Details of Virus RNA

  Strain Information Strain Name
Influenza A virus (strain California/7/2004 (H3N2))
Strain Family
Orthomyxoviridae
RNA Binding Site
5'UTR - 3'UTR
  Virus Information Virus Name
Influenza A virus (IAV)
Taxonomy ID 11320

Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain

Protein Name Uniprot ID Host Species Pro Info Detection Method Infection Cell Cell ID Cell Originated Tissue Infection Time Interaction Score Fold Change
100 kDa coactivator Q7KZF4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.93811629627651e-05 FC > 5
100 kDa coactivator Q7KZF4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.93811629627651e-05 .
130 kDa leucine-rich protein P42704 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.47907662819642e-06 FC > 5
130 kDa leucine-rich protein P42704 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.47907662819642e-06 .
14-3-3 protein zeta/delta P63104 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
182 kDa tankyrase-1-binding protein Q9C0C2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.45170906409877E-06 FC > 5
182 kDa tankyrase-1-binding protein Q9C0C2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.45170906409877e-06 .
26S proteasome non-ATPase regulatory subunit 1 Q99460 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
26S proteasome non-ATPase regulatory subunit 2 Q13200 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
3'-5' RNA helicase YTHDC2 Q9H6S0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
39S ribosomal protein L43 Q8N983 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00011687672844119 .
40S ribosomal protein S24 P62847 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0116356953980411 .
40S ribosomal protein S6 P62753 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0320902000006297 .
40S ribosomal protein S8 P62241 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0209065756962134 .
4F2 cell-surface antigen heavy chain P08195 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.64123890342127e-05 FC > 5
4F2 cell-surface antigen heavy chain P08195 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.64123890342127e-05 .
5'-3' exoribonuclease 2 Q9H0D6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.7369072391961e-05 .
60 kDa heat shock protein P10809 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.40263549160902e-05 .
60S ribosomal protein L15 P61313 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.882589466623e-06 FC > 5
60S ribosomal protein L15 P61313 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.882589466623e-06 .
60S ribosomal protein L18 Q07020 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.518236639702403 .
60S ribosomal protein L18a Q02543 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.291576688030317 .
60S ribosomal protein L22 P35268 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00135669720197405 .
60S ribosomal protein L27a P46776 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000107687259835675 .
60S ribosomal protein L3 P39023 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00138373439063738 .
60S ribosomal protein L4 P36578 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00331475527888648 .
60S ribosomal protein L5 P46777 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.8644769448909e-05 .
60S ribosomal protein L6 Q02878 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00299049033743692 .
60S ribosomal protein L7 P18124 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0300157943681904 .
78 kDa gastrin-binding protein P40939 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.98029987866637e-06 FC > 5
78 kDa gastrin-binding protein P40939 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.98029987866637e-06 .
A-kinase anchor protein 1 Q92667 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000226441773960147 .
A-kinase anchor protein 12 Q02952 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
A-kinase anchor protein 13 Q12802 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.58462852056575e-06 FC > 5
A-kinase anchor protein 13 Q12802 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.58462852056575e-06 .
Acetyl-CoA carboxylase 1 Q13085 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.39046999903513e-06 FC > 5
Acetyl-CoA carboxylase 1 Q13085 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.39046999903513e-06 .
Actin-related protein 2/3 complex subunit 1B O15143 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.76928366768302e-05 .
Activity-dependent neuroprotective protein Q9H2P0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.06542456522103e-06 FC > 5
Activity-dependent neuroprotective protein Q9H2P0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.06542456522103e-06 .
Acute-phase response factor P40763 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.48951413742594e-05 FC > 5
Acute-phase response factor P40763 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.48951413742594e-05 .
Acyl-CoA 6-desaturase O95864 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.70543876878776e-05 .
Acylamino-acid-releasing enzyme P13798 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000220148252486277 .
ADAM 9 Q13443 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000552162330160861 .
Adenomatous polyposis coli protein P25054 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.67138989219118e-06 FC > 5
Adenomatous polyposis coli protein P25054 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.67138989219118e-06 .
Adenylyl cyclase-associated protein 1 Q01518 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000338592317040434 .
ADP-ribosylation factor GTPase-activating protein 3 Q9NP61 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.47866698046487e-05 .
ADP/ATP translocase 3 P12236 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.40304617466999e-06 FC > 5
ADP/ATP translocase 3 P12236 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.40304617466999e-06 .
AF4/FMR2 family member 4 Q9UHB7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.72262190528788e-05 FC > 5
AF4/FMR2 family member 4 Q9UHB7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.72262190528788e-05 .
Afadin P55196 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.00953297393718e-06 FC > 5
Afadin P55196 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.00953297393718e-06 .
Agrin O00468 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.58456939006188e-05 FC > 5
Agrin O00468 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.58456939006188e-05 .
AHA1 O95433 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00116900383790467 .
Alanine--tRNA ligase P49588 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.09114872785808e-05 .
Aldehyde dehydrogenase P30838 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000513601445113023 .
Aldehyde dehydrogenase 1A1 P00352 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000561153537758919 .
Aldehyde dehydrogenase family 3 member A2 P51648 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000620458795281044 .
Aldo-keto reductase family 1 member B1 P15121 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00673233406700243 .
Aldo-keto reductase family 1 member B10 O60218 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000101040915818726 .
Aldo-keto reductase family 1 member C2 P52895 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.3004252001895e-05 FC > 5
Aldo-keto reductase family 1 member C2 P52895 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.3004252001895e-05 .
Alpha-actinin-4 O43707 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.01975884793718e-06 FC > 5
Alpha-actinin-4 O43707 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.01975884793718e-06 .
Alpha-enolase P06733 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000370046814496375 .
Alpha-ETF P13804 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Anaphase-promoting complex subunit 1 Q9H1A4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Anillin Q9NQW6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.59849335001284e-06 FC > 5
Anillin Q9NQW6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.59849335001284e-06 .
