Details of Virus RNA
| Strain Information | Strain Name |
Rhinovirus
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Picornaviridae
|
||||||||
| RNA Binding Site |
5'UTR - 3'UTR
|
||||||||
| Virus Information | Virus Name |
Rhinovirus (RV)
|
|||||||
| Taxonomy ID | 12059 | ||||||||
Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.49489429578887 |
| 140 kDa Ser/Arg-rich domain protein | O15042 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.88306161472377 |
| 3-keto acyl-CoA synthase ELOVL1 | Q9BW60 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.49429783456651 |
| 4-hydroxyphenylpyruvate dioxygenase | P32754 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.12547918458531 |
| 40S ribosomal protein S10 | P46783 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.29452958973902 |
| 40S ribosomal protein S13 | P62277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.64899456426205 |
| 40S ribosomal protein S18 | P62269 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.46536331129223 |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.35345315610425 |
| 40S ribosomal protein S23 | P62266 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.1914324168098 |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.47052264524306 |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.31570823660782 |
| 40S ribosomal protein S4 | P62701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.82392051736333 |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.74723699918068 |
| 40S ribosomal protein S7 | P62081 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.19719231209517 |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.67945082305537 |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.95016976589757 |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.20419237485748 |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.04829199482641 |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.76689981669335 |
| 60S ribosomal protein L18 | Q07020 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.43494575238648 |
| 60S ribosomal protein L21 | Q59GK9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.04829199482641 |
| 60S ribosomal protein L23a | P62750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.16138466636816 |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.54967409879678 |
| 60S ribosomal protein L29 | P47914 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.20856095825791 |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.23793382796414 |
| 60S ribosomal protein L34 | P49207 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.01183551950546 |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.50012897824518 |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.56925289151035 |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.77537719220175 |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.3631611597389 |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.49357816902521 |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.21886794382337 |
| A-kinase anchor protein 8 | O43823 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.93530132553432 |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.12965320271847 |
| Albumin | P02768 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.27211876817504 |
| Alpha-actinin-4 | O43707 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.24713415937786 |
| Alpha-enolase | P06733 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.55417264162191 |
| Annexin | B4DPJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.06362028593433 |
| Annexin A1 | P04083 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.27600876336998 |
| Annexin A7 | P20073 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25891285033135 |
| Apoptosis inhibitor 5 | Q9BZZ5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.26814091392716 |
| Apoptotic chromatin condensation inducer in the nucleus | Q9UKV3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.27356959813513 |
| apurinic or apyrimidinic site | P27695 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.12059082132996 |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.19759493929768 |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.03365205249 |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.50499658804899 |
| ATP-dependent DNA helicase Q1 | P46063 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.41093260771695 |
| ATP-dependent DNA/RNA helicase DHX36 | Q9H2U1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.05685400832983 |
| ATP-dependent RNA helicase | A8K7F6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.16290929672594 |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.78603566677749 |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.87077305546401 |
| ATP-dependent RNA helicase DDX3X | O00571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.8796647127451 |
| ATP-dependent RNA helicase DDX42 | Q86XP3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.89273684266871 |
| ATP-dependent RNA helicase DHX15 | O43143 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.31573576165924 |
| ATP-dependent RNA helicase DHX30 | Q7L2E3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.52742481954982 |
| Bcl-2-associated transcription factor 1 | Q9NYF8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.51637325412124 |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.34190037813241 |
