Details of Virus RNA

  Strain Information Strain Name
Ebola virus (strain VeroVP30)
Strain Family
Zaire ebolavirus
RNA Binding Site
5'UTR - 3'UTR
  Virus Information Virus Name
Ebola virus (EBOV)
Taxonomy ID 1570291
GeneBank ID AF086833

Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain

Protein Name Uniprot ID Host Species Pro Info Detection Method Infection Cell Cell ID Cell Originated Tissue Infection Time Interaction Score Fold Change
10 kDa heat shock protein Q9UNM1 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685545701 .
14-3-3 protein zeta/delta P63104 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.988696737 .
40S ribosomal protein S10 P46783 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685524562 .
40S ribosomal protein S16 P62249 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685529155 .
40S ribosomal protein S18 P62269 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685520376 .
40S ribosomal protein S2 P15880 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685527293 .
40S ribosomal protein S20 P60866 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68553744 .
40S ribosomal protein S25 P62851 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685516694 .
40S ribosomal protein S26 P62854 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685524069 .
40S ribosomal protein S3 P23396 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.6855443 .
40S ribosomal protein S4 P62701 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.97860769 .
40S ribosomal protein S6 P62753 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685519578 .
40S ribosomal protein S9 P46781 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685530001 .
60 kDa heat shock protein P10809 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685532472 .
60S ribosomal protein L10 P27635 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.994057235 .
60S ribosomal protein L10a P62906 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685516059 .
60S ribosomal protein L12 P30050 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685520311 .
60S ribosomal protein L13 P26373 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685525092 .
60S ribosomal protein L13a P40429 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685521746 .
60S ribosomal protein L14 P50914 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986177667 .
60S ribosomal protein L15 P61313 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685544182 .
60S ribosomal protein L17 P18621 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685524069 .
60S ribosomal protein L18 Q07020 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685534413 .
60S ribosomal protein L18a Q02543 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685531988 .
60S ribosomal protein L19 P84098 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685521858 .
60S ribosomal protein L22 P35268 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.98620317 .
60S ribosomal protein L23 P62829 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685529082 .
60S ribosomal protein L24 P83731 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685516385 .
60S ribosomal protein L27 P61353 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685543707 .
60S ribosomal protein L27a P46776 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986180958 .
60S ribosomal protein L29 P47914 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515221 .
60S ribosomal protein L35 P42766 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68552264 .
60S ribosomal protein L36 Q9Y3U8 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986179598 .
60S ribosomal protein L4 P36578 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685519585 .
60S ribosomal protein L6 Q02878 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685521179 .
60S ribosomal protein L7 P18124 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685531926 .
60S ribosomal protein L7a P62424 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.978605243 .
60S ribosomal protein L8 P62917 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685518255 .
7-dehydrocholesterol reductase Q9UBM7 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986187644 .
Acid ceramidase Q13510 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685513991 .
Acyl-CoA (8-3)-desaturase O60427 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685517034 .
Acyl-CoA 6-desaturase O95864 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.974719339 .
Adenosylhomocysteinase P23526 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685517905 .
ADP/ATP translocase 2 P05141 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.994036201 .
Alpha-enolase P06733 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.970586891 .
Ankyrin repeat domain-containing protein 11 Q6UB99 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986167669 .
Annexin A1 P04083 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685526554 .
Annexin A2 P07355 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685544279 .
Antileukoproteinase P03973 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685519334 .
Antioxidant protein 1 P30048 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685514835 .
Apolipoprotein D P05090 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986169334 .
Arginase-1 P05089 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.649632939 .
ATP synthase subunit a P00846 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986204157 .
ATP synthase subunit alpha P25705 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68552618 .
ATP-dependent RNA helicase A Q08211 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.993092155 .
ATP-dependent RNA helicase DDX3X O00571 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685516559 .
Bleomycin hydrolase Q13867 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685517389 .
Butyrate-induced protein 1 Q9P035 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.962223612 .
Bystin Q13895 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685511845 .
Calcium load-activated calcium channel Q9UM00 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.988669375 .
Calmodulin-like protein 3 P27482 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515425 .
Calnexin P27824 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.938164358 .
Caspase-14 P31944 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.993148146 .
Catalase P04040 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986177597 .
Cathepsin B P07858 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68552078 .
Cathepsin D P07339 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.993965825 .
Ceramide synthase 2 Q96G23 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.98620285 .
Cholestenol Delta-isomerase Q15125 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685516946 .
Citron Rho-interacting kinase O14578 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986159946 .
Coiled-coil domain-containing protein 15 Q0P6D6 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685510828 .
Collagen alpha-1(I) chain P02452 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685510938 .
Corneodesmosin Q0EFA5 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.615181763 .
CPSF 59 kDa subunit Q8N684 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685516489 .
Cystatin-A P01040 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986200029 .
Cystatin-M Q15828 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515534 .
DDOST 48 kDa subunit P39656 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685512739 .
Deleted in malignant brain tumors 1 protein Q9UGM3 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685510351 .
Delta(14)-sterol reductase LBR Q14739 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.970581172 .
Delta(14)-sterol reductase TM7SF2 O76062 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515466 .
Derlin-1 Q9BUN8 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986172015 .
Desmocollin-1 Q08554 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.798934004 .
Desmocollin-3 Q14574 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685510914 .
Diacylglycerol O-acyltransferase 1 O75907 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986163599 .
E3 ubiquitin-protein ligase synoviolin Q86TM6 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515355 .
Ergosterol biosynthetic protein 28 homolog Q9UKR5 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.962246117 .
Eukaryotic translation initiation factor 6 P56537 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685525515 .
Extracellular glycoprotein lacritin Q9GZZ8 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986174587 .
Extracellular matrix protein 1 Q16610 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685514519 .
F-box only protein 50 Q6ZVX7 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.992711803 .
Fatty acid synthase P49327 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685510334 .
Fatty acid-binding protein 5 Q01469 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.938182819 .
Filaggrin P20930 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.994009146 .
Fructose-bisphosphate aldolase A P04075 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986172102 .
Gamma-glutamylcyclotransferase O75223 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986217132 .
Ganglioside GM2 activator P17900 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685514392 .
Gasdermin-A Q96QA5 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.992735572 .
Glucose-6-phosphatase 3 Q9BUM1 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.98616692 .
Glucosidase 2 subunit beta P14314 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685514049 .
Glyceraldehyde-3-phosphate dehydrogenase P04406 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685537208 .
Glyceraldehyde-3-phosphate dehydrogenase O14556 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685512055 .
GTP-binding nuclear protein Ran P62826 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685525661 .
GTP-binding protein 4 Q9BZE4 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685514963 .
Heat shock protein beta-1 P04792 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685522088 .
Hemoglobin subunit alpha P69905 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68553502 .
Heterogeneous nuclear ribonucleoprotein A/B Q99729 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.988651925 .
Heterogeneous nuclear ribonucleoprotein A0 Q13151 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515929 .
Heterogeneous nuclear ribonucleoprotein A1 P09651 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.993615158 .
Heterogeneous nuclear ribonucleoprotein D0 Q14103 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986194597 .
Heterogeneous nuclear ribonucleoprotein H P31943 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.992272131 .
Heterogeneous nuclear ribonucleoprotein L P14866 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.988657711 .
Heterogeneous nuclear ribonucleoprotein M P52272 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986170356 .
Heterogeneous nuclear ribonucleoprotein Q O60506 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685514511 .
Heterogeneous nuclear ribonucleoprotein R O43390 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68551591 .
Heterogeneous nuclear ribonucleoprotein U Q00839 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68552182 .
Heterogeneous nuclear ribonucleoproteins A2/B1 P22626 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.990933416 .
Heterogeneous nuclear ribonucleoproteins C1/C2 P07910 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.994046145 .
Histidine ammonia-lyase P42357 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68553638 .
Histone H1.2 P16403 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685518557 .
Histone H1.5 P16401 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986178682 .
Histone H2A type 1-H Q96KK5 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.719180789 .