Anion exchange protein 2 P04920 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Ankyrin repeat domain-containing protein 17 O75179 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Annexin A1 P04083 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.47530086400802e-05 FC > 5
Annexin A1 P04083 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.47530086400802e-05 .
Annexin A2 P07355 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00014341278167336 .
Antigen NY-CO-16 Q9BVJ6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
AP-1 complex subunit gamma-1 O43747 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
AP-2 complex subunit beta P63010 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.32543513613775e-05 FC > 5
AP-2 complex subunit beta P63010 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.32543513613775e-05 .
AP-2 complex subunit mu Q96CW1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000785543908512933 .
AP-3 complex subunit beta-1 O00203 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0135636302111475 .
AP2-associated protein kinase 1 Q2M2I8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.59558918370666e-06 FC > 5
AP2-associated protein kinase 1 Q2M2I8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.59558918370666e-06 .
ARC205 Q15648 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.53854564963006e-06 FC > 5
ARC205 Q15648 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.53854564963006e-06 .
Arginase-1 P05089 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.153179792549668 .
Arginyl-tRNA--protein transferase 1 O95260 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.95685971878032e-05 .
Asparagine--tRNA ligase O43776 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.14759448644182e-05 FC > 5
Asparagine--tRNA ligase O43776 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.14759448644182e-05 .
Aspartate--tRNA ligase P14868 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.35181638530868e-05 .
Aspartyl/asparaginyl beta-hydroxylase Q12797 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
AT-rich interactive domain-containing protein 2 Q68CP9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.74129001006381e-06 FC > 5
AT-rich interactive domain-containing protein 2 Q68CP9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.74129001006381e-06 .
Ataxin-2 Q99700 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.22299878742222e-05 .
Ataxin-2-like protein Q8WWM7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.21433838373537e-05 .
ATP-binding cassette sub-family B member 6 Q9NP58 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.000154225208270343 FC > 5
ATP-binding cassette sub-family B member 6 Q9NP58 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000154225208270343 .
ATP-binding cassette sub-family F member 1 Q8NE71 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.00089503886253e-05 FC > 5
ATP-binding cassette sub-family F member 1 Q8NE71 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.00089503886253e-05 .
ATP-citrate synthase P53396 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.17015651415149e-05 .
ATP-dependent 6-phosphofructokinase Q01813 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.37996504901779e-06 FC > 5
ATP-dependent 6-phosphofructokinase Q01813 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.37996504901779e-06 .
ATP-dependent DNA helicase Q1 P46063 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.19233337305201e-05 FC > 5
ATP-dependent DNA helicase Q1 P46063 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.19233337305201e-05 .
ATP-dependent DNA/RNA helicase DHX36 Q9H2U1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.85151905985316e-06 FC > 5
ATP-dependent DNA/RNA helicase DHX36 Q9H2U1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.85151905985316e-06 .
ATP-dependent RNA helicase A Q08211 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.55265749878949e-05 FC > 5
ATP-dependent RNA helicase A Q08211 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.55265749878949e-05 .
ATP-dependent RNA helicase DDX1 Q92499 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000295623674999081 .
ATP-dependent RNA helicase DDX3X O00571 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.13675159756588e-06 FC > 5
ATP-dependent RNA helicase DDX3X O00571 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.13675159756588e-06 .
ATP-dependent RNA helicase DDX42 Q86XP3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.08708871625292e-06 FC > 5
ATP-dependent RNA helicase DDX42 Q86XP3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.08708871625292e-06 .
ATP-dependent RNA helicase DDX54 Q8TDD1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0290467724319392 .
ATP-dependent RNA helicase DHX15 O43143 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.48055052843239e-06 FC > 5
ATP-dependent RNA helicase DHX15 O43143 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.48055052843239e-06 .
ATP-dependent RNA helicase DHX29 Q7Z478 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.24574770950848e-06 FC > 5
ATP-dependent RNA helicase DHX29 Q7Z478 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.24574770950848e-06 .
ATP-dependent RNA helicase DHX30 Q7L2E3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.16968669193278e-05 FC > 5
ATP-dependent RNA helicase DHX30 Q7L2E3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.16968669193278e-05 .
ATP-dependent RNA helicase DHX38 Q92620 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.31449319527699e-06 FC > 5
ATP-dependent RNA helicase DHX38 Q92620 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.31449319527699e-06 .
B-cell CLL/lymphoma 9-like protein Q86UU0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.31242977157174e-05 .
B120 O14497 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.00703253847109e-05 .
Band 4.1-like protein 1 Q9H4G0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.000104169540686426 FC > 5
Band 4.1-like protein 1 Q9H4G0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000104169540686426 .
Band 4.1-like protein 2 O43491 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.47507260809381e-05 FC > 5
Band 4.1-like protein 2 O43491 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.47507260809381e-05 .
Bcl-2-associated transcription factor 1 Q9NYF8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00123291455842982 .
Beige-like protein P50851 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000561175117471097 .
Beta ig-h3 Q15582 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.30417877003499e-05 FC > 5
Beta ig-h3 Q15582 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.30417877003499e-05 .
Beta-crystallin B1 P53674 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000916889046182734 .
Bifunctional glutamate/proline--tRNA ligase P07814 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.54427135223456e-06 FC > 5
Bifunctional glutamate/proline--tRNA ligase P07814 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.54427135223456e-06 .
Bifunctional purine biosynthesis protein ATIC P31939 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000846471369960141 .
Biorientation of chromosomes in cell division protein 1-like 1 Q8NFC6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.61975197323122e-05 FC > 5
Biorientation of chromosomes in cell division protein 1-like 1 Q8NFC6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.61975197323122e-05 .
Bleomycin hydrolase Q13867 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00551141160438623 .
Bromodomain-containing protein 4 O60885 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.26598304299103e-06 FC > 5
Bromodomain-containing protein 4 O60885 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.26598304299103e-06 .
BRR2 homolog O75643 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.91355134688585e-06 FC > 5
BRR2 homolog O75643 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.91355134688585e-06 .
