Home
Search 
BLAST
Manual
DownloadDetails of Virus RNA
| Strain Information | Strain Name |
Zika virus (strain MR766)
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Flaviviridae
|
||||||||
| RNA Binding Site |
5'UTR - 3'UTR
|
||||||||
| Virus Information | Virus Name |
Zika virus (ZIKV)
|
|||||||
| Taxonomy ID | 64320 | ||||||||
Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.913706848 | . |
| 40S ribosomal protein S10 | P46783 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.990629188 | . |
| 40S ribosomal protein S13 | P62277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.862937308 | . |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.974249926 | . |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880154658 | . |
| 40S ribosomal protein S17 | P08708 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.877553154 | . |
| 40S ribosomal protein S18 | P62269 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.989213519 | . |
| 40S ribosomal protein S19 | P39019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.874176815 | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.879417315 | . |
| 40S ribosomal protein S20 | P60866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.990319108 | . |
| 40S ribosomal protein S23 | P62266 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.842705485 | . |
| 40S ribosomal protein S25 | P62851 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.989485353 | . |
| 40S ribosomal protein S26 | P62854 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.975626655 | . |
| 40S ribosomal protein S28 | P62857 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865587674 | . |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.990256938 | . |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.993844416 | . |
| 40S ribosomal protein S4 | P62701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880184258 | . |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.989470983 | . |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.85736217 | . |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880150374 | . |
| 60 kDa heat shock protein | P10809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.87987748 | . |
| 60S ribosomal protein L11 | P62913 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.991255484 | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.873655865 | . |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.984944505 | . |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.878994403 | . |
| 60S ribosomal protein L18 | Q07020 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880157063 | . |
| 60S ribosomal protein L21 | P46778 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.851906949 | . |
| 60S ribosomal protein L22 | P35268 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880147049 | . |
| 60S ribosomal protein L23 | P62829 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880146979 | . |
| 60S ribosomal protein L23a | P62750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865598072 | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.824141624 | . |
| 60S ribosomal protein L27 | P61353 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880155377 | . |
| 60S ribosomal protein L27a | P46776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.87788758 | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.810122983 | . |
| 60S ribosomal protein L31 | P62899 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880157013 | . |
| 60S ribosomal protein L34 | P49207 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.873659262 | . |
| 60S ribosomal protein L35 | P42766 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.983610493 | . |
| 60S ribosomal protein L36 | Q9Y3U8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.877892801 | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.957733119 | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.965892914 | . |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.868461361 | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.957313204 | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.879380602 | . |
| Actin | P68032 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880140873 | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.842697416 | . |
| ADP/ATP translocase 2 | P05141 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.936125267 | . |
| Alpha-actinin-1 | P12814 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.879370545 | . |