Histone H2B type 1-D P58876 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.9931479 .
Histone H3.3 P84243 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.719198054 .
Histone H4 P62805 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.993636487 .
IGF2 mRNA-binding protein 1 Q9NZI8 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986187128 .
Immunoglobulin heavy constant alpha 1 P01876 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.988658281 .
Immunoglobulin heavy constant gamma 1 P01857 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685520123 .
Immunoglobulin heavy constant gamma 3 P01860 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986164195 .
Immunoglobulin lambda constant 1 P0CG04 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685533794 .
Junction plakoglobin P14923 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.992703915 .
Lipase maturation factor 1 Q96S06 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515972 .
Loricrin P23490 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685517095 .
LPLAT7 Q92604 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685512123 .
Lysophosphatidylcholine acyltransferase 1 Q8NF37 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685511546 .
Lysosome-associated membrane glycoprotein 1 P11279 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68551215 .
Lysozyme C P61626 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.994035981 .
Matrin-3 P43243 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68551484 .
Methylsterol monooxygenase 1 Q15800 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685512602 .
Microsomal glutathione S-transferase 1 P10620 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.98618429 .
Microsomal glutathione S-transferase 2 Q99735 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515534 .
Mitochondrial carrier homolog 2 Q9Y6C9 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685530091 .
Multiple C2 and transmembrane domain-containing protein 1 Q6DN14 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986163476 .
Myosin-11 P35749 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685519316 .
N6-adenosine-methyltransferase TMT1A Q9H8H3 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685518878 .
NADH-cytochrome b5 reductase 3 P00387 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.99191859 .
Neurotrophic tyrosine kinase Q01974 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685511153 .
Neutral alpha-glucosidase AB Q14697 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.982264976 .
Neutrophil defensin 1 P59665 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.98620317 .
NonO protein Q15233 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986171206 .
Nucleolar protein 1 P46087 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685512047 .
Nucleolar RNA helicase 2 Q9NR30 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685512093 .
Nucleolin P19338 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685520942 .
Nucleophosmin P06748 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685524627 .
Organic anion transporter 7 Q8IVM8 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685511472 .
PCCase subunit beta P05166 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.953951544 .
Peptidyl-prolyl cis-trans isomerase FKBP11 Q9NYL4 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685518218 .
Peroxisomal membrane protein PMP34 O43808 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685513563 .
Phospholipase B-like 1 Q6P4A8 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685511446 .
Plakophilin-1 Q13835 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515678 .
Polyadenylate-binding protein 1 P11940 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685538892 .
Polymeric immunoglobulin receptor P01833 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685512196 .
Polyubiquitin-C P0CG48 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986225527 .
Positive cofactor 4 P53999 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685528669 .
Probable ATP-dependent RNA helicase DDX17 Q92841 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685511139 .
Probable non-functional immunoglobulin kappa variable 2D-24 A0A075B6R9 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986176063 .
Profilin-1 P07737 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685518923 .
Prolactin-inducible protein P12273 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.787116092 .
Proline-rich peptide P-B P02814 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685532434 .
Proteasome subunit alpha type-4 P25789 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685516588 .
Proteasome subunit alpha-type 8 Q8TAA3 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685513843 .
Proteasome subunit beta type-5 P28074 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685517156 .
Protein jagunal homolog 1 Q8N5M9 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986180144 .
Protein lin-28 homolog B Q6ZN17 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685517943 .
Protein S100-A14 Q9HCY8 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685517905 .
Protein S100-A7 P31151 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.99409776 .
Protein S100-A9 P06702 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.988737262 .
Protein TRAM1 Q15629 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515479 .
Protein transport protein Sec61 subunit beta P60468 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685528865 .
Protein-glutamine gamma-glutamyltransferase E Q08188 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.988670377 .
Pyruvate kinase PKM P14618 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685515177 .
Ras-related protein Rab-6B Q9NRW1 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986197302 .
Receptor of activated protein C kinase 1 P63244 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685527115 .
Reticulon-3 O95197 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685517218 .
Reticulon-4 Q9NQC3 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.993605543 .
Ribosome-binding protein 1 Q9P2E9 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685518646 .
RNA-binding motif protein P38159 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986179959 .
RNA-binding protein 14 Q96PK6 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.9861717 .
rRNA 2'-O-methyltransferase fibrillarin P22087 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685516435 .
Secreted Ly-6/uPAR-related protein 1 P55000 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685518218 .
Secretoglobin family 1D member 2 O95969 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986181451 .
Serine protease 1 P07477 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68552462 .
Serine/arginine-rich splicing factor 1 Q07955 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.977182231 .
Serine/arginine-rich splicing factor 10 O75494 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685518737 .
Serine/arginine-rich splicing factor 3 P84103 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986202692 .
Serine/arginine-rich splicing factor 7 Q16629 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.994037586 .
Serine/arginine-rich splicing factor 9 Q13242 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68551664 .
Serpin A12 Q8IW75 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.967052241 .
Serpin B12 Q96P63 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68552916 .
Serpin B3 P29508 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.769949135 .
Sigma intracellular receptor 2 Q5BJF2 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986200029 .
Similar to Laminin receptor 1 A0A024R7P5 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685522451 .
Skin-specific protein 32 Q5T750 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.98865355 .
Small nuclear ribonucleoprotein Sm D1 P62314 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685520922 .
Small nuclear ribonucleoprotein Sm D3 P62318 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986174964 .
snRNP-N P63162 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685517632 .
Solute carrier family 12 member 4 Q9UP95 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685510794 .
Sphingolipid delta(4)-desaturase DES1 O15121 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685517055 .
Splicing factor P23246 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.9237784 .
Stress-70 protein P38646 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986192246 .
Suprabasin Q6UWP8 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.994012141 .
Target of rapamycin complex 2 subunit MAPKAP1 Q9BPZ7 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986166936 .
TBC1 domain family member 2B Q9UPU7 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685510832 .
Thyroid hormone receptor-associated protein 3 Q9Y2W1 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685512196 .
Toll-interacting protein Q9H0E2 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685513388 .
Translocon-associated protein subunit delta P51571 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986172647 .
Transmembrane protein 205 Q6UW68 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.986175634 .
Transmembrane protein 33 P57088 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.974740528 .
Transmembrane protein 43 Q9BTV4 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.993965014 .
Tubulin alpha-1C chain Q9BQE3 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.68552462 .
Ubiquitin carboxyl-terminal hydrolase 37 Q86T82 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685511214 .
VDAC-1 P21796 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.993978403 .
Y-box-binding protein 1 P67809 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.98617411 .
Zinc-alpha-2-glycoprotein P25311 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.702190513 .
Zymogen granule protein 16 homolog B Q96DA0 Homo sapiens Pro Info Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) . Liver . MIST = 0.685528653 .

Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain

GO Term GO Category GO ID Adjusted P-value Odds Ratio Combined Score
RNA Binding Molecular Function GO:0003723 4.86E-51 11.02496268 1339.679894
mRNA Binding Molecular Function GO:0003729 1.56E-16 11.03662427 456.5602284
Cadherin Binding Molecular Function GO:0045296 1.05E-09 7.178920214 181.1998413
Regulatory RNA Binding Molecular Function GO:0061980 0.000485185 15.16205837 180.5444398
rRNA Binding Molecular Function GO:0019843 0.000667794 13.64308756 155.0544265
miRNA Binding Molecular Function GO:0035198 0.000755029 18.87710245 208.7799182
Endopeptidase Inhibitor Activity Molecular Function GO:0004866 0.001524384 7.038640429 71.81676336
Ribosome Binding Molecular Function GO:0043022 0.001657264 8.184532289 81.73160905
mRNA 3'-UTR Binding Molecular Function GO:0003730 0.002622508 7.420165805 69.81901144
Single-Stranded RNA Binding Molecular Function GO:0003727 0.003234508 11.91393047 108.3483066
mRNA 5'-UTR Binding Molecular Function GO:0048027 0.00350762 18.04292237 160.8786737
N6-methyladenosine-containing RNA Binding Molecular Function GO:1990247 0.00350762 38.51298701 337.8649886
Poly-Pyrimidine Tract Binding Molecular Function GO:0008187 0.00350762 17.18286584 150.3643158
Serine-Type Endopeptidase Inhibitor Activity Molecular Function GO:0004867 0.00629252 9.427083333 76.28675653
pre-mRNA Binding Molecular Function GO:0036002 0.006304413 13.87495609 111.2967914
Protease Binding Molecular Function GO:0002020 0.009197148 5.399129002 40.92125979
Protein Kinase Binding Molecular Function GO:0019901 0.010946861 2.803340183 20.58899081
Oxidoreductase Activity, Acting On The CH-CH Group Of Donors, NAD Or NADP As Acceptor Molecular Function GO:0016628 0.015777822 17.96545455 124.3521828
Large Ribosomal Subunit rRNA Binding Molecular Function GO:0070180 0.018349452 59.65007541 400.6502935
snRNA Binding Molecular Function GO:0017069 0.019014572 9.243882449 61.2848873
Large Ribosomal Subunit Cellular Component GO:0015934 6.33E-28 72.04543947 4829.87017
Cytosolic Large Ribosomal Subunit Cellular Component GO:0022625 6.33E-28 72.04543947 4829.87017
Ribosome Cellular Component GO:0005840 3.17E-26 55.3943105 3474.407999
Focal Adhesion Cellular Component GO:0005925 2.83E-16 8.808096325 348.1024983
Cell-Substrate Junction Cellular Component GO:0030055 4.06E-16 8.610963255 335.2821299
Polysomal Ribosome Cellular Component GO:0042788 1.29E-13 60.31076582 1989.744824
Cytosolic Small Ribosomal Subunit Cellular Component GO:0022627 3.84E-13 38.72789672 1229.537941
Small Ribosomal Subunit Cellular Component GO:0015935 4.66E-13 37.43507109 1176.263354
Intracellular Non-Membrane-Bounded Organelle Cellular Component GO:0043232 1.27E-10 3.862244406 99.25426029
Nuclear Lumen Cellular Component GO:0031981 3.17E-09 4.262172075 95.35551096
Intracellular Membrane-Bounded Organelle Cellular Component GO:0043231 8.55E-09 2.355240498 50.05124829
Nucleolus Cellular Component GO:0005730 8.55E-09 4.153624718 88.0514128
Nucleus Cellular Component GO:0005634 1.58E-08 2.366959017 48.52771798
Azurophil Granule Cellular Component GO:0042582 2.60E-08 9.328582578 185.9353129
Secretory Granule Lumen Cellular Component GO:0034774 1.98E-07 5.739433623 102.3595762
Endoplasmic Reticulum Membrane Cellular Component GO:0005789 3.28E-06 3.382119127 50.60203209
Azurophil Granule Lumen Cellular Component GO:0035578 6.45E-06 10.35473131 147.2806847
Ficolin-1-Rich Granule Cellular Component GO:0101002 1.02E-05 6.482420368 88.87352443
Vacuolar Lumen Cellular Component GO:0005775 1.73E-05 6.789213836 89.11486637
Asymmetric Synapse Cellular Component GO:0032279 2.05E-05 7.501813046 96.83030556
Cytoplasmic Translation Biological Process GO:0002181 1.04E-41 63.29466251 6428.988134
Gene Expression Biological Process GO:0010467 3.50E-35 19.66672635 1688.440403
Peptide Biosynthetic Process Biological Process GO:0043043 5.93E-33 29.74788099 2389.224119
Macromolecule Biosynthetic Process Biological Process GO:0009059 1.10E-30 24.69145342 1847.12829
Translation Biological Process GO:0006412 3.51E-28 19.03646087 1309.987155
mRNA Splicing, Via Spliceosome Biological Process GO:0000398 5.34E-13 11.34370476 382.0073695
mRNA Processing Biological Process GO:0006397 6.16E-13 11.16474917 372.6548788
RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile Biological Process GO:0000377 2.76E-11 11.3477043 334.0854298