Butyrate-induced protein 1 Q9P035 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.03699939933742e-05 FC > 5
Butyrate-induced protein 1 Q9P035 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.03699939933742e-05 .
C-1-tetrahydrofolate synthase P11586 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.54922779514056e-06 FC > 5
C-1-tetrahydrofolate synthase P11586 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.54922779514056e-06 .
CAD protein P27708 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.14011005786e-06 FC > 5
CAD protein P27708 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.14011005786e-06 .
Calmodulin-like protein 5 Q9NZT1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.10325354298253 .
Calmodulin-regulated spectrin-associated protein 1 Q5T5Y3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.96408193967121e-06 FC > 5
Calmodulin-regulated spectrin-associated protein 1 Q5T5Y3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.96408193967121e-06 .
Calmodulin-regulated spectrin-associated protein 2 Q08AD1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.41960000787304e-05 .
Calpain-1 catalytic subunit P07384 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.22803267076629e-05 FC > 5
Calpain-1 catalytic subunit P07384 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.22803267076629e-05 .
Calpain-2 catalytic subunit P17655 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Calpastatin P20810 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000101918454358924 .
Caprin-1 Q14444 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Caspase-14 P31944 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.336444412258428 .
Catalase P04040 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0168037233586307 .
Catenin delta-1 O60716 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.46630959330288e-06 FC > 5
Catenin delta-1 O60716 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.46630959330288e-06 .
Cathepsin D P07339 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.662051630505742 .
Cation-independent mannose-6-phosphate receptor P11717 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00200869474618316 .
CCR4-NOT transcription complex subunit 1 A5YKK6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.68369270862804e-05 FC > 5
CCR4-NOT transcription complex subunit 1 A5YKK6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.68369270862804e-05 .
Cell cycle control protein TS11 P08243 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0252596362224838 .
Cell division control protein 42 homolog P60953 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000923885592436679 .
Cell division cycle protein 91-like 1 Q9H490 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.35125356787907e-05 FC > 5
Cell division cycle protein 91-like 1 Q9H490 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.35125356787907e-05 .
Cell division cycle-associated protein 2 Q69YH5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000127345541732784 .
Centrosomal protein of 170 kDa Q5SW79 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.28076900348682e-06 FC > 5
Centrosomal protein of 170 kDa Q5SW79 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.28076900348682e-06 .
Centrosomal protein of 170 kDa protein B Q9Y4F5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Centrosomal protein of 55 kDa Q53EZ4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.01930450680209e-05 .
Centrosome-associated protein 350 Q5VT06 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.65297653856439e-05 FC > 5
Centrosome-associated protein 350 Q5VT06 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.65297653856439e-05 .
Centrosome-associated protein ALMS1 Q8TCU4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.00011491907769017 FC > 5
Centrosome-associated protein ALMS1 Q8TCU4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00011491907769017 .
CHORD domain-containing protein 1 Q9UHD1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.30637925282966e-05 .
CHRAC subunit ACF1 Q9NRL2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Chromodomain-helicase-DNA-binding protein 1 O14646 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.78375571197069e-06 FC > 5
Chromodomain-helicase-DNA-binding protein 1 O14646 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.78375571197069e-06 .
Chromosome-associated kinesin KIF4A O95239 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.46031539018083e-05 FC > 5
Chromosome-associated kinesin KIF4A O95239 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.46031539018083e-05 .
Citron Rho-interacting kinase O14578 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.86183863067471e-06 FC > 5
Citron Rho-interacting kinase O14578 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.86183863067471e-06 .
Clathrin heavy chain 1 Q00610 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.48417171712619e-05 .
Cleavage and polyadenylation specificity factor subunit 1 Q10570 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.59232381891652e-05 FC > 5
Cleavage and polyadenylation specificity factor subunit 1 Q10570 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.59232381891652e-05 .
Clustered mitochondria protein homolog O75153 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.99832415983871e-05 .
Coatomer subunit alpha P53621 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.68953804282514e-05 FC > 5
Coatomer subunit alpha P53621 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.68953804282514e-05 .
Coatomer subunit beta P53618 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.78835353265453e-05 FC > 5
Coatomer subunit beta P53618 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.78835353265453e-05 .
Coatomer subunit beta' P35606 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.7141520935566e-05 .
Coatomer subunit delta P48444 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000107988920075308 .
Coatomer subunit gamma-1 Q9Y678 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.93121793621438e-05 .
Cofilin-1 P23528 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.8480708584084e-05 FC > 5
Cofilin-1 P23528 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.8480708584084e-05 .
Cold shock domain-containing protein E1 O75534 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.22851420593569e-05 .
Collagen alpha-1(VII) chain Q02388 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.4941206398962e-05 FC > 5
Collagen alpha-1(VII) chain Q02388 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.4941206398962e-05 .
Collagen alpha-1(XVIII) chain P39060 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.85250847122013e-06 FC > 5
Collagen alpha-1(XVIII) chain P39060 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.85250847122013e-06 .
Collagen alpha-2(IV) chain P08572 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.19074262336783e-05 FC > 5
Collagen alpha-2(IV) chain P08572 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.19074262336783e-05 .
Contactin-1 Q12860 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Copine-1 Q99829 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00240877995585097 .
Copine-3 O75131 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00064779574834661 .
Corneodesmosin Q15517 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00863999834320216 .
Coronin-1C Q9ULV4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000125075421584543 .
CREB-binding protein Q92793 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Cullin-2 Q13617 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.35109786230951e-06 FC > 5
Cullin-2 Q13617 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.35109786230951e-06 .
Cullin-3 Q13618 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00263860546811828 .
Cyclin-G-associated kinase O14976 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Cyclin-T1 O60563 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.52890015277503e-05 FC > 5
Cyclin-T1 O60563 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.52890015277503e-05 .
Cystatin-A P01040 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0847903546718671 .
Cystine/glutamate transporter Q9UPY5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000295595343772993 .