| Annexin A1 | P04083 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.983974142 | . |
| ATP synthase subunit a | P00846 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880143196 | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880177109 | . |
| Bleomycin hydrolase | Q13867 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.913809134 | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.864817725 | . |
| Cathepsin D | P07339 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.903234106 | . |
| CCN family member 1 | O00622 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.906311884 | . |
| Chloride intracellular channel protein 1 | O00299 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.8741708 | . |
| Chromodomain-helicase-DNA-binding protein 3 | Q12873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865574721 | . |
| CLE7 homolog | Q9Y224 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.860074821 | . |
| Corneodesmosin | Q15517 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865582399 | . |
| DBIRD complex subunit ZNF326 | Q5BKZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.808802115 | . |
| E3 ubiquitin/ISG15 ligase TRIM25 | Q14258 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.829257733 | . |
| eIF3b | P55884 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.858232666 | . |
| ELAV-like protein 1 | Q15717 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.864826371 | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.867608038 | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.867502628 | . |
| Endoplasmin | P14625 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.858235997 | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.877560422 | . |
| Eukaryotic initiation factor 4A-III | P38919 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.879578011 | . |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.837994988 | . |
| Far upstream element-binding protein 1 | Q96AE4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.867645087 | . |
| FAU ubiquitin-like and ribosomal protein S30 | P62861 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.950694203 | . |
| Fragile X messenger ribonucleoprotein 1 | Q06787 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.87754483 | . |
| Fructose-bisphosphate aldolase A | P04075 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880141088 | . |
| Gamma-glutamylcyclotransferase | O75223 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.918670894 | . |
| Gasdermin-A | Q96QA5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.772732409 | . |
| Glucosidase 2 subunit beta | P14314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865576025 | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.86293005 | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.955135788 | . |
| Heat shock protein HSP 90-beta | P08238 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.982434474 | . |
| Helicase with zinc finger domain 2 | Q9BYK8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.808799467 | . |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.864821465 | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.877891717 | . |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.938673667 | . |
| Heterogeneous nuclear ribonucleoprotein D0 | Q14103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.952354154 | . |
| Heterogeneous nuclear ribonucleoprotein F | P52597 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.936343656 | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.945037788 | . |
| Heterogeneous nuclear ribonucleoprotein H2 | P55795 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.826842994 | . |
| Heterogeneous nuclear ribonucleoprotein H3 | P31942 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.986507574 | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.966223238 | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.84743472 | . |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.989022438 | . |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.990520036 | . |
| Heterogeneous nuclear ribonucleoprotein R | O43390 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.868345762 | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.955359044 | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.98199703 | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.866639342 | . |