Positive Regulation Of Cytoplasmic Translation Biological Process GO:2000767 8.96E-11 122.6108527 3451.097192
CRD-mediated mRNA Stabilization Biological Process GO:0070934 3.01E-10 213.6080247 5726.746273
RNA Processing Biological Process GO:0006396 3.01E-10 10.43654102 279.009801
Negative Regulation Of Nuclear-Transcribed mRNA Catabolic Process, Deadenylation-Dependent Decay Biological Process GO:1900152 6.97E-10 160.1979167 4134.303249
Negative Regulation Of mRNA Catabolic Process Biological Process GO:1902373 2.09E-09 29.90458882 736.5478872
Regulation Of Cytoplasmic Translation Biological Process GO:2000765 1.28E-08 45.95581395 1045.113232
mRNA Stabilization Biological Process GO:0048255 2.80E-08 21.54602031 471.6521575
Regulation Of mRNA Splicing, Via Spliceosome Biological Process GO:0048024 4.95E-08 13.65969252 290.3600272
Regulation Of Translation Biological Process GO:0006417 8.47E-08 8.141291361 168.1968934
Positive Regulation Of Translation Biological Process GO:0045727 2.24E-07 11.65936019 228.8605898
Regulation Of Nuclear-Transcribed mRNA Catabolic Process, Deadenylation-Dependent Decay Biological Process GO:1900151 2.92E-07 40.02517361 772.9114506
Negative Regulation Of Amide Metabolic Process Biological Process GO:0034249 4.78E-07 12.46232168 233.874056

Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain

Pathways Category Adjusted P-value Odds Ratio Combined Score
Ribosome KEGG Pathway 2.13E-33 29.74788099 2389.224119
Coronavirus disease KEGG Pathway 1.46E-27 18.5036181 1224.618619
Spliceosome KEGG Pathway 6.62E-06 8.093550381 128.8080705
Steroid biosynthesis KEGG Pathway 9.03E-05 30.21712538 393.2501875
Protein processing in endoplasmic reticulum KEGG Pathway 0.000742696 5.720117808 61.11020239
Amyotrophic lateral sclerosis KEGG Pathway 0.001696843 3.718086124 35.97182358
Glycolysis / Gluconeogenesis KEGG Pathway 0.002352977 8.93676815 82.16250263
Parkinson disease KEGG Pathway 0.040110123 3.42353972 21.30907433
Alzheimer disease KEGG Pathway 0.05318881 2.814496153 16.36874657
Biosynthesis of unsaturated fatty acids KEGG Pathway 0.05318881 11.22329545 64.18511191
RNA degradation KEGG Pathway 0.173561564 4.79805175 21.30778302
Lysosome KEGG Pathway 0.18191386 3.664876557 15.53407406
Proteasome KEGG Pathway 0.18191386 6.258139535 26.45233585
Sphingolipid metabolism KEGG Pathway 0.194137861 5.849110672 23.73251679
Pathways of neurodegeneration KEGG Pathway 0.194137861 2.159675911 8.679160603
Spinocerebellar ataxia KEGG Pathway 0.224585576 3.26402739 12.43106814
Glutathione metabolism KEGG Pathway 0.23359297 4.980555556 18.22577433
Diabetic cardiomyopathy KEGG Pathway 0.23359297 2.748134459 9.971139771
Amoebiasis KEGG Pathway 0.23359297 3.667691734 13.1939066
Ribosome biogenesis in eukaryotes KEGG Pathway 0.24926735 3.455040393 11.80312225

Virus RNA Sequence Information

>AF086833.2 Ebola virus - Mayinga, Zaire, 1976, complete genome CGGACACACAAAAAGAAAGAAGAATTTTTAGGATCTTTTGTGTGCGAATAACTATGAGGAAGATTAATAA TTTTCCTCTCATTGAAATTTATATCGGAATTTAAATTGAAATTGTTACTGTAATCACACCTGGTTTGTTT CAGAGCCACATCACAAAGATAGAGAACAACCTAGGTCTCCGAAGGGAGCAAGGGCATCAGTGTGCTCAGT TGAAAATCCCTTGTCAACACCTAGGTCTTATCACATCACAAGTTCCACCTCAGACTCTGCAGGGTGATCC AACAACCTTAATAGAAACATTATTGTTAAAGGACAGCATTAGTTCACAGTCAAACAAGCAAGATTGAGAA TTAACCTTGGTTTTGAACTTGAACACTTAGGGGATTGAAGATTCAACAACCCTAAAGCTTGGGGTAAAAC ATTGGAAATAGTTAAAAGACAAATTGCTCGGAATCACAAAATTCCGAGTATGGATTCTCGTCCTCAGAAA ATCTGGATGGCGCCGAGTCTCACTGAATCTGACATGGATTACCACAAGATCTTGACAGCAGGTCTGTCCG TTCAACAGGGGATTGTTCGGCAAAGAGTCATCCCAGTGTATCAAGTAAACAATCTTGAAGAAATTTGCCA ACTTATCATACAGGCCTTTGAAGCAGGTGTTGATTTTCAAGAGAGTGCGGACAGTTTCCTTCTCATGCTT TGTCTTCATCATGCGTACCAGGGAGATTACAAACTTTTCTTGGAAAGTGGCGCAGTCAAGTATTTGGAAG GGCACGGGTTCCGTTTTGAAGTCAAGAAGCGTGATGGAGTGAAGCGCCTTGAGGAATTGCTGCCAGCAGT ATCTAGTGGAAAAAACATTAAGAGAACACTTGCTGCCATGCCGGAAGAGGAGACAACTGAAGCTAATGCC GGTCAGTTTCTCTCCTTTGCAAGTCTATTCCTTCCGAAATTGGTAGTAGGAGAAAAGGCTTGCCTTGAGA AGGTTCAAAGGCAAATTCAAGTACATGCAGAGCAAGGACTGATACAATATCCAACAGCTTGGCAATCAGT AGGACACATGATGGTGATTTTCCGTTTGATGCGAACAAATTTTCTGATCAAATTTCTCCTAATACACCAA GGGATGCACATGGTTGCCGGGCATGATGCCAACGATGCTGTGATTTCAAATTCAGTGGCTCAAGCTCGTT TTTCAGGCTTATTGATTGTCAAAACAGTACTTGATCATATCCTACAAAAGACAGAACGAGGAGTTCGTCT CCATCCTCTTGCAAGGACCGCCAAGGTAAAAAATGAGGTGAACTCCTTTAAGGCTGCACTCAGCTCCCTG GCCAAGCATGGAGAGTATGCTCCTTTCGCCCGACTTTTGAACCTTTCTGGAGTAAATAATCTTGAGCATG GTCTTTTCCCTCAACTATCGGCAATTGCACTCGGAGTCGCCACAGCACACGGGAGTACCCTCGCAGGAGT AAATGTTGGAGAACAGTATCAACAACTCAGAGAGGCTGCCACTGAGGCTGAGAAGCAACTCCAACAATAT