| Bleomycin hydrolase | Q13867 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.55078248683478 |
| BRR2 homolog | O75643 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.26750358800681 |
| C-1-tetrahydrofolate synthase | F5H2F4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.56866937732466 |
| Calcyclin-binding protein | Q9HB71 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.04227311083037 |
| Caprin-1 | Q14444 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.23797970271119 |
| Cathepsin D | P07339 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.0294965194713 |
| CDKN2A-interacting protein | Q9NXV6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.09901909625342 |
| cDNA | B2R959 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.00103115835904 |
| cDNA FLJ40872 fis | Q8N1H4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.09901909625342 |
| cDNA FLJ54020 | B4DLR3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.8841680764481 |
| cDNA FLJ55671 | B4DYY5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.13356352574111 |
| cDNA FLJ58832 | B4E3E6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.90742525548616 |
| cDNA FLJ61021 | B4E0X8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 5.50689132548862 |
| cDNA FLJ76656 | A8K329 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.41208778123175 |
| Cell cycle and apoptosis regulator protein 2 | Q8N163 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.13134089268005 |
| Cell division cycle 5-like protein | Q99459 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.29237538197009 |
| Chloride intracellular channel protein 1 | O00299 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.29958462713231 |
| Chromatin target of PRMT1 protein | Q9Y3Y2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.65615768073577 |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.10359834788396 |
| Clustered mitochondria protein homolog | I3L2B0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.02432677207395 |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.95898988849105 |
| Cold-inducible RNA-binding protein | Q14011 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.56506093953895 |
| CPSF 25 kDa subunit | O43809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.38809032262437 |
| CPSF 59 kDa subunit | Q8N684 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.23151535488395 |
| CPSF 68 kDa subunit | Q16630 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.9752779980539 |
| CUGBP Elav-like family member 1 | Q92879 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.09079247021782 |
| Cullin-associated NEDD8-dissociated protein 1 | Q86VP6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.61035044730406 |
| Cyclin-dependent kinase 1 | P06493 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.57037286203392 |
| Cystatin-M | Q15828 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.10959458133312 |
| Cytochrome P450 26B1 | Q9NR63 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.10377960489538 |
| Cytoplasmic dynein 2 heavy chain 1 | Q8NCM8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.27211876817504 |
| DAZ-associated protein 1 | Q96EP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.68867497604531 |
| DBIRD complex subunit ZNF326 | Q5BKZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.12071688144982 |
| DEAH-box protein 16 | O60231 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25016120137001 |
| Death inducer with SAP domain | Q8IX12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25016120137001 |
| Dermokine | Q6E0U4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.58913306887572 |
| Desmocollin-1 | Q08554 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.07334672733138 |
| Deubiquitinating enzyme FAF-X | Q93008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.0297496988126 |
| DNA (cytosine-5)-methyltransferase 1 | P26358 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.40585080529357 |
| DNA dC->dU-editing enzyme APOBEC-3B | Q9UH17 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.0874696303875 |
| DNA replication licensing factor MCM2 | P49736 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.05301399471512 |
| DNA replication licensing factor MCM3 | P25205 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.84949492839852 |
| DNA replication licensing factor MCM5 | P33992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.55619886012406 |
| DNA replication licensing factor MCM6 | Q14566 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25813898006613 |
| DNA replication licensing factor MCM7 | P33993 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.01977662667778 |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 5.64629747140172 |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.10050003325325 |
| eIF-2-alpha kinase activator GCN1 | Q92616 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.91315175116204 |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.65095177570436 |
| eIF3a | Q14152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.56275529128687 |
| eIF3b | P55884 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.0445759749075 |
| eIF3c | Q99613 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.413331405684 |
| eIF3d | O15371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.15163804541918 |
| eIF3l | Q9Y262 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25990801554819 |