| High mobility group protein HMG-I/HMG-Y | P17096 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.978573216 | . |
| Histone H2A.Z | P0C0S5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.873658937 | . |
| Histone H2B type 1-J | P06899 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880147654 | . |
| IGF2 mRNA-binding protein 1 | Q9NZI8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.949811312 | . |
| IGF2 mRNA-binding protein 2 | Q9Y6M1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.843828984 | . |
| IGF2 mRNA-binding protein 3 | O00425 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.892634233 | . |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.812854532 | . |
| L-lactate dehydrogenase A chain | P00338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.735084485 | . |
| Lactotransferrin | P02788 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.749682784 | . |
| Lysosome-associated membrane glycoprotein 1 | P11279 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.84447566 | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.906196602 | . |
| Microtubule-associated protein 4 | P27816 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.873647379 | . |
| Moesin | P26038 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.863722493 | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.827964137 | . |
| Mucin-like protein 1 | Q96DR8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865585874 | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.847807097 | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.967918687 | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.850239891 | . |
| Oligosaccharyl transferase subunit DAD1 | P61803 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.88014882 | . |
| Oxidative stress-associated Src activator | Q9NZB2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.73312132 | . |
| p59scr | Q86XZ4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.808806228 | . |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.864819305 | . |
| Peptidyl-prolyl cis-trans isomerase A | P62937 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.989660951 | . |
| Peptidyl-prolyl cis-trans isomerase B | P23284 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.879682194 | . |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.879578223 | . |
| Poly(rC)-binding protein 1 | Q15365 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.850768662 | . |
| Polyubiquitin-C | P0CG48 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865579709 | . |
| Prelamin-A/C | P02545 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.879984588 | . |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.847431309 | . |
| Probable ATP-dependent RNA helicase DDX5 | P17844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865581842 | . |
| Probable ATP-dependent RNA helicase DDX6 | P26196 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.850771269 | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.99182861 | . |
| Proteasome subunit alpha type-1 | P25786 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.827959902 | . |
| Proteasome subunit alpha type-7 | O14818 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.82797275 | . |
| Proteasome subunit beta type-5 | P28074 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.802594384 | . |
| Protein disulfide-isomerase A4 | P13667 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.850234024 | . |
| Protein disulfide-isomerase A6 | Q15084 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.967182939 | . |
| Protein FAM98A | Q8NCA5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.801481913 | . |
| Protein-glutamine gamma-glutamyltransferase 2 | P21980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.863726469 | . |
| Ras GTPase-activating protein-binding protein 1 | Q13283 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.968707905 | . |
| Ras GTPase-activating protein-binding protein 2 | Q9UN86 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.864818506 | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.958773439 | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.87172851 | . |
| Rho GDP-dissociation inhibitor 1 | P52565 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865578794 | . |
| Ribosome-binding protein 1 | Q9P2E9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.866629343 | . |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.960524134 | . |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.856297175 | . |