GCAGAGTCTCGCGAACTTGACCATCTTGGACTTGATGATCAGGAAAAGAAAATTCTTATGAACTTCCATC AGAAAAAGAACGAAATCAGCTTCCAGCAAACAAACGCTATGGTAACTCTAAGAAAAGAGCGCCTGGCCAA GCTGACAGAAGCTATCACTGCTGCGTCACTGCCCAAAACAAGTGGACATTACGATGATGATGACGACATT CCCTTTCCAGGACCCATCAATGATGACGACAATCCTGGCCATCAAGATGATGATCCGACTGACTCACAGG ATACGACCATTCCCGATGTGGTGGTTGATCCCGATGATGGAAGCTACGGCGAATACCAGAGTTACTCGGA AAACGGCATGAATGCACCAGATGACTTGGTCCTATTCGATCTAGACGAGGACGACGAGGACACTAAGCCA GTGCCTAATAGATCGACCAAGGGTGGACAACAGAAGAACAGTCAAAAGGGCCAGCATATAGAGGGCAGAC AGACACAATCCAGGCCAATTCAAAATGTCCCAGGCCCTCACAGAACAATCCACCACGCCAGTGCGCCACT CACGGACAATGACAGAAGAAATGAACCCTCCGGCTCAACCAGCCCTCGCATGCTGACACCAATTAACGAA GAGGCAGACCCACTGGACGATGCCGACGACGAGACGTCTAGCCTTCCGCCCTTGGAGTCAGATGATGAAG AGCAGGACAGGGACGGAACTTCCAACCGCACACCCACTGTCGCCCCACCGGCTCCCGTATACAGAGATCA CTCTGAAAAGAAAGAACTCCCGCAAGACGAGCAACAAGATCAGGACCACACTCAAGAGGCCAGGAACCAG GACAGTGACAACACCCAGTCAGAACACTCTTTTGAGGAGATGTATCGCCACATTCTAAGATCACAGGGGC CATTTGATGCTGTTTTGTATTATCATATGATGAAGGATGAGCCTGTAGTTTTCAGTACCAGTGATGGCAA AGAGTACACGTATCCAGACTCCCTTGAAGAGGAATATCCACCATGGCTCACTGAAAAAGAGGCTATGAAT GAAGAGAATAGATTTGTTACATTGGATGGTCAACAATTTTATTGGCCGGTGATGAATCACAAGAATAAAT TCATGGCAATCCTGCAACATCATCAGTGAATGAGCATGGAACAATGGGATGATTCAACCGACAAATAGCT AACATTAAGTAGTCAAGGAACGAAAACAGGAAGAATTTTTGATGTCTAAGGTGTGAATTATTATCACAAT AAAAGTGATTCTTATTTTTGAATTTAAAGCTAGCTTATTATTACTAGCCGTTTTTCAAAGTTCAATTTGA GTCTTAATGCAAATAGGCGTTAAGCCACAGTTATAGCCATAATTGTAACTCAATATTCTAACTAGCGATT TATCTAAATTAAATTACATTATGCTTTTATAACTTACCTACTAGCCTGCCCAACATTTACACGATCGTTT TATAATTAAGAAAAAACTAATGATGAAGATTAAAACCTTCATCATCCTTACGTCAATTGAATTCTCTAGC ACTCGAAGCTTATTGTCTTCAATGTAAAAGAAAAGCTGGTCTAACAAGATGACAACTAGAACAAAGGGCA GGGGCCATACTGCGGCCACGACTCAAAACGACAGAATGCCAGGCCCTGAGCTTTCGGGCTGGATCTCTGA GCAGCTAATGACCGGAAGAATTCCTGTAAGCGACATCTTCTGTGATATTGAGAACAATCCAGGATTATGC TACGCATCCCAAATGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGTCAAACCCAAACGGACCCAA TTTGCAATCATAGTTTTGAGGAGGTAGTACAAACATTGGCTTCATTGGCTACTGTTGTGCAACAACAAAC CATCGCATCAGAATCATTAGAACAACGCATTACGAGTCTTGAGAATGGTCTAAAGCCAGTTTATGATATG GCAAAAACAATCTCCTCATTGAACAGGGTTTGTGCTGAGATGGTTGCAAAATATGATCTTCTGGTGATGA CAACCGGTCGGGCAACAGCAACCGCTGCGGCAACTGAGGCTTATTGGGCCGAACATGGTCAACCACCACC TGGACCATCACTTTATGAAGAAAGTGCGATTCGGGGTAAGATTGAATCTAGAGATGAGACCGTCCCTCAA AGTGTTAGGGAGGCATTCAACAATCTAAACAGTACCACTTCACTAACTGAGGAAAATTTTGGGAAACCTG ACATTTCGGCAAAGGATTTGAGAAACATTATGTATGATCACTTGCCTGGTTTTGGAACTGCTTTCCACCA ATTAGTACAAGTGATTTGTAAATTGGGAAAAGATAGCAACTCATTGGACATCATTCATGCTGAGTTCCAG GCCAGCCTGGCTGAAGGAGACTCTCCTCAATGTGCCCTAATTCAAATTACAAAAAGAGTTCCAATCTTCC AAGATGCTGCTCCACCTGTCATCCACATCCGCTCTCGAGGTGACATTCCCCGAGCTTGCCAGAAAAGCTT GCGTCCAGTCCCACCATCGCCCAAGATTGATCGAGGTTGGGTATGTGTTTTTCAGCTTCAAGATGGTAAA ACACTTGGACTCAAAATTTGAGCCAATCTCCCTTCCCTCCGAAAGAGGCGAATAATAGCAGAGGCTTCAA CTGCTGAACTATAGGGTACGTTACATTAATGATACACTTGTGAGTATCAGCCCTGGATAATATAAGTCAA TTAAACGACCAAGATAAAATTGTTCATATCTCGCTAGCAGCTTAAAATATAAATGTAATAGGAGCTATAT CTCTGACAGTATTATAATCAATTGTTATTAAGTAACCCAAACCAAAAGTGATGAAGATTAAGAAAAACCT ACCTCGGCTGAGAGAGTGTTTTTTCATTAACCTTCATCTTGTAAACGTTGAGCAAAATTGTTAAAAATAT GAGGCGGGTTATATTGCCTACTGCTCCTCCTGAATATATGGAGGCCATATACCCTGTCAGGTCAAATTCA ACAATTGCTAGAGGTGGCAACAGCAATACAGGCTTCCTGACACCGGAGTCAGTCAATGGGGACACTCCAT CGAATCCACTCAGGCCAATTGCCGATGACACCATCGACCATGCCAGCCACACACCAGGCAGTGTGTCATC AGCATTCATCCTTGAAGCTATGGTGAATGTCATATCGGGCCCCAAAGTGCTAATGAAGCAAATTCCAATT TGGCTTCCTCTAGGTGTCGCTGATCAAAAGACCTACAGCTTTGACTCAACTACGGCCGCCATCATGCTTG CTTCATACACTATCACCCATTTCGGCAAGGCAACCAATCCACTTGTCAGAGTCAATCGGCTGGGTCCTGG AATCCCGGATCATCCCCTCAGGCTCCTGCGAATTGGAAACCAGGCTTTCCTCCAGGAGTTCGTTCTTCCG CCAGTCCAACTACCCCAGTATTTCACCTTTGATTTGACAGCACTCAAACTGATCACCCAACCACTGCCTG CTGCAACATGGACCGATGACACTCCAACAGGATCAAATGGAGCGTTGCGTCCAGGAATTTCATTTCATCC AAAACTTCGCCCCATTCTTTTACCCAACAAAAGTGGGAAGAAGGGGAACAGTGCCGATCTAACATCTCCG GAGAAAATCCAAGCAATAATGACTTCACTCCAGGACTTTAAGATCGTTCCAATTGATCCAACCAAAAATA TCATGGGAATCGAAGTGCCAGAAACTCTGGTCCACAAGCTGACCGGTAAGAAGGTGACTTCTAAAAATGG ACAACCAATCATCCCTGTTCTTTTGCCAAAGTACATTGGGTTGGACCCGGTGGCTCCAGGAGACCTCACC ATGGTAATCACACAGGATTGTGACACGTGTCATTCTCCTGCAAGTCTTCCAGCTGTGATTGAGAAGTAAT TGCAATAATTGACTCAGATCCAGTTTTATAGAATCTTCTCAGGGATAGTGATAACATCTATTTAGTAATC CGTCCATTAGAGGAGACACTTTTAATTGATCAATATACTAAAGGTGCTTTACACCATTGTCTTTTTTCTC TCCTAAATGTAGAACTTAACAAAAGACTCATAATATACTTGTTTTTAAAGGATTGATTGATGAAAGATCA TAACTAATAACATTACAAATAATCCTACTATAATCAATACGGTGATTCAAATGTTAATCTTTCTCATTGC ACATACTTTTTGCCCTTATCCTCAAATTGCCTGCATGCTTACATCTGAGGATAGCCAGTGTGACTTGGAT TGGAAATGTGGAGAAAAAATCGGGACCCATTTCTAGGTTGTTCACAATCCAAGTACAGACATTGCCCTTC