Cytoplasmic aconitate hydratase P21399 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.54013991684844e-05 FC > 5
Cytoplasmic aconitate hydratase P21399 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.54013991684844e-05 .
Cytoplasmic dynein 1 heavy chain 1 Q14204 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.01515499437477e-06 FC > 5
Cytoplasmic dynein 1 heavy chain 1 Q14204 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.01515499437477e-06 .
Cytoplasmic dynein 1 intermediate chain 2 Q13409 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.49601641152159e-05 .
Cytoskeleton-associated protein 5 Q14008 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.24929365195614e-05 FC > 5
Cytoskeleton-associated protein 5 Q14008 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.24929365195614e-05 .
Cytosolic acyl coenzyme A thioester hydrolase O00154 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.79591301578339e-05 .
D-fructose-6-phosphate amidotransferase 1 Q06210 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.69639372943674e-05 FC > 5
D-fructose-6-phosphate amidotransferase 1 Q06210 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.69639372943674e-05 .
DDOST 48 kDa subunit P39656 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.479077610142881 .
Death inducer with SAP domain Q8IX12 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.43816980492768e-05 FC > 5
Death inducer with SAP domain Q8IX12 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.43816980492768e-05 .
Death-inducer obliterator 1 Q9BTC0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.92763136395998e-05 .
Dedicator of cytokinesis protein 10 Q96BY6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.26352974140068e-05 FC > 5
Dedicator of cytokinesis protein 10 Q96BY6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.26352974140068e-05 .
Dedicator of cytokinesis protein 5 Q9H7D0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.88299787935628e-06 FC > 5
Dedicator of cytokinesis protein 5 Q9H7D0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.88299787935628e-06 .
Dedicator of cytokinesis protein 7 Q96N67 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Delta(14)-sterol reductase LBR Q14739 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.28467673847027e-05 .
Delta-1-pyrroline-5-carboxylate synthase P54886 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
DENN domain-containing protein 4C Q5VZ89 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.84146116202676e-05 FC > 5
DENN domain-containing protein 4C Q5VZ89 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.84146116202676e-05 .
Derlin-1 Q9BUN8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.26241492836289e-06 FC > 5
Derlin-1 Q9BUN8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.26241492836289e-06 .
Dermcidin P81605 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0266724404549103 .
Desmocollin-1 Q08554 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.109394519950086 .
Desmocollin-3 Q14574 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0560210532810859 .
Desmoglein-1 Q02413 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0568695530451181 .
Desmoplakin P15924 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0251052827681873 .
Desmoyokin Q09666 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.71139662518727e-07 FC > 5
Desmoyokin Q09666 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.71139662518727e-07 .
Deubiquitinating enzyme FAF-X Q93008 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.51717915792878e-05 FC > 5
Deubiquitinating enzyme FAF-X Q93008 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.51717915792878e-05 .
Dihydrolipoyl dehydrogenase P09622 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00856828349387962 .
Dihydropyrimidinase-related protein 2 Q16555 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000773730459560912 .
Diphosphoinositol pentakisphosphate kinase 2 O43314 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
DNA (cytosine-5)-methyltransferase 1 P26358 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.91676478863405e-05 FC > 5
DNA (cytosine-5)-methyltransferase 1 P26358 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.91676478863405e-05 .
DNA damage-binding protein 1 Q16531 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000260078677852715 .
DNA mismatch repair protein Msh2 P43246 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0124701324885037 .
DNA mismatch repair protein Msh3 P20585 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.88684888252318e-07 FC > 5
DNA mismatch repair protein Msh3 P20585 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.88684888252318e-07 .
DNA mismatch repair protein Msh6 P52701 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.15142701973344e-05 FC > 5
DNA mismatch repair protein Msh6 P52701 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.15142701973344e-05 .
DNA repair protein RAD50 Q92878 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00289164961185393 .
DNA replication licensing factor MCM3 P25205 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00016442637880212 .
DNA replication licensing factor MCM4 P33991 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000935038268598985 .
DNA replication licensing factor MCM5 P33992 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.93647261137272e-05 .
DNA replication licensing factor MCM6 Q14566 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.03591406681046e-05 .
DNA replication licensing factor MCM7 P33993 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000432900620934648 .
DNA topoisomerase 2-alpha P11388 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.9040745168638e-06 FC > 5
DNA topoisomerase 2-alpha P11388 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.9040745168638e-06 .
DNA topoisomerase 2-beta Q02880 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.56788348733952e-06 FC > 5
DNA topoisomerase 2-beta Q02880 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.56788348733952e-06 .
DNA topoisomerase 3-alpha Q13472 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.44315551779968e-05 FC > 5
DNA topoisomerase 3-alpha Q13472 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.44315551779968e-05 .
DNA topoisomerase 3-beta-1 O95985 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.15905958222751e-05 FC > 5
DNA topoisomerase 3-beta-1 O95985 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.15905958222751e-05 .
DNA-dependent protein kinase catalytic subunit P78527 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.17464386260637e-06 FC > 5
DNA-dependent protein kinase catalytic subunit P78527 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.17464386260637e-06 .
DNA-directed RNA polymerase II subunit RPB2 P30876 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.0540905387446e-05 .
DnaJ homolog subfamily A member 1 P31689 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.00815280904692e-05 FC > 5
DnaJ homolog subfamily A member 1 P31689 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.00815280904692e-05 .
DnaJ homolog subfamily A member 2 O60884 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000941757037447176 .
DnaJ homolog subfamily C member 13 O75165 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.15975496170493e-05 FC > 5
DnaJ homolog subfamily C member 13 O75165 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.15975496170493e-05 .
Dolichyldiphosphatase 1 Q86YN1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Double-stranded RNA-binding protein Staufen homolog 1 O95793 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.45748160075046e-06 FC > 5
Double-stranded RNA-binding protein Staufen homolog 1 O95793 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.45748160075046e-06 .
Dynactin subunit 1 Q14203 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000108657806995505 .