| RNA-binding protein FUS | P35637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.983969488 | . |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.83410323 | . |
| RNA-binding protein FXR2 | P51116 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.752758999 | . |
| SAP domain-containing ribonucleoprotein | P82979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.808808152 | . |
| Secretoglobin family 1D member 2 | O95969 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865584842 | . |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.867655852 | . |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865578381 | . |
| Serine/arginine-rich splicing factor 6 | Q13247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.879578801 | . |
| Small nuclear ribonucleoprotein Sm D2 | P62316 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880158451 | . |
| Small ubiquitin-related modifier 2 | P61956 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.877550166 | . |
| SPATS2-like protein | Q9NUQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.768330541 | . |
| Spliceosome RNA helicase DDX39B | Q13838 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.872466884 | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.957984327 | . |
| Stress-70 protein | P38646 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.877546995 | . |
| Synaptophysin-like protein 1 | Q16563 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865577936 | . |
| TATA-binding protein-associated factor 2N | Q92804 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.808805947 | . |
| THO complex subunit 4 | Q86V81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.972138166 | . |
| Transcriptional activator protein Pur-alpha | Q00577 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.97475366 | . |
| Transcriptional activator protein Pur-beta | Q96QR8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880173564 | . |
| Translocon-associated protein subunit delta | P51571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880144945 | . |
| Transmembrane protein 263 | Q8WUH6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.877952735 | . |
| Treacle protein | Q13428 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.865574947 | . |
| Tubulin alpha-1C chain | Q9BQE3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.880154431 | . |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.978011497 | . |
| VDAC-1 | P21796 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.877935903 | . |
| Vigilin | Q00341 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.87025125 | . |
| Vinculin | P18206 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.785259963 | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.858236589 | . |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.978004318 | . |
| Y-box-binding protein 3 | P16989 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 20 h | MIST = 0.982439852 | . |
Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| GO Term | GO Category | GO ID | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|---|
| RNA Binding | Molecular Function |
GO:0003723
|
7.38E-120 | 53.04837753 | 14834.68317 |
| mRNA Binding | Molecular Function |
GO:0003729
|
4.03E-38 | 26.36846154 | 2392.805814 |
| Cadherin Binding | Molecular Function |
GO:0045296
|
2.09E-17 | 12.45800661 | 531.2353714 |
| mRNA 3'-UTR Binding | Molecular Function |
GO:0003730
|
4.89E-15 | 26.30835831 | 970.7087585 |
| mRNA 5'-UTR Binding | Molecular Function |
GO:0048027
|
1.24E-13 | 87.3633157 | 2921.360704 |
| Double-Stranded RNA Binding | Molecular Function |
GO:0003725
|
6.99E-09 | 22.19191919 | 495.3299876 |
| Single-Stranded RNA Binding | Molecular Function |
GO:0003727
|
8.43E-08 | 27.58606272 | 542.7716718 |
| N6-methyladenosine-containing RNA Binding | Molecular Function |
GO:1990247
|
2.79E-07 | 118.7005988 | 2177.415501 |
| Regulatory RNA Binding | Molecular Function |
GO:0061980
|
1.48E-06 | 23.99151515 | 397.2394449 |
| rRNA Binding | Molecular Function |
GO:0019843
|
2.57E-06 | 21.52649573 | 342.2990391 |
| Single-Stranded DNA Binding | Molecular Function |
GO:0003697
|
2.58E-06 | 12.52866512 | 197.5053241 |
| miRNA Binding | Molecular Function |
GO:0035198
|
2.58E-06 | 31.12362493 | 489.1525339 |
| pre-mRNA Binding | Molecular Function |
GO:0036002
|
2.95E-06 | 29.8253012 | 462.3045672 |
| Telomeric DNA Binding | Molecular Function |