| ELAV-like protein 1 | Q15717 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.8260249557538 |
| Elongation factor 1-alpha | Q53GE9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.78423593921322 |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.00779287734323 |
| Enhancer of rudimentary homolog | P84090 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25069483214544 |
| Epiplakin | P58107 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.29583633416429 |
| Epithelial splicing regulatory protein 2 | Q9H6T0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.76892533556375 |
| eRF3a | P15170 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.47483057256104 |
| ERPROT 213-21 | Q8IWX8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.116111863626 |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.05135342050951 |
| Eukaryotic initiation factor 4A-III | P38919 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.33689890165536 |
| Eukaryotic release factor 1 | P62495 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.11629155536309 |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.81951695824368 |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.31186077150751 |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.65898832910724 |
| Exportin-1 | O14980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.20106921784666 |
| Exportin-2 | P55060 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.72725829615081 |
| Ezrin | P15311 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.63509232462185 |
| Far upstream element-binding protein 1 | Q96AE4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.60378754303189 |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.59534413447392 |
| Far upstream element-binding protein 3 | Q96I24 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.84461162137031 |
| Fascin | Q16658 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.38219233298804 |
| Fatty acid-binding protein 5 | Q01469 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.34699091814806 |
| Filaggrin | P20930 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.92274208713047 |
| Filamin-A | P21333 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.52526709170203 |
| Flap endonuclease 1 | P39748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.88254132354892 |
| Fus-like protein | Q13344 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.71272452780643 |
| Galectin-3 | P17931 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.02696998642051 |
| Galectin-7 | P47929 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.92567864253219 |
| GAP-associated tyrosine phosphoprotein p62 | Q07666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.14357365055552 |
| Glucose-6-phosphate isomerase | P06744 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.28449231520214 |
| Glutamine synthetase | P15104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.10959458133312 |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.0438650543147 |
| Glycine--tRNA ligase | P41250 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.30949927306963 |
| Glycogen debranching enzyme | P35573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.56106702691126 |
| GMP synthase [glutamine-hydrolyzing] | P49915 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.20101274135798 |
| HCG2020860 | A0A024RC46 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.7980214738849 |
| Heat shock 70 kDa protein 1A | P0DMV8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.38771704555752 |
| Heat shock 70 kDa protein 4 | A0A087WYC1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.13440496201525 |
| Heat shock 70kDa protein 1A variant | Q59EJ3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.33215795796047 |
| Heat shock protein beta-1 | P04792 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.52277367796678 |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.52243747032511 |
| Hepatoma-derived growth factor | P51858 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.12465899041952 |
| Heterogeneous nuclear ribonucleoprotein A/B | Q99729 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.5934613442314 |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.56240118827258 |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.99310773574112 |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.89560084114104 |
| Heterogeneous nuclear ribonucleoprotein C | B4DY08 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.77556012410833 |
| Heterogeneous nuclear ribonucleoprotein D-like | O14979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.7808245055557 |
| Heterogeneous nuclear ribonucleoprotein D0 | Q14103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.6534603235074 |
| Heterogeneous nuclear ribonucleoprotein F | P52597 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.11073990531611 |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.99830874404116 |
| Heterogeneous nuclear ribonucleoprotein H2 | P55795 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.18433742972526 |
| Heterogeneous nuclear ribonucleoprotein H3 | P31942 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.32988984734069 |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.27223064663143 |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 5.63450730820938 |