Dynamin-1 Q05193 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.01859728183738e-05 FC > 5
Dynamin-1 Q05193 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.01859728183738e-05 .
Dynein axonemal heavy chain 5 Q8TE73 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0251632894797197 .
Dystrophin P11532 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.48971280933115e-05 FC > 5
Dystrophin P11532 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.48971280933115e-05 .
E1A-binding protein p400 Q96L91 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000212191709802768 .
E1B-55 kDa-associated protein 5 Q9BUJ2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.70437682185625e-05 .
E3 SUMO-protein ligase RanBP2 P49792 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.65752749106168e-06 FC > 5
E3 SUMO-protein ligase RanBP2 P49792 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.65752749106168e-06 .
E3 ubiquitin-protein ligase HECTD1 Q9ULT8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.91744377537674e-06 FC > 5
E3 ubiquitin-protein ligase HECTD1 Q9ULT8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.91744377537674e-06 .
E3 ubiquitin-protein ligase HUWE1 Q7Z6Z7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.56461891953769e-06 FC > 5
E3 ubiquitin-protein ligase HUWE1 Q7Z6Z7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.56461891953769e-06 .
E3 ubiquitin-protein ligase Midline-1 O15344 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000115641055771738 .
E3 ubiquitin-protein ligase NEDD4 P46934 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.49073363799055e-06 FC > 5
E3 ubiquitin-protein ligase NEDD4 P46934 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.49073363799055e-06 .
E3 ubiquitin-protein ligase RNF213 Q63HN8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
E3 ubiquitin-protein ligase TRIP12 Q14669 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.51673334642764e-05 .
E3 ubiquitin-protein ligase UBR4 Q5T4S7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.44928731125857e-05 FC > 5
E3 ubiquitin-protein ligase UBR4 Q5T4S7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.44928731125857e-05 .
E3 ubiquitin-protein ligase UBR5 O95071 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.07615458163263e-05 FC > 5
E3 ubiquitin-protein ligase UBR5 O95071 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.07615458163263e-05 .
E3 ubiquitin-protein ligase ZNF598 Q86UK7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.33150495922814e-06 FC > 5
E3 ubiquitin-protein ligase ZNF598 Q86UK7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.33150495922814e-06 .
E3 ubiquitin/ISG15 ligase TRIM25 Q14258 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.5591113124564e-05 .
Early endosome antigen 1 Q15075 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0253374643314934 .
Egl nine homolog 1 Q9GZT9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000281474279145031 .
EH domain-binding protein 1 Q8NDI1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.27113711114471e-06 FC > 5
EH domain-binding protein 1 Q8NDI1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.27113711114471e-06 .
EH domain-binding protein 1-like protein 1 Q8N3D4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.87770348616655e-06 FC > 5
EH domain-binding protein 1-like protein 1 Q8N3D4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.87770348616655e-06 .
eIF-2-alpha kinase activator GCN1 Q92616 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.57368372311329e-05 FC > 5
eIF-2-alpha kinase activator GCN1 Q92616 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.57368372311329e-05 .
eIF-4-gamma 3 O43432 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.000202236409716836 FC > 5
eIF-4-gamma 3 O43432 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000202236409716836 .
eIF3a Q14152 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.000123348411447595 FC > 5
eIF3a Q14152 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000123348411447595 .
ELM2 and SANT domain-containing protein 1 Q6PJG2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000264855393718162 .
Elongation factor 1-alpha 2 Q05639 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0372496117424957 .
Elongation factor 1-gamma P26641 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.00730642312423e-05 FC > 5
Elongation factor 1-gamma P26641 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.00730642312423e-05 .
Elongation factor 2 P13639 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.64033011524218e-05 .
Elongation factor G Q96RP9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Elongation factor Tu P49411 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.1243906857622e-05 FC > 5
Elongation factor Tu P49411 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.1243906857622e-05 .
Elongator complex protein 1 O95163 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.58711897957088e-05 .
EMAP-4 Q9HC35 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.19431774776101e-05 .
Endoplasmic reticulum chaperone BiP P11021 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0216881209476344 .
Endoplasmin P14625 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0018539703589341 .
Enhancer of mRNA-decapping protein 4 Q6P2E9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Envoplakin Q92817 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00875773721917697 .
EPS8-like protein 2 Q9H6S3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000224170217802979 .
Eukaryotic initiation factor 4A-I P60842 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.00153670319980673 FC > 5
Eukaryotic initiation factor 4A-I P60842 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00153670319980673 .
Eukaryotic translation initiation factor 2A Q9BY44 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000119267263977326 .
Eukaryotic translation initiation factor 5B O60841 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00102301810868898 .
Exocyst complex component 1 Q9NV70 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.124659392416422 .
Exocyst complex component 4 Q96A65 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000191692449500576 .
Exosome complex exonuclease RRP44 Q9Y2L1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.09564671628493e-06 FC > 5
Exosome complex exonuclease RRP44 Q9Y2L1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.09564671628493e-06 .
Exosome RNA helicase MTR4 P42285 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000508788488357424 .
Exportin-2 P55060 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00796758119655106 .
Extended synaptotagmin-1 Q9BSJ8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.28615073524525e-05 .
Extended synaptotagmin-2 A0FGR8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.01449880367752e-05 FC > 5
Extended synaptotagmin-2 A0FGR8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.01449880367752e-05 .
Extracellular matrix protein 1 Q16610 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.81522967811052e-05 .
Ezrin P15311 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000320604469118994 .
FACT complex subunit SPT16 Q9Y5B9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.40167288545775e-06 FC > 5
FACT complex subunit SPT16 Q9Y5B9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.40167288545775e-06 .
FACT complex subunit SSRP1 Q08945 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.003077131107468 .
Factor for adipocyte differentiation 104 Q53EP0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.28962361511659e-05 .
Fascin Q16658 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000572431586973969 .
Fatty acid synthase P49327 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.32151441735083e-06 FC > 5
Fatty acid synthase P49327 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.32151441735083e-06 .