GO:0042162
|
5.01E-06 | 26.50736278 | 394.9160475 |
| Ribosome Binding | Molecular Function |
GO:0043022
|
9.61E-06 | 12.51251188 | 177.3929624 |
| DNA Binding | Molecular Function |
GO:0003677
|
4.84E-05 | 3.382588997 | 42.26617114 |
| mRNA 3'-UTR AU-rich Region Binding | Molecular Function |
GO:0035925
|
0.000501224 | 24.82330827 | 250.6648525 |
| Small Ribosomal Subunit rRNA Binding | Molecular Function |
GO:0070181
|
0.000581235 | 58.64497041 | 580.1571929 |
| Poly-Pyrimidine Tract Binding | Molecular Function |
GO:0008187
|
0.000632122 | 22.4569161 | 219.0606713 |
| Ubiquitin Protein Ligase Binding | Molecular Function |
GO:0031625
|
0.001277662 | 4.627737572 | 41.64829583 |
| Cytosolic Small Ribosomal Subunit | Cellular Component |
GO:0022627
|
3.77E-31 | 137.7377483 | 10325.78343 |
| Small Ribosomal Subunit | Cellular Component |
GO:0015935
|
3.77E-31 | 131.1721854 | 9743.605348 |
| Ribosome | Cellular Component |
GO:0005840
|
7.57E-31 | 80.39032144 | 5870.579993 |
| Nucleus | Cellular Component |
GO:0005634
|
7.57E-31 | 6.425405341 | 468.3461734 |
| Focal Adhesion | Cellular Component |
GO:0005925
|
2.51E-30 | 17.01248799 | 1215.826879 |
| Cell-Substrate Junction | Cellular Component |
GO:0030055
|
4.71E-30 | 16.62227913 | 1174.48114 |
| Large Ribosomal Subunit | Cellular Component |
GO:0015934
|
3.12E-29 | 88.81371502 | 6081.628721 |
| Cytosolic Large Ribosomal Subunit | Cellular Component |
GO:0022625
|
3.12E-29 | 88.81371502 | 6081.628721 |
| Intracellular Membrane-Bounded Organelle | Cellular Component |
GO:0043231
|
3.68E-26 | 5.443676345 | 333.6316553 |
| Intracellular Non-Membrane-Bounded Organelle | Cellular Component |
GO:0043232
|
2.96E-21 | 6.883806276 | 343.4141234 |
| Nuclear Lumen | Cellular Component |
GO:0031981
|
3.68E-19 | 7.816543817 | 351.487863 |
| Nucleolus | Cellular Component |
GO:0005730
|
1.76E-18 | 7.649698016 | 331.3725507 |
| Polysomal Ribosome | Cellular Component |
GO:0042788
|
2.75E-15 | 79.62038729 | 2857.088591 |
| Cytoplasmic Stress Granule | Cellular Component |
GO:0010494
|
3.00E-14 | 28.24867293 | 944.041962 |
| Small-Subunit Processome | Cellular Component |
GO:0032040
|
4.48E-13 | 26.93752621 | 825.5221666 |
| Asymmetric Synapse | Cellular Component |
GO:0032279
|
1.48E-08 | 12.21508264 | 246.4149634 |
| Postsynaptic Density | Cellular Component |
GO:0014069
|
5.97E-08 | 10.62356115 | 198.8807116 |
| Rough Endoplasmic Reticulum Membrane | Cellular Component |
GO:0030867
|
4.70E-05 | 175.9704142 | 2110.862759 |
| Cytoplasmic Vesicle Lumen | Cellular Component |
GO:0060205
|
0.000445935 | 7.746352413 | 75.06896401 |
| Ficolin-1-Rich Granule Lumen | Cellular Component |
GO:1904813
|
0.00064841 | 7.209195402 | 66.79490026 |
| Gene Expression | Biological Process |
GO:0010467
|
2.56E-65 | 45.81840138 | 7137.624307 |
| Cytoplasmic Translation | Biological Process |
GO:0002181
|
1.34E-62 | 131.8533333 | 19623.54569 |
| Peptide Biosynthetic Process | Biological Process |
GO:0043043
|
9.85E-51 | 57.13913043 | 6919.385856 |
| Macromolecule Biosynthetic Process | Biological Process |
GO:0009059
|
1.86E-49 | 48.69132194 | 5739.202922 |
| Translation | Biological Process |
GO:0006412
|
5.52E-46 | 36.81852268 | 4037.231664 |
| Regulation Of Translation | Biological Process |
GO:0006417
|
6.10E-21 | 19.88449564 | 1030.150921 |
| mRNA Splicing, Via Spliceosome | Biological Process |
GO:0000398
|
3.07E-19 | 17.95954941 | 857.2491408 |
| mRNA Processing | Biological Process |
GO:0006397
|
3.83E-19 | 17.67177771 | 837.2729032 |
| RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile | Biological Process |
GO:0000377
|
3.56E-17 | 18.25907173 | 780.2036532 |
| mRNA Stabilization | Biological Process |
GO:0048255
|
1.47E-15 | 44.96040247 | 1749.153599 |
| Ribonucleoprotein Complex Biogenesis | Biological Process |
GO:0022613
|
2.39E-14 | 21.42184606 | 771.6208669 |
| Ribosomal Small Subunit Biogenesis | Biological Process |
GO:0042274
|
4.77E-14 | 27.35945721 | 964.1432726 |
| CRD-mediated mRNA Stabilization | Biological Process |
GO:0070934
|
9.33E-14 | 483.5609756 | 16644.31076 |
| Positive Regulation Of Translation | Biological Process |
GO:0045727
|
9.33E-14 | 22.00222965 | 757.2146266 |
| Ribosome Biogenesis | Biological Process |
GO:0042254
|
1.12E-13 | 16.79960186 | 574.0116576 |
| RNA Processing | Biological Process |
GO:0006396
|
1.35E-13 | 14.88984537 | 504.991654 |
| Negative Regulation Of Amide Metabolic Process | Biological Process |
GO:0034249
|