| Heterogeneous nuclear ribonucleoprotein L-like | Q8WVV9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.07124095355556 |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.07568235218623 |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.29818687019397 |
| Heterogeneous nuclear ribonucleoprotein R | O43390 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.09894720094265 |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.82794191790462 |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.25396171944314 |
| High mobility group protein B1 | P09429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.87675856240305 |
| Histone deacetylase complex subunit SAP18 | X6RAL5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.42569561669044 |
| Histone H2AX | P16104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.02091106558169 |
| Histone H2B type 1-D | P58876 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.79636517651625 |
| Histone H4 | P62805 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.23715743065641 |
| Histone-binding protein RBBP4 | Q09028 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.43259601609611 |
| Histone-binding protein RBBP7 | Q16576 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25941712597375 |
| IGF2 mRNA-binding protein 1 | Q9NZI8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.77901592319047 |
| IGF2 mRNA-binding protein 3 | O00425 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.05573448143472 |
| Insulin-degrading enzyme | P14735 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.88817238876863 |
| Interferon-inducible protein 4 | P55265 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.95949753797624 |
| Interleukin enhancer-binding factor 2 | Q12905 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.79971731115824 |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.74032586232291 |
| Isoform 5 of Prelamin-A/C | P02545-5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.40633766035515 |
| Keratin | B4DRS2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.10959458133312 |
| KH domain-containing RNA-binding protein QKI | Q96PU8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.12465899041952 |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.30055720028567 |
| La-related protein 4 | Q71RC2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.63166308746278 |
| Luc7-like protein 3 | O95232 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.72267585576241 |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.39129480795202 |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.2251181466437 |
| Mitotic checkpoint protein BUB3 | O43684 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.33286257653276 |
| mRNA cap guanine-N7 methyltransferase | O43148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.22589186169034 |
| Muscleblind-like protein 1 | Q9NR56 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.32084855519858 |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.70932041581822 |
| NADH-ubiquinone oxidoreductase chain 1 | A0A096WL34 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.04829199482641 |
| Nebulin | P20929 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.34699091814806 |
| NonO protein | Q15233 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 5.34267207345559 |
| Nuclear cap-binding protein subunit 1 | Q09161 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.29362945150255 |
| Nuclear receptor coactivator 5 | Q9HCD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.05614649204466 |
| Nuclear RNA export factor 1 | Q9UBU9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.56805156764223 |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.75535336400451 |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.28845749489942 |
| Nucleolysin TIAR | Q01085 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.64016046919794 |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.19680845342656 |
| Nucleoprotein TPR | P12270 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.18712161952568 |
| Oxidative stress-associated Src activator | Q9NZB2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.44647989646073 |
| P0DN76 | P0DN76 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.40480505041782 |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.83090025454832 |
| PAPSS 2 | O95340 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.32066951599152 |
| Paraspeckle component 1 | Q8WXF1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.26371351488783 |
| Paraspeckle component 1 | B4DWI8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.982991749940535 |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.35449283542054 |
| Pinin | Q9H307 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.51416771855427 |
| Plectin | Q15149 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.31913461115803 |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.4571740027042 |
| Poly(rC)-binding protein 1 | Q15365 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.76114759614598 |
| Poly(U)-binding-splicing factor PUF60 | E9PQ56 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.12725357317259 |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.77912260296166 |
| Polyadenylate-binding protein 4 | Q13310 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.55222949842233 |
| Polymerase delta-interacting protein 3 | Q9BY77 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.7370766774077 |