Fatty acid-binding protein 5 Q01469 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0179028921084205 .
Felix-ina Q7Z2K6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.20083860299001e-05 .
Fermitin family homolog 2 Q96AC1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.4354878586134e-06 FC > 5
Fermitin family homolog 2 Q96AC1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.4354878586134e-06 .
Fibronectin P02751 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000152511999308019 .
Filamin-A P21333 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.98172606816946e-05 .
Filamin-B O75369 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.95799245649001e-05 FC > 5
Filamin-B O75369 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.95799245649001e-05 .
FK506-binding protein 15 Q5T1M5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00023210358699301 .
Flotillin-1 O75955 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00362658696949445 .
Focal adhesion kinase 1 Q05397 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.32060483430296e-05 FC > 5
Focal adhesion kinase 1 Q05397 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.32060483430296e-05 .
Forkhead box protein K2 Q01167 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.41796493116028e-05 FC > 5
Forkhead box protein K2 Q01167 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.41796493116028e-05 .
Fructose-bisphosphate aldolase A P04075 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000238223448003699 .
Galectin-7 P47929 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Gamma-glutamylcyclotransferase O75223 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0904676683697119 .
Gasdermin-A Q96QA5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Gem-associated protein 5 Q8TEQ6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.95823370465103e-06 FC > 5
Gem-associated protein 5 Q8TEQ6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.95823370465103e-06 .
Genetic suppressor element 1 Q14687 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.46027769964585e-06 FC > 5
Genetic suppressor element 1 Q14687 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.46027769964585e-06 .
Girdin Q3V6T2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000130237114327233 .
Glucose-6-phosphate 1-dehydrogenase P11413 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.73827777733609e-05 .
GLUT-1 P11166 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.96965213435667e-05 .
Glutamate--cysteine ligase catalytic subunit P48506 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00211143269300019 .
Glutamine and serine-rich protein 1 Q2KHR3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Glutamine--tRNA ligase P47897 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.12355672099595e-05 FC > 5
Glutamine--tRNA ligase P47897 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.12355672099595e-05 .
Glutathione reductase P00390 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Glyceraldehyde-3-phosphate dehydrogenase P04406 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.80690978561988e-05 .
Glycinamide ribonucleotide synthetase P22102 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.47503455485569e-06 FC > 5
Glycinamide ribonucleotide synthetase P22102 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.47503455485569e-06 .
Glycogenin-1 P46976 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000414850901037429 .
Golgin subfamily A member 4 Q13439 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00229884591237159 .
Golgin subfamily B member 1 Q14789 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000117621448732066 .
GRB10-interacting GYF protein 2 Q6Y7W6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00361951268687454 .
Growth hormone-inducible transmembrane protein Q9H3K2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.83183063838191e-05 FC > 5
Growth hormone-inducible transmembrane protein Q9H3K2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.83183063838191e-05 .
GTP-binding nuclear protein Ran P62826 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000126135417354686 .
GTPase-activating protein ZNF289 Q8N6H7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000390050250036441 .
HBS1-like protein Q9Y450 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
HEAT repeat-containing protein 1 Q9H583 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.65226963401873e-05 FC > 5
HEAT repeat-containing protein 1 Q9H583 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.65226963401873e-05 .
HEAT repeat-containing protein 5A Q86XA9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000243329335578959 .
Heat shock 70 kDa protein 4 P34932 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.54781479836215e-05 FC > 5
Heat shock 70 kDa protein 4 P34932 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.54781479836215e-05 .
Heat shock cognate 71 kDa protein P11142 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000201508953242015 .
Heat shock protein 105 kDa Q92598 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.76150325825738e-05 .
Heat shock protein HSP 90-alpha P07900 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.00390790910585e-05 FC > 5
Heat shock protein HSP 90-alpha P07900 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.00390790910585e-05 .
Heat shock protein HSP 90-beta P08238 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.46694524604146e-05 .
Hemicentin-1 Q96RW7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.80701207544467e-06 FC > 5
Hemicentin-1 Q96RW7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.80701207544467e-06 .
Heterogeneous nuclear ribonucleoprotein A0 Q13151 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0212123940892391 .
Heterogeneous nuclear ribonucleoprotein A1 P09651 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00444130345269999 .
Heterogeneous nuclear ribonucleoprotein A3 P51991 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0148970795375428 .
Heterogeneous nuclear ribonucleoprotein K P61978 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.81960804204782e-06 FC > 5
Heterogeneous nuclear ribonucleoprotein K P61978 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.81960804204782e-06 .
Heterogeneous nuclear ribonucleoprotein L P14866 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000115660852254867 .
Heterogeneous nuclear ribonucleoprotein U Q00839 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.03868184119794e-05 FC > 5
Heterogeneous nuclear ribonucleoprotein U Q00839 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.03868184119794e-05 .
Heterogeneous nuclear ribonucleoproteins A2/B1 P22626 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0025788136211647 .
Histone-lysine N-methyltransferase SETD2 Q9BYW2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
HIV-1 Rev-binding protein P52594 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000686745903095873 .
HIV-1 Vpr-binding ankyrin repeat protein Q8IWZ3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.09080401402957e-06 FC > 5
HIV-1 Vpr-binding ankyrin repeat protein Q8IWZ3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.09080401402957e-06 FC > 5
HIV-1 Vpr-binding ankyrin repeat protein Q8IWZ3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.09080401402957e-06 .
Host cell factor 1 P51610 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.42020296526507e-06 FC > 5
Host cell factor 1 P51610 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.42020296526507e-06 .
HPK/GCK-like kinase HGK O95819 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
IGF2 mRNA-binding protein 1 Q9NZI8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.67352834094127e-05 .
Importin subunit beta-1 Q14974 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.6970691904829e-06 FC > 5
Importin subunit beta-1 Q14974 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.6970691904829e-06 .