1.66E-13 | 24.19157276 | 813.8910743 |
| Negative Regulation Of Macromolecule Biosynthetic Process | Biological Process |
GO:0010558
|
3.54E-13 | 22.72849359 | 746.1957396 |
| Negative Regulation Of Translation | Biological Process |
GO:0017148
|
1.30E-12 | 20.49570756 | 645.2019585 |
| Negative Regulation Of Protein Metabolic Process | Biological Process |
GO:0051248
|
9.38E-12 | 15.42141319 | 454.1424664 |
Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| Ribosome | KEGG Pathway | 1.57E-49 | 54.90079576 | 6427.06512 |
| Coronavirus disease | KEGG Pathway | 3.84E-42 | 33.39255061 | 3317.892536 |
| Spliceosome | KEGG Pathway | 2.92E-14 | 17.4403778 | 606.1803937 |
| RNA transport | KEGG Pathway | 2.07E-06 | 8.471551724 | 138.8685727 |
| Protein processing in endoplasmic reticulum | KEGG Pathway | 6.05E-06 | 8.398602484 | 126.794014 |
| Amyotrophic lateral sclerosis | KEGG Pathway | 6.10E-05 | 4.931139241 | 62.14976794 |
| Parkinson disease | KEGG Pathway | 0.004891333 | 4.506441718 | 36.34773379 |
| Prion disease | KEGG Pathway | 0.008333226 | 4.091745678 | 30.27650791 |
| mRNA surveillance pathway | KEGG Pathway | 0.019161751 | 6.353422188 | 40.97298108 |
| Thyroid hormone synthesis | KEGG Pathway | 0.043542131 | 6.625419182 | 36.59079266 |
| Antigen processing and presentation | KEGG Pathway | 0.045541334 | 6.355855856 | 34.21095044 |
| Huntington disease | KEGG Pathway | 0.046204288 | 3.196922573 | 16.88334424 |
| Proteasome | KEGG Pathway | 0.059476197 | 8.167744599 | 40.25704058 |
| Spinocerebellar ataxia | KEGG Pathway | 0.059476197 | 4.271891001 | 20.65238289 |
| Pathways of neurodegeneration | KEGG Pathway | 0.059476197 | 2.57042347 | 12.35211031 |
| IL-17 signaling pathway | KEGG Pathway | 0.060227141 | 5.221693122 | 24.69020854 |
| Necroptosis | KEGG Pathway | 0.078265764 | 3.824947508 | 16.8518755 |
| HIF-1 signaling pathway | KEGG Pathway | 0.088498007 | 4.472335601 | 18.89897829 |
| Glycolysis / Gluconeogenesis | KEGG Pathway | 0.113953925 | 5.481878698 | 21.43526881 |
| Salmonella infection | KEGG Pathway | 0.113953925 | 2.913134018 | 11.26676922 |
Full list of Host ncRNAs interacting with the Virus RNA
| HncRNA | Host Species | HncRNA Detail | PMID | Source | Target Gene | Target Gene ID | Target Gene Source | PMID | Source |
|---|---|---|---|---|---|---|---|---|---|
| hsa-miR-142-5p | Homo sapiens | HncRNA Info | 32902370 | ViRBase | ZEB1 | . | miRTarBase | 23342264 | miRTarBase |
Virus RNA Sequence Information
|
>NC_012532.1 Zika virus, complete genome
AGTTGTTGATCTGTGTGAGTCAGACTGCGACAGTTCGAGTCTGAAGCGAGAGCTAACAACAGTATCAACA
GGTTTAATTTGGATTTGGAAACGAGAGTTTCTGGTCATGAAAAACCCCAAAGAAGAAATCCGGAGGATCC
GGATTGTCAATATGCTAAAACGCGGAGTAGCCCGTGTAAACCCCTTGGGAGGTTTGAAGAGGTTGCCAGC
CGGACTTCTGCTGGGTCATGGACCCATCAGAATGGTTTTGGCGATACTAGCCTTTTTGAGATTTACAGCA
ATCAAGCCATCACTGGGCCTTATCAACAGATGGGGTTCCGTGGGGAAAAAAGAGGCTATGGAAATAATAA
AGAAGTTCAAGAAAGATCTTGCTGCCATGTTGAGAATAATCAATGCTAGGAAAGAGAGGAAGAGACGTGG
CGCAGACACCAGCATCGGAATCATTGGCCTCCTGCTGACTACAGCCATGGCAGCAGAGATCACTAGACGC
GGGAGTGCATACTACATGTACTTGGATAGGAGCGATGCCGGGAAGGCCATTTCGTTTGCTACCACATTGG
GAGTGAACAAGTGCCACGTACAGATCATGGACCTCGGGCACATGTGTGACGCCACCATGAGTTATGAGTG
CCCTATGCTGGATGAGGGAGTGGAACCAGATGATGTCGATTGCTGGTGCAACACGACATCAACTTGGGTT
GTGTACGGAACCTGTCATCACAAAAAAGGTGAGGCACGGCGATCTAGAAGAGCCGTGACGCTCCCTTCTC
ACTCTACAAGGAAGTTGCAAACGCGGTCGCAGACCTGGTTAGAATCAAGAGAATACACGAAGCACTTGAT
CAAGGTTGAAAACTGGATATTCAGGAACCCCGGGTTTGCGCTAGTGGCCGTTGCCATTGCCTGGCTTTTG
GGAAGCTCGACGAGCCAAAAAGTCATATACTTGGTCATGATACTGCTGATTGCCCCGGCATACAGTATCA
GGTGCATTGGAGTCAGCAATAGAGACTTCGTGGAGGGCATGTCAGGTGGGACCTGGGTTGATGTTGTCTT
GGAACATGGAGGCTGCGTTACCGTGATGGCACAGGACAAGCCAACAGTCGACATAGAGTTGGTCACGACG
ACGGTTAGTAACATGGCCGAGGTAAGATCCTATTGCTACGAGGCATCGATATCGGACATGGCTTCGGACA
GTCGTTGCCCAACACAAGGTGAAGCCTACCTTGACAAGCAATCAGACACTCAATATGTCTGCAAAAGAAC
ATTAGTGGACAGAGGTTGGGGAAACGGTTGTGGACTTTTTGGCAAAGGGAGCTTGGTGACATGTGCCAAG
TTTACGTGTTCTAAGAAGATGACCGGGAAGAGCATTCAACCGGAAAATCTGGAGTATCGGATAATGCTAT
CAGTGCATGGCTCCCAGCATAGCGGGATGATTGGATATGAAACTGACGAAGATAGAGCGAAAGTCGAGGT
TACGCCTAATTCACCAAGAGCGGAAGCAACCTTGGGAGGCTTTGGAAGCTTAGGACTTGACTGTGAACCA
AGGACAGGCCTTGACTTTTCAGATCTGTATTACCTGACCATGAACAATAAGCATTGGTTGGTGCACAAAG
AGTGGTTTCATGACATCCCATTGCCTTGGCATGCTGGGGCAGACACCGGAACTCCACACTGGAACAACAA
AGAGGCATTGGTAGAATTCAAGGATGCCCACGCCAAGAGGCAAACCGTCGTCGTTCTGGGGAGCCAGGAA
GGAGCCGTTCACACGGCTCTCGCTGGAGCTCTAGAGGCTGAGATGGATGGTGCAAAGGGAAGGCTGTTCT
CTGGCCATTTGAAATGCCGCCTAAAAATGGACAAGCTTAGATTGAAGGGCGTGTCATATTCCTTGTGCAC
TGCGGCATTCACATTCACCAAGGTCCCAGCTGAAACACTGCATGGAACAGTCACAGTGGAGGTGCAGTAT