| Polypyrimidine tract-binding protein 1 | A0A0U1RRM4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.5618040685121 |
| PP-1G | P36873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26625283218526 |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.31853666383135 |
| Pre-mRNA-processing factor 40 homolog A | O75400 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.83316941435794 |
| Pre-mRNA-processing factor 6 | O94906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.81984391184964 |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.77634196047397 |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.26383142492686 |
| Probable ATP-dependent RNA helicase DDX23 | Q9BUQ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26811096366712 |
| Probable ATP-dependent RNA helicase DDX46 | Q7L014 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.1488511512429 |
| Probable ATP-dependent RNA helicase DDX5 | P17844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.76936772816545 |
| Probable ATP-dependent RNA helicase DDX6 | P26196 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.04341100311601 |
| Programmed cell death protein 6 | O75340 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.7861237495903 |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.61816815860399 |
| Protein arginine methyltransferase 1 | H0YDE4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.12344106814418 |
| Protein argonaute-2 | Q9UKV8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.17303146387803 |
| Protein FMC1 homolog | Q96HJ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.35552940691741 |
| Protein PRRC2A | P48634 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.04915676105847 |
| Protein S100-A4 | P26447 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.69980923363812 |
| Protein SCAF11 | Q99590 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.04529617746071 |
| Pumilio homolog 1 | Q14671 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.69172174774447 |
| Putative RNA-binding protein Luc7-like 2 | Q9Y383 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.95633549692718 |
| Rab GDP dissociation inhibitor beta | P50395 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.30470405974963 |
| Ras GTPase-activating protein-binding protein 1 | Q13283 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.56322252726726 |
| Ras GTPase-activating protein-binding protein 2 | Q9UN86 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.84909454012293 |
| Ras GTPase-activating-like protein IQGAP1 | P46940 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.982991749940535 |
| RCC2 protein | A5PLK7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.68981351822858 |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.23053747846065 |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.60760610108608 |
| Retroviral-like aspartic protease 1 | Q53RT3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.34699091814806 |
| Ribonucleoprotein | E9PAU2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.67202246263784 |
| RNA binding motif protein 26 | A0A087X0H9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.22647770266222 |
| RNA cytosine C(5)-methyltransferase NSUN2 | Q08J23 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.95219105605775 |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.64617248923622 |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.116111863626 |
| RNA-binding protein 12B | Q8IXT5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.36471809512101 |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.02815980012973 |
| RNA-binding protein 15 | Q96T37 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.74970587917699 |
| RNA-binding protein 25 | P49756 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.35539409029898 |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.66673614409365 |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.52856131748399 |
| RNA-binding protein 4 | Q9BWF3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.09745236113524 |
| RNA-binding protein 47 | A0AV96 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.28078709893383 |
| RNA-binding protein EWS | Q01844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.72552740807169 |
| RNA-binding protein FUS | P35637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.64652213381662 |
| RNA-binding protein FXR1 | A0A0F7KYT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.81851520164482 |
| RNA-binding protein Raly | Q9UKM9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.61269455269052 |
| RNA-splicing ligase RtcB homolog | Q9Y3I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.02992457789775 |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.39584701748086 |
| rRNA 2'-O-methyltransferase fibrillarin | P22087 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.04829199482641 |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.39737010826867 |
| SAFB-like transcription modulator | Q9NWH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.83614228053109 |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.64406853885623 |
| Scaffold attachment factor B2 | Q14151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.29952308689792 |
| Scaffold-attachment factor A2 | Q1KMD3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.45572832418783 |
| Septin-2 | Q15019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.08698073083257 |