TAATTAAGAAAAAATCGGCGATGAAGATTAAGCCGACAGTGAGCGTAATCTTCATCTCTCTTAGATTATT TGTTTTCCAGAGTAGGGGTCGTCAGGTCCTTTTCAATCGTGTAACCAAAATAAACTCCACTAGAAGGATA TTGTGGGGCAACAACACAATGGGCGTTACAGGAATATTGCAGTTACCTCGTGATCGATTCAAGAGGACAT CATTCTTTCTTTGGGTAATTATCCTTTTCCAAAGAACATTTTCCATCCCACTTGGAGTCATCCACAATAG CACATTACAGGTTAGTGATGTCGACAAACTAGTTTGTCGTGACAAACTGTCATCCACAAATCAATTGAGA TCAGTTGGACTGAATCTCGAAGGGAATGGAGTGGCAACTGACGTGCCATCTGCAACTAAAAGATGGGGCT TCAGGTCCGGTGTCCCACCAAAGGTGGTCAATTATGAAGCTGGTGAATGGGCTGAAAACTGCTACAATCT TGAAATCAAAAAACCTGACGGGAGTGAGTGTCTACCAGCAGCGCCAGACGGGATTCGGGGCTTCCCCCGG TGCCGGTATGTGCACAAAGTATCAGGAACGGGACCGTGTGCCGGAGACTTTGCCTTCCATAAAGAGGGTG CTTTCTTCCTGTATGATCGACTTGCTTCCACAGTTATCTACCGAGGAACGACTTTCGCTGAAGGTGTCGT TGCATTTCTGATACTGCCCCAAGCTAAGAAGGACTTCTTCAGCTCACACCCCTTGAGAGAGCCGGTCAAT GCAACGGAGGACCCGTCTAGTGGCTACTATTCTACCACAATTAGATATCAGGCTACCGGTTTTGGAACCA ATGAGACAGAGTACTTGTTCGAGGTTGACAATTTGACCTACGTCCAACTTGAATCAAGATTCACACCACA GTTTCTGCTCCAGCTGAATGAGACAATATATACAAGTGGGAAAAGGAGCAATACCACGGGAAAACTAATT TGGAAGGTCAACCCCGAAATTGATACAACAATCGGGGAGTGGGCCTTCTGGGAAACTAAAAAAACCTCAC TAGAAAAATTCGCAGTGAAGAGTTGTCTTTCACAGTTGTATCAAACGGAGCCAAAAACATCAGTGGTCAG AGTCCGGCGCGAACTTCTTCCGACCCAGGGACCAACACAACAACTGAAGACCACAAAATCATGGCTTCAG AAAATTCCTCTGCAATGGTTCAAGTGCACAGTCAAGGAAGGGAAGCTGCAGTGTCGCATCTAACAACCCT TGCCACAATCTCCACGAGTCCCCAATCCCTCACAACCAAACCAGGTCCGGACAACAGCACCCATAATACA CCCGTGTATAAACTTGACATCTCTGAGGCAACTCAAGTTGAACAACATCACCGCAGAACAGACAACGACA GCACAGCCTCCGACACTCCCTCTGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAG CAAGAGCACTGACTTCCTGGACCCCGCCACCACAACAAGTCCCCAAAACCACAGCGAGACCGCTGGCAAC AACAACACTCATCACCAAGATACCGGAGAAGAGAGTGCCAGCAGCGGGAAGCTAGGCTTAATTACCAATA CTATTGCTGGAGTCGCAGGACTGATCACAGGCGGGAGAAGAACTCGAAGAGAAGCAATTGTCAATGCTCA ACCCAAATGCAACCCTAATTTACATTACTGGACTACTCAGGATGAAGGTGCTGCAATCGGACTGGCCTGG ATACCATATTTCGGGCCAGCAGCCGAGGGAATTTACATAGAGGGGCTAATGCACAATCAAGATGGTTTAA TCTGTGGGTTGAGACAGCTGGCCAACGAGACGACTCAAGCTCTTCAACTGTTCCTGAGAGCCACAACTGA GCTACGCACCTTTTCAATCCTCAACCGTAAGGCAATTGATTTCTTGCTGCAGCGATGGGGCGGCACATGC CACATTCTGGGACCGGACTGCTGTATCGAACCACATGATTGGACCAAGAACATAACAGACAAAATTGATC AGATTATTCATGATTTTGTTGATAAAACCCTTCCGGACCAGGGGGACAATGACAATTGGTGGACAGGATG GAGACAATGGATACCGGCAGGTATTGGAGTTACAGGCGTTATAATTGCAGTTATCGCTTTATTCTGTATA TGCAAATTTGTCTTTTAGTTTTTCTTCAGATTGCTTCATGGAAAAGCTCAGCCTCAAATCAATGAAACCA GGATTTAATTATATGGATTACTTGAATCTAAGATTACTTGACAAATGATAATATAATACACTGGAGCTTT AAACATAGCCAATGTGATTCTAACTCCTTTAAACTCACAGTTAATCATAAACAAGGTTTGACATCAATCT AGTTATCTCTTTGAGAATGATAAACTTGATGAAGATTAAGAAAAAGGTAATCTTTCGATTATCTTTAATC TTCATCCTTGATTCTACAATCATGACAGTTGTCTTTAGTGACAAGGGAAAGAAGCCTTTTTATTAAGTTG TAATAATCAGATCTGCGAACCGGTAGAGTTTAGTTGCAACCTAACACACATAAAGCATTGGTCAAAAAGT CAATAGAAATTTAAACAGTGAGTGGAGACAACTTTTAAATGGAAGCTTCATATGAGAGAGGACGCCCACG AGCTGCCAGACAGCATTCAAGGGATGGACACGACCACCATGTTCGAGCACGATCATCATCCAGAGAGAAT TATCGAGGTGAGTACCGTCAATCAAGGAGCGCCTCACAAGTGCGCGTTCCTACTGTATTTCATAAGAAGA GAGTTGAACCATTAACAGTTCCTCCAGCACCTAAAGACATATGTCCGACCTTGAAAAAAGGATTTTTGTG TGACAGTAGTTTTTGCAAAAAAGATCACCAGTTGGAGAGTTTAACTGATAGGGAATTACTCCTACTAATC GCCCGTAAGACTTGTGGATCAGTAGAACAACAATTAAATATAACTGCACCCAAGGACTCGCGCTTAGCAA ATCCAACGGCTGATGATTTCCAGCAAGAGGAAGGTCCAAAAATTACCTTGTTGACACTGATCAAGACGGC AGAACACTGGGCGAGACAAGACATCAGAACCATAGAGGATTCAAAATTAAGAGCATTGTTGACTCTATGT GCTGTGATGACGAGGAAATTCTCAAAATCCCAGCTGAGTCTTTTATGTGAGACACACCTAAGGCGCGAGG GGCTTGGGCAAGATCAGGCAGAACCCGTTCTCGAAGTATATCAACGATTACACAGTGATAAAGGAGGCAG TTTTGAAGCTGCACTATGGCAACAATGGGACCGACAATCCCTAATTATGTTTATCACTGCATTCTTGAAT ATTGCTCTCCAGTTACCGTGTGAAAGTTCTGCTGTCGTTGTTTCAGGGTTAAGAACATTGGTTCCTCAAT CAGATAATGAGGAAGCTTCAACCAACCCGGGGACATGCTCATGGTCTGATGAGGGTACCCCTTAATAAGG CTGACTAAAACACTATATAACCTTCTACTTGATCACAATACTCCGTATACCTATCATCATATATTTAATC AAGACGATATCCTTTAAAACTTATTCAGTACTATAATCACTCTCGTTTCAAATTAATAAGATGTGCATGA TTGCCCTAATATATGAAGAGGTATGATACAACCCTAACAGTGATCAAAGAAAATCATAATCTCGTATCGC TCGTAATATAACCTGCCAAGCATACCTCTTGCACAAAGTGATTCTTGTACACAAATAATGTTTTACTCTA CAGGAGGTAGCAACGATCCATCCCATCAAAAAATAAGTATTTCATGACTTACTAATGATCTCTTAAAATA TTAAGAAAAACTGACGGAACATAAATTCTTTATGCTTCAAGCTGTGGAGGAGGTGTTTGGTATTGGCTAT TGTTATATTACAATCAATAACAAGCTTGTAAAAATATTGTTCTTGTTTCAAGAGGTAGATTGTGACCGGA AATGCTAAACTAATGATGAAGATTAATGCGGAGGTCTGATAAGAATAAACCTTATTATTCAGATTAGGCC CCAAGAGGCATTCTTCATCTCCTTTTAGCAAAGTACTATTTCAGGGTAGTCCAATTAGTGGCACGTCTTT TAGCTGTATATCAGTCGCCCCTGAGATACGCCACAAAAGTGTCTCTAAGCTAAATTGGTCTGTACACATC CCATACATTGTATTAGGGGCAATAATATCTAATTGAACTTAGCCGTTTAAAATTTAGTGCATAAATCTGG GCTAACACCACCAGGTCAACTCCATTGGCTGAAAAGAAGCTTACCTACAACGAACATCACTTTGAGCGCC