GCAGGGACAGATGGACCCTGCAAGATCCCAGTCCAGATGGCGGTGGACATGCAGACCCTGACCCCAGTTG
GAAGGCTGATAACCGCCAACCCCGTGATTACTGAAAGCACTGAGAACTCAAAGATGATGTTGGAGCTTGA
CCCACCATTTGGGGATTCTTACATTGTCATAGGAGTTGGGGACAAGAAAATCACCCACCACTGGCATAGG
AGTGGTAGCACCATCGGAAAGGCATTTGAGGCCACTGTGAGAGGCGCCAAGAGAATGGCAGTCCTGGGGG
ATACAGCCTGGGACTTCGGATCAGTCGGGGGTGTGTTCAACTCACTGGGTAAGGGCATTCACCAGATTTT
TGGAGCAGCCTTCAAATCACTGTTTGGAGGAATGTCCTGGTTCTCACAGATCCTCATAGGCACGCTGCTA
GTGTGGTTAGGTTTGAACACAAAGAATGGATCTATCTCCCTCACATGCTTGGCCCTGGGGGGAGTGATGA
TCTTCCTCTCCACGGCTGTTTCTGCTGACGTGGGGTGCTCAGTGGACTTCTCAAAAAAGGAAACGAGATG
TGGCACGGGGGTATTCATCTATAATGATGTTGAAGCCTGGAGGGACCGGTACAAGTACCATCCTGACTCC
CCCCGCAGATTGGCAGCAGCAGTCAAGCAGGCCTGGGAAGAGGGGATCTGTGGGATCTCATCCGTTTCAA
GAATGGAAAACATCATGTGGAAATCAGTAGAAGGGGAGCTCAATGCTATCCTAGAGGAGAATGGAGTTCA
ACTGACAGTTGTTGTGGGATCTGTAAAAAACCCCATGTGGAGAGGTCCACAAAGATTGCCAGTGCCTGTG
AATGAGCTGCCCCATGGCTGGAAAGCCTGGGGGAAATCGTATTTTGTTAGGGCGGCAAAGACCAACAACA
GTTTTGTTGTCGACGGTGACACACTGAAGGAATGTCCGCTTGAGCACAGAGCATGGAATAGTTTTCTTGT
GGAGGATCACGGGTTTGGAGTCTTCCACACCAGTGTCTGGCTTAAGGTCAGAGAAGATTACTCATTAGAA
TGTGACCCAGCCGTCATAGGAACAGCTGTTAAGGGAAGGGAGGCCGCGCACAGTGATCTGGGCTATTGGA
TTGAAAGTGAAAAGAATGACACATGGAGGCTGAAGAGGGCCCACCTGATTGAGATGAAAACATGTGAATG
GCCAAAGTCTCACACATTGTGGACAGATGGAGTAGAAGAAAGTGATCTTATCATACCCAAGTCTTTAGCT
GGTCCACTCAGCCACCACAACACCAGAGAGGGTTACAGAACCCAAGTGAAAGGGCCATGGCACAGTGAAG
AGCTTGAAATCCGGTTTGAGGAATGTCCAGGCACCAAGGTTTACGTGGAGGAGACATGCGGAACTAGAGG
ACCATCTCTGAGATCAACTACTGCAAGTGGAAGGGTCATTGAGGAATGGTGCTGTAGGGAATGCACAATG
CCCCCACTATCGTTTCGAGCAAAAGACGGCTGCTGGTATGGAATGGAGATAAGGCCCAGGAAAGAACCAG
AGAGCAACTTAGTGAGGTCAATGGTGACAGCGGGGTCAACCGATCATATGGACCACTTCTCTCTTGGAGT
GCTTGTGATTCTACTCATGGTGCAGGAGGGGTTGAAGAAGAGAATGACCACAAAGATCATCATGAGCACA
TCAATGGCAGTGCTGGTAGTCATGATCTTGGGAGGATTTTCAATGAGTGACCTGGCCAAGCTTGTGATCC
TGATGGGTGCTACTTTCGCAGAAATGAACACTGGAGGAGATGTAGCTCACTTGGCATTGGTAGCGGCATT
TAAAGTCAGACCAGCCTTGCTGGTCTCCTTCATTTTCAGAGCCAATTGGACACCCCGTGAGAGCATGCTG
CTAGCCCTGGCTTCGTGTCTTCTGCAAACTGCGATCTCTGCTCTTGAAGGTGACTTGATGGTCCTCATTA
ATGGATTTGCTTTGGCCTGGTTGGCAATTCGAGCAATGGCCGTGCCACGCACTGACAACATCGCTCTACC
AATCTTGGCTGCTCTAACACCACTAGCTCGAGGCACACTGCTCGTGGCATGGAGAGCGGGCCTGGCTACT
TGTGGAGGGATCATGCTCCTCTCCCTGAAAGGGAAAGGTAGTGTGAAGAAGAACCTGCCATTTGTCATGG
CCCTGGGATTGACAGCTGTGAGGGTAGTAGACCCTATTAATGTGGTAGGACTACTGTTACTCACAAGGAG
TGGGAAGCGGAGCTGGCCCCCTAGTGAAGTTCTCACAGCCGTTGGCCTGATATGTGCACTGGCCGGAGGG
TTTGCCAAGGCAGACATTGAGATGGCTGGACCCATGGCTGCAGTAGGCTTGCTAATTGTCAGCTATGTGG
TCTCGGGAAAGAGTGTGGACATGTACATTGAAAGAGCAGGTGACATCACATGGGAAAAGGACGCGGAAGT
CACTGGAAACAGTCCTCGGCTTGACGTGGCACTGGATGAGAGTGGTGACTTCTCCTTGGTAGAGGAAGAT
GGTCCACCCATGAGAGAGATCATACTCAAGGTGGTCCTGATGGCCATCTGTGGCATGAACCCAATAGCTA
TACCTTTTGCTGCAGGAGCGTGGTATGTGTATGTGAAGACTGGGAAAAGGAGTGGCGCCCTCTGGGACGT
GCCTGCTCCCAAAGAAGTGAAGAAAGGAGAGACCACAGATGGAGTGTACAGAGTGATGACTCGCAGACTG
CTAGGTTCAACACAGGTTGGAGTGGGAGTCATGCAAGAGGGAGTCTTCCACACCATGTGGCACGTTACAA
AAGGAGCCGCACTGAGGAGCGGTGAGGGAAGACTTGATCCATACTGGGGGGATGTCAAGCAGGACTTGGT
GTCATACTGTGGGCCTTGGAAGTTGGATGCAGCTTGGGATGGACTCAGCGAGGTACAGCTTTTGGCCGTA
CCTCCCGGAGAGAGGGCCAGAAACATTCAGACCCTGCCTGGAATATTCAAGACAAAGGACGGGGACATCG
GAGCAGTTGCTCTGGACTACCCTGCAGGGACCTCAGGATCTCCGATCCTAGACAAATGTGGAAGAGTGAT
AGGACTCTATGGCAATGGGGTTGTGATCAAGAATGGAAGCTATGTTAGTGCTATAACCCAGGGAAAGAGG
GAGGAGGAGACTCCGGTTGAATGTTTCGAACCCTCGATGCTGAAGAAGAAGCAGCTAACTGTCTTGGATC
TGCATCCAGGAGCCGGAAAAACCAGGAGAGTTCTTCCTGAAATAGTCCGTGAAGCCATAAAAAAGAGACT
CCGGACAGTGATCTTGGCACCAACTAGGGTTGTCGCTGCTGAGATGGAGGAGGCCTTGAGAGGACTTCCG
GTGCGTTACATGACAACAGCAGTCAACGTCACCCATTCTGGGACAGAAATCGTTGATTTGATGTGCCATG
CCACTTTCACTTCACGCTTACTACAACCCATCAGAGTCCCTAATTACAATCTCAACATCATGGATGAAGC
CCACTTCACAGACCCCTCAAGTATAGCTGCAAGAGGATACATATCAACAAGGGTTGAAATGGGCGAGGCG
GCTGCCATTTTTATGACTGCCACACCACCAGGAACCCGTGATGCGTTTCCTGACTCTAACTCACCAATCA
TGGACACAGAAGTGGAAGTCCCAGAGAGAGCCTGGAGCTCAGGCTTTGATTGGGTGACAGACCATTCTGG
GAAAACAGTTTGGTTCGTTCCAAGCGTGAGAAACGGAAATGAAATCGCAGCCTGTCTGACAAAGGCTGGA
AAGCGGGTCATACAGCTCAGCAGGAAGACTTTTGAGACAGAATTTCAGAAAACAAAAAATCAAGAGTGGG
ACTTTGTCATAACAACTGACATCTCAGAGATGGGCGCCAACTTCAAGGCTGACCGGGTCATAGACTCTAG
GAGATGCCTAAAACCAGTCATACTTGATGGTGAGAGAGTCATCTTGGCTGGGCCCATGCCTGTCACGCAT
GCTAGTGCTGCTCAGAGGAGAGGACGTATAGGCAGGAACCCTAACAAACCTGGAGATGAGTACATGTATG
GAGGTGGGTGTGCAGAGACTGATGAAGGCCATGCACACTGGCTTGAAGCAAGAATGCTTCTTGACAACAT
CTACCTCCAGGATGGCCTCATAGCCTCGCTCTATCGGCCTGAGGCCGATAAGGTAGCCGCCATTGAGGGA
GAGTTTAAGCTGAGGACAGAGCAAAGGAAGACCTTCGTGGAACTCATGAAGAGAGGAGACCTTCCCGTCT
GGCTAGCCTATCAGGTTGCATCTGCCGGAATAACTTACACAGACAGAAGATGGTGCTTTGATGGCACAAC
CAACAACACCATAATGGAAGACAGTGTACCAGCAGAGGTTTGGACAAAGTATGGAGAGAAGAGAGTGCTC