| Septin-6 | Q14141 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.951908523828921 |
| Septin-7 | Q16181 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.34769399973652 |
| Septin-9 | Q9UHD8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.52465548071713 |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.04303472268534 |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.06498255735911 |
| Serine/arginine-rich splicing factor 10 | O75494 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.22254492675134 |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.4766357247039 |
| Serine/arginine-rich splicing factor 3 | P84103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.6728965721531 |
| Serine/arginine-rich splicing factor 5 | Q13243 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.33215795796047 |
| Serine/arginine-rich splicing factor 6 | Q13247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.6501780656369 |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.96545184942666 |
| Serine/arginine-rich splicing factor 9 | Q13242 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.02361021518265 |
| Serpin B3 | P29508 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.83713995168703 |
| Serrate RNA effector molecule homolog | Q9BXP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.98901726348131 |
| Small nuclear ribonucleoprotein Sm D1 | P62314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.06567570218222 |
| Small ubiquitin like modifier 3 | A8MU27 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.29938534447941 |
| Small ubiquitin-related modifier 2 | P61956 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.31995313689195 |
| snRNP-N | P63162 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.12465899041952 |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.49028515719696 |
| Spliceosome RNA helicase DDX39B | Q13838 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.50600141358785 |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.68721024422198 |
| Splicing factor 1 | Q15637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.33511161516605 |
| Splicing factor 3A subunit 1 | Q15459 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.51275784218733 |
| Splicing factor 3B subunit 1 | O75533 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.13858513947539 |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.89559733537727 |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.10487002286532 |
| Staphylococcal nuclease domain-containing protein | B3KU67 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.35467218723652 |
| Statherin | P02808 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.10359834788396 |
| Suprabasin | Q6UWP8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.14263585999876 |
| SURP and G-patch domain-containing protein 2 | Q8IX01 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.84374471460757 |
| T-complex protein 1 subunit beta | P78371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.23233085742263 |
| Talin-1 | Q9Y490 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.20799902009707 |
| TAR DNA-binding protein 43 | Q13148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.81660687391618 |
| TAR DNA-binding protein 43 | A0A0A0N0L3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.48599863937045 |
| TATA-binding protein-associated factor 2N | Q92804 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.37102071366995 |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26311856059002 |
| THO complex subunit 4 | Q86V81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.35889132974862 |
| Thyroid hormone receptor-associated protein 3 | Q9Y2W1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.68718389461182 |
| TIA1 protein variant | Q59G98 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.1045983342524 |
| Transcription elongation factor SPT6 | Q7KZ85 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.33267356630225 |
| Transcription elongation regulator 1 | O14776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.12711157026594 |
| Transcription intermediary factor 1-beta | Q13263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.54971352275308 |
| Transformer-2 protein homolog alpha | Q13595 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.12574035821778 |
| Transformer-2 protein homolog beta | P62995 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.66764465513273 |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.956881875886641 |
| Transketolase | P29401 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.45775732351554 |
| Transportin-1 | Q92973 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.93975691049117 |
| Tripartite motif containing 16 | J3QLP0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.02091106558169 |
| tRNA (guanine(26)-N(2))-dimethyltransferase | Q9NXH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.24472878009937 |
| Tubulin beta chain | B4DY90 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.31850774173223 |
| Tubulin beta-4B chain | P68371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.55802742230029 |
| U1 small nuclear ribonucleoprotein 70 kDa | P08621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.38114144974433 |
| U1 small nuclear ribonucleoprotein A | P09012 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.21845261120299 |