CTCACAATTAAAAAATAGGAACGTCGTTCCAACAATCGAGCGCAAGGTTTCAAGGTTGAACTGAGAGTGT CTAGACAACAAAATATTGATACTCCAGACACCAAGCAAGACCTGAGAAAAAACCATGGCTAAAGCTACGG GACGATACAATCTAATATCGCCCAAAAAGGACCTGGAGAAAGGGGTTGTCTTAAGCGACCTCTGTAACTT CTTAGTTAGCCAAACTATTCAGGGGTGGAAGGTTTATTGGGCTGGTATTGAGTTTGATGTGACTCACAAA GGAATGGCCCTATTGCATAGACTGAAAACTAATGACTTTGCCCCTGCATGGTCAATGACAAGGAATCTCT TTCCTCATTTATTTCAAAATCCGAATTCCACAATTGAATCACCGCTGTGGGCATTGAGAGTCATCCTTGC AGCAGGGATACAGGACCAGCTGATTGACCAGTCTTTGATTGAACCCTTAGCAGGAGCCCTTGGTCTGATC TCTGATTGGCTGCTAACAACCAACACTAACCATTTCAACATGCGAACACAACGTGTCAAGGAACAATTGA GCCTAAAAATGCTGTCGTTGATTCGATCCAATATTCTCAAGTTTATTAACAAATTGGATGCTCTACATGT CGTGAACTACAACGGATTGTTGAGCAGTATTGAAATTGGAACTCAAAATCATACAATCATCATAACTCGA ACTAACATGGGTTTTCTGGTGGAGCTCCAAGAACCCGACAAATCGGCAATGAACCGCATGAAGCCTGGGC CGGCGAAATTTTCCCTCCTTCATGAGTCCACACTGAAAGCATTTACACAAGGATCCTCGACACGAATGCA AAGTTTGATTCTTGAATTTAATAGCTCTCTTGCTATCTAACTAAGGTAGAATACTTCATATTGAGCTAAC TCATATATGCTGACTCAATAGTTATCTTGACATCTCTGCTTTCATAATCAGATATATAAGCATAATAAAT AAATACTCATATTTCTTGATAATTTGTTTAACCACAGATAAATCCTCACTGTAAGCCAGCTTCCAAGTTG ACACCCTTACAAAAACCAGGACTCAGAATCCCTCAAACAAGAGATTCCAAGACAACATCATAGAATTGCT TTATTATATGAATAAGCATTTTATCACCAGAAATCCTATATACTAAATGGTTAATTGTAACTGAACCCGC AGGTCACATGTGTTAGGTTTCACAGATTCTATATATTACTAACTCTATACTCGTAATTAACATTAGATAA GTAGATTAAGAAAAAAGCCTGAGGAAGATTAAGAAAAACTGCTTATTGGGTCTTTCCGTGTTTTAGATGA AGCAGTTGAAATTCTTCCTCTTGATATTAAATGGCTACACAACATACCCAATACCCAGACGCTAGGTTAT CATCACCAATTGTATTGGACCAATGTGACCTAGTCACTAGAGCTTGCGGGTTATATTCATCATACTCCCT TAATCCGCAACTACGCAACTGTAAACTCCCGAAACATATCTACCGTTTGAAATACGATGTAACTGTTACC AAGTTCTTGAGTGATGTACCAGTGGCGACATTGCCCATAGATTTCATAGTCCCAGTTCTTCTCAAGGCAC TGTCAGGCAATGGATTCTGTCCTGTTGAGCCGCGGTGCCAACAGTTCTTAGATGAAATCATTAAGTACAC AATGCAAGATGCTCTCTTCTTGAAATATTATCTCAAAAATGTGGGTGCTCAAGAAGACTGTGTTGATGAA CACTTTCAAGAGAAAATCTTATCTTCAATTCAGGGCAATGAATTTTTACATCAAATGTTTTTCTGGTATG ATCTGGCTATTTTAACTCGAAGGGGTAGATTAAATCGAGGAAACTCTAGATCAACATGGTTTGTTCATGA TGATTTAATAGACATCTTAGGCTATGGGGACTATGTTTTTTGGAAGATCCCAATTTCAATGTTACCACTG AACACACAAGGAATCCCCCATGCTGCTATGGACTGGTATCAGGCATCAGTATTCAAAGAAGCGGTTCAAG GGCATACACACATTGTTTCTGTTTCTACTGCCGACGTCTTGATAATGTGCAAAGATTTAATTACATGTCG ATTCAACACAACTCTAATCTCAAAAATAGCAGAGATTGAGGATCCAGTTTGTTCTGATTATCCCAATTTT AAGATTGTGTCTATGCTTTACCAGAGCGGAGATTACTTACTCTCCATATTAGGGTCTGATGGGTATAAAA TTATTAAGTTCCTCGAACCATTGTGCTTGGCCAAAATTCAATTATGCTCAAAGTACACTGAGAGGAAGGG CCGATTCTTAACACAAATGCATTTAGCTGTAAATCACACCCTAGAAGAAATTACAGAAATGCGTGCACTA AAGCCTTCACAGGCTCAAAAGATCCGTGAATTCCATAGAACATTGATAAGGCTGGAGATGACGCCACAAC AACTTTGTGAGCTATTTTCCATTCAAAAACACTGGGGGCATCCTGTGCTACATAGTGAAACAGCAATCCA AAAAGTTAAAAAACATGCTACGGTGCTAAAAGCATTACGCCCTATAGTGATTTTCGAGACATACTGTGTT TTTAAATATAGTATTGCCAAACATTATTTTGATAGTCAAGGATCTTGGTACAGTGTTACTTCAGATAGGA ATCTAACACCGGGTCTTAATTCTTATATCAAAAGAAATCAATTCCCTCCGTTGCCAATGATTAAAGAACT ACTATGGGAATTTTACCACCTTGACCACCCTCCACTTTTCTCAACCAAAATTATTAGTGACTTAAGTATT TTTATAAAAGACAGAGCTACCGCAGTAGAAAGGACATGCTGGGATGCAGTATTCGAGCCTAATGTTCTAG GATATAATCCACCTCACAAATTTAGTACTAAACGTGTACCGGAACAATTTTTAGAGCAAGAAAACTTTTC TATTGAGAATGTTCTTTCCTACGCACAAAAACTCGAGTATCTACTACCACAATATCGGAACTTTTCTTTC TCATTGAAAGAGAAAGAGTTGAATGTAGGTAGAACCTTCGGAAAATTGCCTTATCCGACTCGCAATGTTC AAACACTTTGTGAAGCTCTGTTAGCTGATGGTCTTGCTAAAGCATTTCCTAGCAATATGATGGTAGTTAC GGAACGTGAGCAAAAAGAAAGCTTATTGCATCAAGCATCATGGCACCACACAAGTGATGATTTTGGTGAA CATGCCACAGTTAGAGGGAGTAGCTTTGTAACTGATTTAGAGAAATACAATCTTGCATTTAGATATGAGT TTACAGCACCTTTTATAGAATATTGCAACCGTTGCTATGGTGTTAAGAATGTTTTTAATTGGATGCATTA TACAATCCCACAGTGTTATATGCATGTCAGTGATTATTATAATCCACCACATAACCTCACACTGGAGAAT CGAGACAACCCCCCCGAAGGGCCTAGTTCATACAGGGGTCATATGGGAGGGATTGAAGGACTGCAACAAA AACTCTGGACAAGTATTTCATGTGCTCAAATTTCTTTAGTTGAAATTAAGACTGGTTTTAAGTTACGCTC AGCTGTGATGGGTGACAATCAGTGCATTACTGTTTTATCAGTCTTCCCCTTAGAGACTGACGCAGACGAG CAGGAACAGAGCGCCGAAGACAATGCAGCGAGGGTGGCCGCCAGCCTAGCAAAAGTTACAAGTGCCTGTG GAATCTTTTTAAAACCTGATGAAACATTTGTACATTCAGGTTTTATCTATTTTGGAAAAAAACAATATTT GAATGGGGTCCAATTGCCTCAGTCCCTTAAAACGGCTACAAGAATGGCACCATTGTCTGATGCAATTTTT GATGATCTTCAAGGGACCCTGGCTAGTATAGGCACTGCTTTTGAGCGATCCATCTCTGAGACACGACATA TCTTTCCTTGCAGGATAACCGCAGCTTTCCATACGTTTTTTTCGGTGAGAATCTTGCAATATCATCATCT CGGGTTCAATAAAGGTTTTGACCTTGGACAGTTAACACTCGGCAAACCTCTGGATTTCGGAACAATATCA TTGGCACTAGCGGTACCGCAGGTGCTTGGAGGGTTATCCTTCTTGAATCCTGAGAAATGTTTCTACCGGA ATCTAGGAGATCCAGTTACCTCAGGCTTATTCCAGTTAAAAACTTATCTCCGAATGATTGAGATGGATGA TTTATTCTTACCTTTAATTGCGAAGAACCCTGGGAACTGCACTGCCATTGACTTTGTGCTAAATCCTAGC GGATTAAATGTCCCTGGGTCGCAAGACTTAACTTCATTTCTGCGCCAGATTGTACGCAGGACCATCACCC TAAGTGCGAAAAACAAACTTATTAATACCTTATTTCATGCGTCAGCTGACTTCGAAGACGAAATGGTTTG