AAACCGAGATGGATGGATGCTAGGGTCTGTTCAGACCATGCGGCCCTGAAGTCGTTCAAAGAATTCGCCG
CTGGAAAAAGAGGAGCGGCTTTGGGAGTAATGGAGGCCCTGGGAACACTGCCAGGACACATGACAGAGAG
GTTTCAGGAAGCCATTGACAACCTCGCCGTGCTCATGCGAGCAGAGACTGGAAGCAGGCCTTATAAGGCA
GCGGCAGCCCAACTGCCGGAGACCCTAGAGACCATTATGCTCTTAGGTTTGCTGGGAACAGTTTCACTGG
GGATCTTCTTCGTCTTGATGCGGAATAAGGGCATCGGGAAGATGGGCTTTGGAATGGTAACCCTTGGGGC
CAGTGCATGGCTCATGTGGCTTTCGGAAATTGAACCAGCCAGAATTGCATGTGTCCTCATTGTTGTGTTT
TTATTACTGGTGGTGCTCATACCCGAGCCAGAGAAGCAAAGATCTCCCCAAGATAACCAGATGGCAATTA
TCATCATGGTGGCAGTGGGCCTTCTAGGTTTGATAACTGCAAACGAACTTGGATGGCTGGAAAGAACAAA
AAATGACATAGCTCATCTAATGGGAAGGAGAGAAGAAGGAGCAACCATGGGATTCTCAATGGACATTGAT
CTGCGGCCAGCCTCCGCCTGGGCTATCTATGCCGCATTGACAACTCTCATCACCCCAGCTGTCCAACATG
CGGTAACCACTTCATACAACAACTACTCCTTAATGGCGATGGCCACACAAGCTGGAGTGCTGTTTGGCAT
GGGCAAAGGGATGCCATTTATGCATGGGGACCTTGGAGTCCCGCTGCTAATGATGGGTTGCTATTCACAA
TTAACACCCCTGACTCTGATAGTAGCTATCATTCTGCTTGTGGCGCACTACATGTACTTGATCCCAGGCC
TACAAGCGGCAGCAGCGCGTGCTGCCCAGAAAAGGACAGCAGCTGGCATCATGAAGAATCCCGTTGTGGA
TGGAATAGTGGTAACTGACATTGACACAATGACAATAGACCCCCAGGTGGAGAAGAAGATGGGACAAGTG
TTACTCATAGCAGTAGCCATCTCCAGTGCTGTGCTGCTGCGGACCGCCTGGGGATGGGGGGAGGCTGGAG
CTCTGATCACAGCAGCGACCTCCACCTTGTGGGAAGGCTCTCCAAACAAATACTGGAACTCCTCTACAGC
CACCTCACTGTGCAACATCTTCAGAGGAAGCTATCTGGCAGGAGCTTCCCTTATCTATACAGTGACGAGA
AACGCTGGCCTGGTTAAGAGACGTGGAGGTGGGACGGGAGAGACTCTGGGAGAGAAGTGGAAAGCTCGTC
TGAATCAGATGTCGGCCCTGGAGTTCTACTCTTATAAAAAGTCAGGTATCACTGAAGTGTGTAGAGAGGA
GGCTCGCCGTGCCCTCAAGGATGGAGTGGCCACAGGAGGACATGCCGTATCCCGGGGAAGTGCAAAGATC
AGATGGTTGGAGGAGAGAGGATATCTGCAGCCCTATGGGAAGGTTGTTGACCTCGGATGTGGCAGAGGGG
GCTGGAGCTATTATGCCGCCACCATCCGCAAAGTGCAGGAGGTGAGAGGATACACAAAGGGAGGTCCCGG
TCATGAAGAACCCATGCTGGTGCAAAGCTATGGGTGGAACATAGTTCGTCTCAAGAGTGGAGTGGACGTC
TTCCACATGGCGGCTGAGCCGTGTGACACTCTGCTGTGTGACATAGGTGAGTCATCATCTAGTCCTGAAG
TGGAAGAGACACGAACACTCAGAGTGCTCTCTATGGTGGGGGACTGGCTTGAAAAAAGACCAGGGGCCTT
CTGTATAAAGGTGCTGTGCCCATACACCAGCACTATGATGGAAACCATGGAGCGACTGCAACGTAGGCAT
GGGGGAGGATTAGTCAGAGTGCCATTGTGTCGCAACTCCACACATGAGATGTACTGGGTCTCTGGGGCAA
AGAGCAACATCATAAAAAGTGTGTCCACCACAAGTCAGCTCCTCCTGGGACGCATGGATGGCCCCAGGAG
GCCAGTGAAATATGAGGAGGATGTGAACCTCGGCTCGGGTACACGAGCTGTGGCAAGCTGTGCTGAGGCT
CCTAACATGAAAATCATCGGCAGGCGCATTGAGAGAATCCGCAATGAACATGCAGAAACATGGTTTCTTG
ATGAAAACCACCCATACAGGACATGGGCCTACCATGGGAGCTACGAAGCCCCCACGCAAGGATCAGCGTC
TTCCCTCGTGAACGGGGTTGTTAGACTCCTGTCAAAGCCTTGGGACGTGGTGACTGGAGTTACAGGAATA
GCCATGACTGACACCACACCATACGGCCAACAAAGAGTCTTCAAAGAAAAAGTGGACACCAGGGTGCCAG
ATCCCCAAGAAGGCACTCGCCAGGTAATGAACATAGTCTCTTCCTGGCTGTGGAAGGAGCTGGGGAAACG
CAAGCGGCCACGCGTCTGCACCAAAGAAGAGTTTATCAACAAGGTGCGCAGCAATGCAGCACTGGGAGCA
ATATTTGAAGAGGAAAAAGAATGGAAGACGGCTGTGGAAGCTGTGAATGATCCAAGGTTTTGGGCCCTAG
TGGATAGGGAGAGAGAACACCACCTGAGAGGAGAGTGTCACAGCTGTGTGTACAACATGATGGGAAAAAG
AGAAAAGAAGCAAGGAGAGTTCGGGAAAGCAAAAGGTAGCCGCGCCATCTGGTACATGTGGTTGGGAGCC
AGATTCTTGGAGTTTGAAGCCCTTGGATTCTTGAACGAGGACCATTGGATGGGAAGAGAAAACTCAGGAG
GTGGAGTCGAAGGGTTAGGATTGCAAAGACTTGGATACATTCTAGAAGAAATGAATCGGGCACCAGGAGG
AAAGATGTACGCAGATGACACTGCTGGCTGGGACACCCGCATTAGTAAGTTTGATCTGGAGAATGAAGCT
CTGATTACCAACCAAATGGAGGAAGGGCACAGAACTCTGGCGTTGGCCGTGATTAAATACACATACCAAA
ACAAAGTGGTGAAGGTTCTCAGACCAGCTGAAGGAGGAAAAACAGTTATGGACATCATTTCAAGACAAGA
CCAGAGAGGGAGTGGACAAGTTGTCACTTATGCTCTCAACACATTCACCAACTTGGTGGTGCAGCTTATC
CGGAACATGGAAGCTGAGGAAGTGTTAGAGATGCAAGACTTATGGTTGTTGAGGAAGCCAGAGAAAGTGA
CCAGATGGTTGCAGAGCAATGGATGGGATAGACTCAAACGAATGGCGGTCAGTGGAGATGACTGCGTTGT
GAAGCCAATCGATGATAGGTTTGCACATGCCCTCAGGTTCTTGAATGACATGGGAAAAGTTAGGAAAGAC
ACACAGGAGTGGAAACCCTCGACTGGATGGAGCAATTGGGAAGAAGTCCCGTTCTGCTCCCACCACTTCA
ACAAGCTGTACCTCAAGGATGGGAGATCCATTGTGGTCCCTTGCCGCCACCAAGATGAACTGATTGGCCG
AGCTCGCGTCTCACCAGGGGCAGGATGGAGCATCCGGGAGACTGCCTGTCTTGCAAAATCATATGCGCAG
ATGTGGCAGCTCCTTTATTTCCACAGAAGAGACCTTCGACTGATGGCTAATGCCATTTGCTCGGCTGTGC
CAGTTGACTGGGTACCAACTGGGAGAACCACCTGGTCAATCCATGGAAAGGGAGAATGGATGACCACTGA
GGACATGCTCATGGTGTGGAATAGAGTGTGGATTGAGGAGAACGACCATATGGAGGACAAGACTCCTGTA
ACAAAATGGACAGACATTCCCTATCTAGGAAAAAGGGAGGACTTATGGTGTGGATCCCTTATAGGGCACA
GACCCCGCACCACTTGGGCTGAAAACATCAAAGACACAGTCAACATGGTGCGCAGGATCATAGGTGATGA
AGAAAAGTACATGGACTATCTATCCACCCAAGTCCGCTACTTGGGTGAGGAAGGGTCCACACCCGGAGTG
TTGTAAGCACCAATTTTAGTGTTGTCAGGCCTGCTAGTCAGCCACAGTTTGGGGAAAGCTGTGCAGCCTG
TAACCCCCCCAGGAGAAGCTGGGAAACCAAGCTCATAGTCAGGCCGAGAACGCCATGGCACGGAAGAAGC
CATGCTGCCTGTGAGCCCCTCAGAGGACACTGAGTCAAAAAACCCCACGCGCTTGGAAGCGCAGGATGGG
AAAAGAAGGTGGCGACCTTCCCCACCCTTCAATCTGGGGCCTGAACTGGAGACTAGCTGTGAATCTCCAG
CAGAGGGACTAGTGGTTAGAGGAGACCCCCCGGAAAACGCAAAACAGCATATTGACGTGGGAAAGACCAG
AGACTCCATGAGTTTCCACCACGCTGGCCGCCAGGCACAGATCGCCGAACTTCGGCGGCCGGTGTGGGGA
AATCCATGGTTTCT
Click to Show/Hide
|