| U2 small nuclear ribonucleoprotein A' | P09661 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.00852991531586 |
| U2 small nuclear RNA auxiliary factor 2 | M0QYQ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.33970919049426 |
| Ubiquitin carboxyl-terminal hydrolase 4 | Q13107 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.16730011600422 |
| Ubiquitin-associated protein 2-like | Q14157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.86052187942244 |
| Ubiquitin-like modifier-activating enzyme 1 | P22314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.2106818626377 |
| Valine--tRNA ligase | P26640 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.21335972541059 |
| Vigilin | Q00341 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.80715911444338 |
| Vinculin | P18206 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.57448423786629 |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.21670007917929 |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.506381391471 |
| Y-box binding protein 1 | H0Y449 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.18894523513254 |
| YLP motif-containing protein 1 | P49750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.37946293338309 |
| YTH domain-containing family protein 2 | Q9Y5A9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.951908523828921 |
| Zinc finger CCCH domain-containing protein 11A | O75152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.55758163972931 |
| Zinc finger CCCH domain-containing protein 14 | Q6PJT7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.13579751222339 |
| Zinc finger CCCH domain-containing protein 7A | Q8IWR0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.06450350808747 |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.60477826083523 |
| Zinc finger protein 638 | Q14966 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.24997468725199 |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.20525799699034 |
Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| Spliceosome | KEGG Pathway | 1.38E-52 | 36.95213886 | 4595.013264 |
| mRNA surveillance pathway | KEGG Pathway | 3.65E-17 | 18.23498054 | 767.5141695 |
| Ribosome | KEGG Pathway | 5.65E-17 | 12.53356036 | 516.9959304 |
| RNA transport | KEGG Pathway | 2.73E-15 | 10.32536645 | 382.88054 |
| Coronavirus disease | KEGG Pathway | 6.00E-14 | 8.376757532 | 282.88359 |
| DNA replication | KEGG Pathway | 4.25E-05 | 14.54051195 | 192.051803 |
| Amyotrophic lateral sclerosis | KEGG Pathway | 0.000248295 | 3.388885812 | 38.25867699 |
| Non-homologous end-joining | KEGG Pathway | 0.00083265 | 26.55589328 | 264.123036 |
| Cell cycle | KEGG Pathway | 0.017339723 | 4.148753316 | 28.17835184 |
| RNA degradation | KEGG Pathway | 0.026659442 | 4.924971723 | 30.50533968 |
| Base excision repair | KEGG Pathway | 0.026659442 | 8.233099256 | 50.72569341 |
| Glycolysis / Gluconeogenesis | KEGG Pathway | 0.295089916 | 3.78327785 | 13.88479032 |
| Selenocompound metabolism | KEGG Pathway | 0.340852687 | 7.916213494 | 27.27792178 |
| Bacterial invasion of epithelial cells | KEGG Pathway | 0.393177681 | 3.263355123 | 10.53708083 |
| Pathogenic Escherichia coli infection | KEGG Pathway | 0.438397376 | 2.201146271 | 6.715814506 |
| Cysteine and methionine metabolism | KEGG Pathway | 0.438754838 | 3.794970986 | 11.33064369 |
| Proteoglycans in cancer | KEGG Pathway | 0.460191658 | 2.111343496 | 6.075122383 |
| Systemic lupus erythematosus | KEGG Pathway | 0.582541161 | 2.290924015 | 5.920796002 |
| Pentose phosphate pathway | KEGG Pathway | 0.616470319 | 4.238023306 | 10.26934605 |
| Amoebiasis | KEGG Pathway | 0.616470319 | 2.427765027 | 5.82461558 |
Virus RNA Sequence Information
|
>NC_038311.1 Human rhinovirus 1 strain ATCC VR-1559, complete genome
TTAAAACTGGGTGTGGGTTGTTCCCACCCACACCACCCAATGGGTGTTGTACTCTGTTATTCCGGTAACT
TTGTACGCCAGTTTTTCCCTCCCCTCCCCATCCTTTTACGTAACTTAGAAGTTTTAAATACAAGACCAAT
AGTAGGCAACTCTCCAGGTTGTCTAAGGTCAAGCACTTCTGTTTCCCCGGTTGATGTTGATATGCTCCAA
CAGGGCAAAAACAACAGATACCGTTATCCGCAAAGTGCCTACACAGAGCTTAGTAGGATTCTGAAAGATC
TTTGGTTGGTCGTTCAGCTGCATACCCAGCAGTAGACCTTGCAGATGAGGCTGGACATTCCCCACTGGTA
ACAGTGGTCCAGCCTGCGTGGCTGCCTGCGCACCTCTCATGAGGTGTGAAGCCAAAGATCGGACAGGGTG
TGAAGAGCCGCGTGTGCTCACTTTGAGTCCTCCGGCCCCTGAATGCGGCTAACCTTAAACCTGCAGCCAT
GGCTCATAAGCCAATGAGTTTATGGTCGTAACGAGTAATTGCGGGATGGGACCGACTACTTTGGGTGTCC
GTGTTTCACTTTTTCCTTTATTAATTGCTTATGGTGACAATATATATATTGATATATATTGGCATCATGG
GCGCCCAGGTATCTAGACAAAATGTTGGTACACACTCAACCCAAAATTCAGTGTCAAATGGATCAAGTTT
AAATTACTTTAATATAAATTACTTCAAGGATGCTGCCTCAAGTGGTGCATCTAGATTAGATTTCTCTCAA
GATCCAAGCAAATTCACTGACCCAGTTAAAGATGTCTTAGAAAAGGGGATCCCAACACTACAATCACCAT
CTGTTGAGGCTTGTGGCTATTCAGACAGGATTATGCAAATAACCAGAGGAGATTCAACAATCACATCTCA
AGATGTAGCAAATGCTGTGGTTGGGTATGGGGTCTGGCCGCATTACTTAACACCACAAGATGCCACTGCT
ATAGACAAACCAACACAACCTGATACATCATCAAATAGATTTTATACACTAGAGAGTAAACATTGGAATG
GTAGTTCAAAAGGATGGTGGTGGAAATTACCAGATGCTCTTAAAGACATGGGTATTTTTGGAGAAAATAT
GTATTATCATTTCCTGGGTAGAAGTGGATATACAGTTCATGTGCAGTGTAATGCTAGTAAATTCCATCAG
GGTACCTTGTTAGTTGCAATGATACCAGAACACCAGCTAGCAAGTGCAAAACACGGAAGTGTGACTGCTG
GTTACAAACTCACACACCCAGGTGAGGCTGGCAGAGATGTAAGTCAAGAACGTGATGCAAGTTTAAGACA
ACCTAGTGATGATAGTTGGCTTAATTTTGATGGCACCCTTCTTGGAAATTTATTAATTTTCCCACATCAA
TTTATAAACCTTAGGAGTAATAATTCTGCAACTCTAATAGTACCATATGTAAATGCTGTGCCAATGGATT
CAATGCTTCGACATAATAACTGGAGCCTGGTCATCATACCAATTAGTCCATTACGTAGTGAAACTACATC
TTCTAATATAGTGCCAATCACTGTATCAATAAGTCCCATGTGTGCTGAATTTTCTGGTGCAAGAGCAAAA
AACATTAAACAAGGATTACCTGTATATATAACTCCAGGATCTGGGCAATTCATGACTACTGATGATATGC
AATCACCTTGTGCACTACCCTGGTACCATCCTACTAAAGAAATATCTATTCCGGGTGAAGTTAAAAACCT