Inactive tyrosine-protein kinase PEAK1 Q9H792 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Inactive tyrosine-protein kinase PRAG1 Q86YV5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.38429176992244e-05 .
Inositol 1,4,5-trisphosphate receptor type 3 Q14573 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.10250444401086e-05 FC > 5
Inositol 1,4,5-trisphosphate receptor type 3 Q14573 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.10250444401086e-05 .
Inositol polyphosphate phosphatase-like protein 1 O15357 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.3135209201597e-06 FC > 5
Inositol polyphosphate phosphatase-like protein 1 O15357 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.3135209201597e-06 .
Integrator complex subunit 1 Q8N201 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.93684895736131e-05 .
Integrator complex subunit 12 Q96CB8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.18781841540329e-05 FC > 5
Integrator complex subunit 12 Q96CB8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.18781841540329e-05 .
Integrin beta-4 P16144 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000168901925081838 .
Interferon-inducible protein 4 P55265 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.85263328463943e-06 FC > 5
Interferon-inducible protein 4 P55265 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.85263328463943e-06 .
Interleukin enhancer-binding factor 3 Q12906 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.70791296881671e-06 FC > 5
Interleukin enhancer-binding factor 3 Q12906 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.70791296881671e-06 .
Intermembrane lipid transfer protein VPS13C Q709C8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Inverted formin-2 Q27J81 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.33497760433836e-05 FC > 5
Inverted formin-2 Q27J81 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.33497760433836e-05 .
IRF-2-binding protein 2 Q7Z5L9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Isoleucine--tRNA ligase P41252 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.3169791707768e-05 FC > 5
Isoleucine--tRNA ligase P41252 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.3169791707768e-05 .
Isoleucine--tRNA ligase Q9NSE4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000124951210398727 .
JNK-interacting protein 4 O60271 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.59069814273029e-05 .
Jumonji domain-containing protein 1C Q15652 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00282189233232679 .
Junction plakoglobin P14923 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.362165988679707 .
Keratin P05783 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.0084720257138e-05 FC > 5
Keratin P05783 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.0084720257138e-05 .
Keratin P04264 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.226466010699046 .
Keratin P35527 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00049906702888677 .
Keratinocyte proline-rich protein Q5T749 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0587363858537018 .
Kinectin Q86UP2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.38207994628931e-06 FC > 5
Kinectin Q86UP2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.38207994628931e-06 .
Kinesin-1 heavy chain P33176 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.36186625186021e-05 .
Kinesin-like protein KIF13A Q9H1H9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.95805752182346e-05 FC > 5
Kinesin-like protein KIF13A Q9H1H9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.95805752182346e-05 .
Kinesin-like protein KIF13B Q9NQT8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Kinesin-like protein KIF14 Q15058 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Kinesin-like protein KIF1C O43896 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.17504965182182e-06 FC > 5
Kinesin-like protein KIF1C O43896 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.17504965182182e-06 .
Kinesin-like protein KIF23 Q02241 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.93674780144536e-06 FC > 5
Kinesin-like protein KIF23 Q02241 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.93674780144536e-06 .
Kynureninase Q16719 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.30340360590956e-06 FC > 5
Kynureninase Q16719 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.30340360590956e-06 .
L-lactate dehydrogenase A chain P00338 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000315759740773665 .
L-lactate dehydrogenase B chain P07195 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.69636878623385e-05 .
La-related protein 1 Q6PKG0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.02831041812186e-06 FC > 5
La-related protein 1 Q6PKG0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.02831041812186e-06 .
Lamin-B1 P20700 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000208147628577501 .
Laminin subunit alpha-5 O15230 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.23796924659314e-05 FC > 5
Laminin subunit alpha-5 O15230 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.23796924659314e-05 .
Laminin subunit beta-1 P07942 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000159011192520808 .
Laminin subunit gamma-1 P11047 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000201750385284459 .
Leucine zipper protein 1 Q86V48 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.05160517450052e-05 FC > 5
Leucine zipper protein 1 Q86V48 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.05160517450052e-05 .
Leucine--tRNA ligase Q9P2J5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.36444461494994e-06 FC > 5
Leucine--tRNA ligase Q9P2J5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.36444461494994e-06 .
Leukotriene A-4 hydrolase P09960 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000273716874525065 .
LIM and calponin homology domains-containing protein 1 Q9UPQ0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.03642678980182e-05 .
LIM domain and actin-binding protein 1 Q9UHB6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.45485021721471e-05 .
LIM domain only protein 7 Q8WWI1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.3408816292471e-06 FC > 5
LIM domain only protein 7 Q8WWI1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.3408816292471e-06 .
Lipoma-preferred partner Q93052 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000188491731352037 .
Lissencephaly-1 protein P43034 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000204355569427485 .
Long-chain fatty acid transport protein 2 O14975 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
LRR FLII-interacting protein 1 Q32MZ4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Lysine-specific demethylase 3B Q7LBC6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.77778437105221e-06 FC > 5
Lysine-specific demethylase 3B Q7LBC6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.77778437105221e-06 .
Lysocardiolipin acyltransferase 1 Q6UWP7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000713106891060255 .
Lysophospholipid acyltransferase 5 Q6P1A2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.24750187048107e-05 FC > 5
Lysophospholipid acyltransferase 5 Q6P1A2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.24750187048107e-05 .
Lysophospholipid acyltransferase 7 Q96N66 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.95732665886141e-05 FC > 5
Lysophospholipid acyltransferase 7 Q96N66 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.95732665886141e-05 .
Lysozyme C P61626 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00496981255104385 .
Major vault protein Q14764 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.80005292820006e-06 FC > 5
Major vault protein Q14764 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.80005292820006e-06 .
Matrin-3 P43243 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.61285376136523e-05 FC > 5
Matrin-3 P43243 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.61285376136523e-05 .
MAX gene-associated protein Q8IWI9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Mediator of DNA damage checkpoint protein 1 Q14676 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.66443960037155e-06 FC > 5
Mediator of DNA damage checkpoint protein 1 Q14676 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.66443960037155e-06 .
