGAGATGCTGTC CTTTAGTGTGTGGTAAGGCAATTCAATTAATGGACAAATCTTCCAGAGTTAGATACAGTATTGACCAGAT CACTACAATGATTATCAATGAGAGAAACAGAAGATCCAACATTGGCAATTGTATGGAGGCTTTGTTTCAA GGACCACTCCAGTATAAAGACTTGAAAATTGACATCAAGACGAGTCCCCCTCCTGAATGTATCAATGACT TGCTCCAAGCAGTTGACTCCCAGGAGGTGAGAGATTACTGTGAGAAGAAGGGTTGGATAGTCAACATCAC CAGCCAGGTTCAAACAGAAAGGAACATCAACAGGGCAATGACAATTCTACAAGCGGTGACAACCTTCGCC GCAGTGGCTGGAGTTGTCTATGTCATGTATAAACTGTTTGCTGGACACCAGGGAGCATACACTGGTTTAC CAAACAAAAAACCCAACGTGCCCACCATTCGGACAGCAAAGGTACAAGGACCAGGGTTCGATTACGCAGT GGCTATGGCTAAAAGAAACATTGTTACAGCAACTACTAGCAAGGGAGAGTTCACTATGTTAGGAGTCCAC GACAACGTGGCTATTTTACCAACCCACGCTTCACCTGGTGAAAGCATTGTGATCGATGGCAAAGAAGTGG AGATCTTGGATGCCAAAGCGCTCGAAGATCAAGCAGGAACCAATCTTGAAATCACTATAATCACTCTAAA GAGAAATGAAAAGTTCAGAGACATTAGACCACATATACCTACTCAAATCACTGAGACAAATGATGGAGTC TTGATCGTGAACACTAGCAAGTACCCCAATATGTATGTTCCTGTCGGTGCTGTGACTGAACAGGGATATC TAAATCTCGGTGGGCGCCAAACTGCTCGTACTCTAATGTACAACTTTCCAACCAGAGCAGGACAGTGTGG TGGAGTCATCACATGTACTGGGAAAGTCATCGGGATGCATGTTGGTGGGAACGGTTCACACGGGTTTGCA GCGGCCCTGAAGCGATCATACTTCACTCAGAGTCAAGGTGAAATCCAGTGGATGAGACCTTCGAAGGAAG TGGGATATCCAATCATAAATGCCCCGTCCAAAACCAAGCTTGAACCCAGTGCTTTCCACTATGTGTTTGA AGGGGTGAAGGAACCAGCAGTCCTCACTAAAAACGATCCCAGGCTTAAGACAGACTTTGAGGAGGCAATT TTCTCCAAGTACGTGGGTAACAAAATTACTGAAGTGGATGAGTACATGAAAGAGGCAGTAGACCACTATG CTGGCCAGCTCATGTCACTAGACATCAACACAGAACAAATGTGCTTGGAGGATGCCATGTATGGCACTGA TGGTCTAGAAGCACTTGATTTGTCCACCAGTGCTGGCTACCCTTATGTAGCAATGGGAAAGAAGAAGAGA GACATCTTGAACAAACAAACCAGAGACACTAAGGAAATGCAAAAACTGCTCGACACATATGGAATCAACC TCCCACTGGTGACTTATGTAAAGGATGAACTTAGATCCAAAACAAAGGTTGAGCAGGGGAAATCCAGATT AATTGAAGCTTCTAGTTTGAATGACTCAGTGGCAATGAGAATGGCTTTTGGGAACCTATATGCTGCTTTT CACAAAAACCCAGGAGTGATAACAGGTTCAGCAGTGGGGTGCGATCCAGATTTGTTTTGGAGCAAAATTC CGGTATTGATGGAAGAGAAGCTGTTTGCTTTTGACTACACAGGGTATGATGCATCTCTCAGCCCTGCTTG GTTCGAGGCACTAAAGATGGTGCTTGAGAAAATCGGATTCGGAGACAGAGTTGACTACATCGACTACCTA AACCACTCACACCACCTGTACAAGAATAAAACATACTGTGTCAAGGGCGGTATGCCATCTGGCTGCTCAG GCACTTCAATTTTTAACTCAATGATTAACAACTTGATTATCAGGACACTCTTACTGAAAACCTACAAGGG CATAGATTTAGACCACCTAAAAATGATTGCCTATGGTGATGATGTAATTGCTTCCTACCCCCATGAAGTT GACGCTAGTCTCCTAGCCCAATCAGGAAAAGACTATGGACTAACTATGACTCCAGCTGACAAATCAGCTA CATTTGAAACAGTCACATGGGAGAATGTAACATTCTTGAAGAGATTCTTCAGGGCAGACGAGAAATACCC ATTTCTTATTCATCCAGTAATGCCAATGAAGGAAATTCATGAATCAATTAGATGGACTAAAGATCCTAGG AACACTCAGGATCACGTTCGCTCTCTGTGCCTTTTAGCTTGGCACAATGGCGAAGAAGAATATAACAAAT TCCTAGCTAAAATCAGGAGTGTGCCAATTGGAAGAGCTTTATTGCTCCCAGAGTACTCAACATTGTACCG CCGTTGGCTTGACTCATTTTAGTAACCCTACCTCAGTCGAATTGGATTGGGTCATACTGTTGTAGGGGTA AATTTTTCTTTAATTCGGAG
    Click to Show/Hide