TATAGAAATGTGTCAAGTTGATACCTTGATTCCAGTCAATAATGTGGGTAACAATGTTGGAAATGTCAGT
ATGTACACTGTACAACTAGGGAACCAAACAGGCATGGCACAAAAAGTCTTTTCAATAAAAGTAGACATTA
CATCACAGCCTTTGGCTACAACTTTAATTGGGGAGATTGCAAGCTATTACACCCATTGGACTGGCAGTCT
GCGATTTAGTTTTATGTTTTGTGGGACTGCAAACACAACACTTAAATTATTACTTGCATACACACCACCT
GGTATTGATGAACCAACAACTAGAAAGGATGCAATGCTAGGGACACATGTTGTGTGGGATGTTGGATTGC
AGTCTACTATATCTCTTGTTGTACCATGGGTGAGTGCCAGCCACTTCAGGTTAACTGCAGATAATAAATA
CTCCATGGCTGGTTATATCACATGTTGGTACCAAACTAATTTAGTAGTGCCCCCAAGTACGCCACAGACT
GCTGATATGCTGTGTTTTGTTTCTGCATGTAAAGATTTTTGTCTACGAATGGCAAGGGATACAGATTTAC
ACATACAAAGTGGTCCAATAGAGCAAAATCCAGTAGAAAACTACATTGATGAAGTTTTAAATGAAGTTTT
AGTAGTGCCGAATATAAAAGAAAGTCATCACACTACATCAAACTCTGCCCCACTTTTAGATGCTGCAGAG
ACGGGACACACCAGTAATGTTCAACCAGAAGATGCTATAGAGACAAGGTATGTTATAACATCACAAACAA
GAGATGAGATGAGTATAGAAAGTTTCCTTGGTAGATCTGGTTGTGTCCACATCTCAAGAATAAAGGTTGA
TTACACTGACTATAATGGACAGGACATAAATTTCACAAAATGGAAAATCACACTACAGGAAATGGCACAG
ATTAGGAGAAAATTTGAATTGTTTACATATGTCAGGTTTGACTCAGAAATAACCTTGGTGCCTTGTATTG
CTGGTAGAGGAGACGACATTGGACATATTGTAATGCAATATATGTATGTTCCTCCAGGAGCTCCAATTCC
TTCAAAAAGAAACGATTTCTCATGGCAATCAGGCACCAATATGTCAATATTCTGGCAACATGGACAGCCA
TTTCCTAGATTTTCTTTACCATTTCTTAGCATTGCATCAGCTTATTATATGTTTTATGATGGATATGATG
GAGACAACACTTCTTCCAAGTATGGTAGCGTAGTTACTAATGATATGGGTACTATATGCTCAAGAATAGT
TACAGAAAAACAGAAACATTCTGTTGTCATCACAACACACATATATCATAAAGCTAAACACACAAAAGCT
TGGTGTCCTAGGCCCCCTAGAGCTGTCCCTTACACACATAGTCATGTGACTAATTATATGCCAGAAACAG
GTGACGTGACAACAGCCATAGTCCGCAGAAACACTATAACAACTGCTGGGCCCAGTGATCTATATGTGCA
TGTAGGTAACTTAATATATAGAAACTTACATCTGTTCAATTCTGAAATGCATGATTCAATTTTGATTTCA
TACTCTTCTGATTTAATCATATACCGCACAAACACTATAGGTGATGATTATATTCCCAATTGTAACTGCA
CTGAGGCTACTTATTATTGTAGACACAAAAATAGGTATTACCCAATAAAAGTTACTCCACATGATTGGTA
TGAAATACAAGAGAGTGAATATTACCCCAAACACATCCAATACAACCTATTAATTGGTGAAGGACCATGT
GAACCTGGTGATTGTGGTGGAAAACTTCTTTGTAGACATGGTGTCATTGGCATAATCACAGCAGGTGGTG
AAGGTCATGTAGCATTTATAGATCTTAGACAATTTCACTGTGCTGAGGAACAAGGCATAACTGATTACAT
ACACATGTTGGGAGAGGCTTTTGGCAATGGTTTTGTAGATAGTGTTAAAGAACAAATAAATGCAATAAAT
CCAATCAATAACATTAGTAAGAAGGTTATTAAGTGGCTACTTAGAATAATCTCGGCTATGGTTATTATAA
TCAGAAACTCCTCTGACCCTCAAACGATCATAGCAACCTTGACACTAATTGGTTGCAATGGTTCACCATG
GAGATTTCTCAAAGAAAAGTTTTGCAAATGGACCCAATTAACTTATATCCACAAAGAGTCTGATTCATGG
CTTAAGAAATTCACTGAAATGTGTAATGCTGCACGTGGTCTTGAATGGATTGGTAATAAAATTTCAAAAT
TTATAGATTGGATGAAATCTATGCTACCCCAGGCCCAATTGAAAGTTAAATACTTGAATGAAATAAAGAA
ACTCAGTTTGCTTGAAAAACAGATTGAAAATCTACGTGCGGCAGATAGTGCAACACAAGAGAAAATCAAA
TGTGAAATTGACACCCTACATGATCTATCGTGCAAATTTCTTCCTTTGTATGCACATGAGGCAAAAAGAA
TCAAAGTGCTTTATAATAAATGTTCCAATATAATTAAACAAAGAAAGAGAAGTGAACCGGTGGCGGTGAT
GATACATGGACCACCCGGTACTGGTAAATCTATAACAACTAACTTCTTGGCTAGAATGATAACAAATGAA
AGTGATGTGTACTCATTACCTCCAGATCCCAAATATTTTGATGGTTATGACAATCAGAGTGTTGTAATCA
TGGATGATATTATGCAAAATCCAGATGGAGAAGACATGACACTATTTTGCCAAATGGTTTCAAGTGTTAC
ATTTATACCACCCATGGCTGATTTGCCTGACAAGGGTAAACCATTTGATTCAAGATTTATCTTATGTAGT
ACTAACCACTCGCTTTTAGCCCCACCTACTATATCTTCATTACCCGCAATGAATAGAAGATTTTTCTTTG
ACTTAGATATTGTAGTTCATGACAATTATAAAGATACACAAGGGAAATTAGATGTATCCAAAGCTTTTCG
ACCTTGTAATGTTAACACCAAAATTGGCAATGCAAAATGTTGTCCATTTGTATGTGGTAAGGCAGTGWCA
TTCAAAGATCGCAGCACTTGCTCAACATACACCTTAGCTCAAGTTTACAATCACATTTTGGAAGAAGACA
AAAGAAGGAGACAGGTGGTGGATGTCATGTCTGCAATTTTCCAAGGACCAATTTCTTTAGACGYTCCACC
ACCACCAGCTATAGYAGATCTGTTACAATCAGTTAGAACACCTGAGGTAATCAAGTACTGTCAAGATAAT
AAATGGGTCATTCCAGCAGAGTGCCAAGTGGAAAGAGACTTAAATATAGCCAATAGCATAATAGCTATTA
TAGCAAATATAATAAGTATAGCTGGCATTATATTTGTAATTTATAAATTGTTTTGTTCATTACAAGGACC
ATACTCAGGTGAACCTAAACCTAAAACCAAAGTACCTGAAAGAAGAGTAGTTGCTCAAGGTCCAGAAGAA
GAATTTGGAAGGTCAATTCTCAAAAACAATACTTGTGTGATTACTACAGGTAATGGAAAATTTACAGGTC
TTGGTATACATGACAGAATTCTAATCATCCCAACACATGCTGATCCAGGTAGAGAGGTCCAAGTTAATGG
TGTCCACACTAAGGTTCTAGACTCATATGATCTTTATAATAGAGATGGAGTTAAACTTGAAATAACGGTC
ATACAATTAGATAGAAATGAAAAATTTAGGGACATTAGAAAGTATATACCTGAAACAGAAGACGATTATC
CAGAATGCAATTTGGCACTTTCAGCTAATCAAGATGAACCAACTATAATTAAAGTAGGAGATGTAGTGTC
CTATGGCAATATTTTGCTTAGTGGAAATCAAACAGCCAGAATGCTTAAATATAATTACCCCACAAAATCA
GGGTATTGTGGAGGGGTACTATATAAAATTGGTCAAATTCTAGGTATTCATGTGGGTGGAAATGGAAGGG
ATGGTTTTTCAGCTATGTTACTTAGATCATACTTTACAGATACTCAGGGCCAAATTAAAGTCAATAAGCA
TGCTACTGAATGTGGTCTTCCAACTATACACACTCCTAGCAAAACCAAACTTCAGCCTAGTGTATTTTAT
GATGTCTTCCCAGGCTCTAAGGAACCAGCTGTGCTCACAGATAATGACCCTAGATTGGAAGTTAATTTTA
AAGAAGCTTTATTTTCTAAATATAAAGGTAATGTGGAATGTAATTTGAATGAACATATGGAAATTGCTAT
TGCCCATTACTCAGCACAATTAATGACACTAGATATTGATTCCAGGCCAATAGCATTGGAAGATAGCGTG
TTTGGGATAGAAGGACTTGAGGCTTTAGATCTAAACACCAGTGCAGGGTTTCCTTATGTCACAATGGGTA
TTAAAAAGAGAGATTTAATAAATAACAAAACAAAAGATATATCCAGGCTTAAAGAGGCTCTAGATAAATA
TGGAGTTGACTTACCCATGATCACTTTCTTAAAAGACGAGCTTAGGAAAAAGGAGAAAATTTCAACAGGT
AAAACTAGAGTTATAGAAGCAAGTAGTATAAATGACACAATATTATTTAGAACTACTTTTGGCAATTTGT
TCTCTAAGTTTCATTTAAACCCAGGCGTTGTTACTGGCTCTGCAGTAGGGTGTGACCCTGAGACTTTCTG
GTCTAAAATCCCAGTTATGCTTGATGGAGATTGTATAATGGCTTTTGACTATACAAATTATGATGGTAGT
ATACACCCTGTCTGGTTTCAAGCTCTGAAAAAAGTTCTTGAAAATTTATCTTTCCAATCTAATTTAATTG
ATAGATTGTGTTATTCCAAGCACTTGTTTAAATCAACATATTATGAAGTGGCAGGTGGAGTTCCTTCTGG
GTGTTCTGGAACCAGTATATTCAATACTATGATTAATAACATTATAATAAGAACACTAGTTCTAGATGCA
TACAAAAATATTGATCTGGACAAGCTTAAAATAATTGCATATGGTGATGATGTGATTTTCTCTTATAAAT
ATACTCTAGATATGGAAGCTATTGCTAATGAAGGAAAGAAATATGGACTTACAATAACACCAGCAGATAA
GTCCAATGAATTCAAGAAACTTGATTATAGTAATGTGACTTTTCTTAAACGTGGTTTTAAGCAAGATGAA
AGACATACATTCCTTATTCATCCTACATTCCCAGTGGAAGAGATACATGAATCAATTAGATGGACCAAGA
AACCTTCACAGATGCAAGAACATGTGCTATCATTATGTCACCTGATGTGGCACAATGGACGTAAGGTGTA
TGAAGATTTCTCTAGTAAGATACGCAGTGTCAGCGCTGGACGTGCACTGTATATCCCACCTTATGATCTG
TTGAAACATGAATGGTATGAAAAATTTTAGATATAGAAATAATGAATGAATGATTCTTTAATTCTAT
Click to Show/Hide
|