TAAATGGCTATTATCATCAACTCCTGTTATGAGTCGTTTTGCGGCCGATATCTTTTCACGCACGCCGAGC GGGAAGCGATTGCAAATTCTAGGATACCTGGAAGGAACACGCACATTATTAGCCTCTAAGATCATCAACA ATAATACAGAGACACCGGTTTTGGACAGACTGAGGAAAATAACATTGCAAAGGTGGAGCCTATGGTTTAG TTATCTTGATCATTGTGATAATATCCTGGCGGAGGCTTTAACCCAAATAACTTGCACAGTTGATTTAGCA CAGATTCTGAGGGAATATTCATGGGCTCATATTTTAGAGGGAAGACCTCTTATTGGAGCCACACTCCCAT GTATGATTGAGCAATTCAAAGTGTTTTGGCTGAAACCCTACGAACAATGTCCGCAGTGTTCAAATGCAAA GCAACCAGGTGGGAAACCATTCGTGTCAGTGGCAGTCAAGAAACATATTGTTAGTGCATGGCCGAACGCA TCCCGAATAAGCTGGACTATCGGGGATGGAATCCCATACATTGGATCAAGGACAGAAGATAAGATAGGAC AACCTGCTATTAAACCAAAATGTCCTTCCGCAGCCTTAAGAGAGGCCATTGAATTGGCGTCCCGTTTAAC ATGGGTAACTCAAGGCAGTTCGAACAGTGACTTGCTAATAAAACCATTTTTGGAAGCACGAGTAAATTTA AGTGTTCAAGAAATACTTCAAATGACCCCTTCACATTACTCAGGAAATATTGTTCACAGGTACAACGATC AATACAGTCCTCATTCTTTCATGGCCAATCGTATGAGTAATTCAGCAACGCGATTGATTGTTTCTACAAA CACTTTAGGTGAGTTTTCAGGAGGTGGCCAGTCTGCACGCGACAGCAATATTATTTTCCAGAATGTTATA AATTATGCAGTTGCACTGTTCGATATTAAATTTAGAAACACTGAGGCTACAGATATCCAATATAATCGTG CTCACCTTCATCTAACTAAGTGTTGCACCCGGGAAGTACCAGCTCAGTATTTAACATACACATCTACATT GGATTTAGATTTAACAAGATACCGAGAAAACGAATTGATTTATGACAGTAATCCTCTAAAAGGAGGACTC AATTGCAATATCTCATTCGATAATCCATTTTTCCAAGGTAAACGGCTGAACATTATAGAAGATGATCTTA TTCGACTGCCTCACTTATCTGGATGGGAGCTAGCCAAGACCATCATGCAATCAATTATTTCAGATAGCAA CAATTCATCTACAGACCCAATTAGCAGTGGAGAAACAAGATCATTCACTACCCATTTCTTAACTTATCCC AAGATAGGACTTCTGTACAGTTTTGGGGCCTTTGTAAGTTATTATCTTGGCAATACAATTCTTCGGACTA AGAAATTAACACTTGACAATTTTTTATATTACTTAACTACTCAAATTCATAATCTACCACATCGCTCATT GCGAATACTTAAGCCAACATTCAAACATGCAAGCGTTATGTCACGGTTAATGAGTATTGATCCTCATTTT TCTATTTACATAGGCGGTGCTGCAGGTGACAGAGGACTCTCAGATGCGGCCAGGTTATTTTTGAGAACGT CCATTTCATCTTTTCTTACATTTGTAAAAGAATGGATAATTAATCGCGGAACAATTGTCCCTTTATGGAT AGTATATCCGCTAGAGGGTCAAAACCCAACACCTGTGAATAATTTTCTCTATCAGATCGTAGAACTGCTG GTGCATGATTCATCAAGACAACAGGCTTTTAAAACTACCATAAGTGATCATGTACATCCTCACGACAATC TTGTTTACACATGTAAGAGTACAGCCAGCAATTTCTTCCATGCATCATTGGCGTACTGGAGGAGCAGACA CAGAAACAGCAACCGAAAATACTTGGCAAGAGACTCTTCAACTGGATCAAGCACAAACAACAGTGATGGT CATATTGAGAGAAGTCAAGAACAAACCACCAGAGATCCACATGATGGCACTGAACGGAATCTAGTCCTAC AAATGAGCCATGAAATAAAAAGAACGACAATTCCACAAGAAAACACGCACCAGGGTCCGTCGTTCCAGTC CTTTCTAAGTGACTCTGCTTGTGGTACAGCAAATCCAAAACTAAATTTCGATCGATCGAGACACAATGTG AAATTTCAGGATCATAACTCGGCATCCAAGAGGGAAGGTCATCAAATAATCTCACACCGTCTAGTCCTAC CTTTCTTTACATTATCTCAAGGGACACGCCAATTAACGTCATCCAATGAGTCACAAACCCAAGACGAGAT ATCAAAGTACTTACGGCAATTGAGATCCGTCATTGATACCACAGTTTATTGTAGATTTACCGGTATAGTC TCGTCCATGCATTACAAACTTGATGAGGTCCTTTGGGAAATAGAGAGTTTCAAGTCGGCTGTGACGCTAG CAGAGGGAGAAGGTGCTGGTGCCTTACTATTGATTCAGAAATACCAAGTTAAGACCTTATTTTTCAACAC GCTAGCTACTGAGTCCAGTATAGAGTCAGAAATAGTATCAGGAATGACTACTCCTAGGATGCTTCTACCT GTTATGTCAAAATTCCATAATGACCAAATTGAGATTATTCTTAACAACTCAGCAAGCCAAATAACAGACA TAACAAATCCTACTTGGTTTAAAGACCAAAGAGCAAGGCTACCTAAGCAAGTCGAGGTTATAACCATGGA TGCAGAGACAACAGAGAATATAAACAGATCGAAATTGTACGAAGCTGTATATAAATTGATCTTACACCAT ATTGATCCTAGCGTATTGAAAGCAGTGGTCCTTAAAGTCTTTCTAAGTGATACTGAGGGTATGTTATGGC TAAATGATAATTTAGCCCCGTTTTTTGCCACTGGTTATTTAATTAAGCCAATAACGTCAAGTGCTAGATC TAGTGAGTGGTATCTTTGTCTGACGAACTTCTTATCAACTACACGTAAGATGCCACACCAAAACCATCTC AGTTGTAAACAGGTAATACTTACGGCATTGCAACTGCAAATTCAACGAAGCCCATACTGGCTAAGTCATT TAACTCAGTATGCTGACTGTGAGTTACATTTAAGTTATATCCGCCTTGGTTTTCCATCATTAGAGAAAGT ACTATACCACAGGTATAACCTCGTCGATTCAAAAAGAGGTCCACTAGTCTCTATCACTCAGCACTTAGCA CATCTTAGAGCAGAGATTCGAGAATTAACTAATGATTATAATCAACAGCGACAAAGTCGGACTCAAACAT ATCACTTTATTCGTACTGCAAAAGGACGAATCACAAAACTAGTCAATGATTATTTAAAATTCTTTCTTAT TGTGCAAGCATTAAAACATAATGGGACATGGCAAGCTGAGTTTAAGAAATTACCAGAGTTGATTAGTGTG TGCAATAGGTTCTACCATATTAGAGATTGCAATTGTGAAGAACGTTTCTTAGTTCAAACCTTATATTTAC ATAGAATGCAGGATTCTGAAGTTAAGCTTATCGAAAGGCTGACAGGGCTTCTGAGTTTATTTCCGGATGG TCTCTACAGGTTTGATTGAATTACCGTGCATAGTATCCTGATACTTGCAAAGGTTGGTTATTAACATACA GATTATAAAAAACTCATAAATTGCTCTCATACATCATATTGATCTAATCTCAATAAACAACTATTTAAAT AACGAAAGGAGTCCCTATATTATATACTATATTTAGCCTCTCTCCCTGCGTGATAATCAAAAAATTCACA ATGCAGCATGTGTGACATATTACTGCCGCAATGAATTTAACGCAACATAATAAACTCTGCACTCTTTATA ATTAAGCTTTAACGAAAGGTCTGGGCTCATATTGTTATTGATATAATAATGTTGTATCAATATCCTGTCA GATGGAATAGTGTTTTGGTTGATAACACAACTTCTTAAAACAAAATTGATCTTTAAGATTAAGTTTTTTA TAATTATCATTACTTTAATTTGTCGTTTTAAAAACGGTGATAGCCTTAATCTTTGTGTAAAATAAGAGAT TAGGTGTAATAACCTTAACATTTTTGTCTAGTAAGCTACTATTTCATACAGAATGATAAAATTAAAAGAA AAGGCAGGACTGTAAAATCAGAAATACCTTCTTTACAATATAGCAGACTAGATAATAATCTTCGTGTTAA TGATAATTAAGACATTGACCACGCTCATCAGAAGGCTCGCCAGAATAAACGTTGCAAAAAGGATTCCTGG AAAAATGGTCGCACACAAAAATTTAAAAATAAATCTATTTCTTCTTTTTTGTGTGTCCA
    Click to Show/Hide