Methionine--tRNA ligase P56192 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.149791533253e-06 FC > 5
Methionine--tRNA ligase P56192 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.149791533253e-06 .
MHC class I region proline-rich protein CAT53 Q96QC0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.99688223225797e-06 FC > 5
MHC class I region proline-rich protein CAT53 Q96QC0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.99688223225797e-06 .
Microtubule cross-linking factor 1 Q9Y4B5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.71736073984096e-06 FC > 5
Microtubule cross-linking factor 1 Q9Y4B5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.71736073984096e-06 .
Microtubule-actin cross-linking factor 1 Q9UPN3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.29207453875687e-05 .
Microtubule-associated protein 1B P46821 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.88285602092475e-06 FC > 5
Microtubule-associated protein 1B P46821 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.88285602092475e-06 .
Microtubule-associated protein 4 P27816 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.03261512566591e-05 FC > 5
Microtubule-associated protein 4 P27816 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.03261512566591e-05 .
Microtubule-associated tumor suppressor 1 Q9ULD2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.80269602294244e-06 FC > 5
Microtubule-associated tumor suppressor 1 Q9ULD2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.80269602294244e-06 .
Minor histocompatibility antigen H13 Q8TCT9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.25479970818659e-06 FC > 5
Minor histocompatibility antigen H13 Q8TCT9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.25479970818659e-06 .
Misshapen-like kinase 1 Q8N4C8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.35570514540473e-06 FC > 5
Misshapen-like kinase 1 Q8N4C8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.35570514540473e-06 .
Mitotic checkpoint protein BUB3 O43684 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000637835123595666 .
Mitotic interactor and substrate of PLK1 Q8IVT2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000195151562085565 .
Moesin P26038 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.92192927982994e-05 .
Monocarboxylate transporter 4 O15427 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.000537887201301505 FC > 5
Monocarboxylate transporter 4 O15427 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000537887201301505 .
Msx2-interacting protein Q96T58 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Mucin-5AC P98088 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00180824605232289 .
Mucin-5B Q9HC84 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000281245220745828 .
Multidrug resistance-associated protein 1 P33527 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00024282171709542 .
Myb-binding protein 1A Q9BQG0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00287413834551099 .
Myeloid-associated differentiation marker Q96S97 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.45788705040237e-05 FC > 5
Myeloid-associated differentiation marker Q96S97 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.45788705040237e-05 .
Myoferlin Q9NZM1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.56072948820638e-06 FC > 5
Myoferlin Q9NZM1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.56072948820638e-06 .
Myosin light chain kinase Q15746 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.06826541010799e-06 FC > 5
Myosin light chain kinase Q15746 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.06826541010799e-06 .
Myosin phosphatase Rho-interacting protein Q6WCQ1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.02042418934826e-06 FC > 5
Myosin phosphatase Rho-interacting protein Q6WCQ1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.02042418934826e-06 .
Myosin-10 P35580 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.94596952484266e-05 FC > 5
Myosin-10 P35580 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.94596952484266e-05 .
Myosin-14 Q7Z406 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.87625744440218e-05 FC > 5
Myosin-14 Q7Z406 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.87625744440218e-05 .
Myosin-9 P35579 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.80455881880339e-05 FC > 5
Myosin-9 P35579 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.80455881880339e-05 .
NACHT Q9NX02 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.35503387208846e-05 FC > 5
NACHT Q9NX02 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.35503387208846e-05 .
NAD(P)H dehydrogenase [quinone] 1 P15559 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.97807845018227e-05 .
NADH-ubiquinone oxidoreductase chain 5 P03915 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.66090918812859e-05 .
Nesprin-1 Q8NF91 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.885191825479791 .
Nesprin-2 Q8WXH0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.407628102904989 .
Neuron navigator 1 Q8NEY1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.00060846302257082 FC > 5
Neuron navigator 1 Q8NEY1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00060846302257082 .
Neuron navigator 3 Q8IVL0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.055551614621321 .
Neutral alpha-glucosidase AB Q14697 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.98319073216068e-06 FC > 5
Neutral alpha-glucosidase AB Q14697 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.98319073216068e-06 .
NF-kappa-B-repressing factor O15226 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000144484417818322 .
Nibrin O60934 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.96384069915657e-05 FC > 5
Nibrin O60934 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.96384069915657e-05 .
NonO protein Q15233 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00553418125566636 .
Notchless protein homolog 1 Q9NVX2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Nuclear mitotic apparatus protein 1 Q14980 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.00520015402828e-06 FC > 5
Nuclear mitotic apparatus protein 1 Q14980 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.00520015402828e-06 .
Nuclear pore complex protein Nup153 P49790 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.34014840554225e-06 FC > 5
Nuclear pore complex protein Nup153 P49790 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.34014840554225e-06 .
Nuclear pore complex protein Nup155 O75694 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.28740639292963e-05 FC > 5
Nuclear pore complex protein Nup155 O75694 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.28740639292963e-05 .
Nuclear pore complex protein Nup160 Q12769 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Nuclear pore complex protein Nup205 Q92621 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.88111343485153e-06 FC > 5
Nuclear pore complex protein Nup205 Q92621 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.88111343485153e-06 .
Nuclear pore complex protein Nup214 P35658 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.23289200204807e-06 FC > 5
Nuclear pore complex protein Nup214 P35658 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.23289200204807e-06 .
Nuclear pore complex protein Nup98-Nup96 P52948 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000200381859813433 .
Nuclear pore membrane glycoprotein 210 Q8TEM1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Nuclear protein localization protein 4 homolog Q8TAT6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000534280551264604 .
Nuclear receptor coactivator 3 Q9Y6Q9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000860969919176551 .
Nuclear receptor coactivator 4 Q13772 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.52147136360875e-05 .
Nuclear receptor coactivator 6 Q14686 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.39808235566709e-05 FC > 5
Nuclear receptor coactivator 6 Q14686 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.39808235566709e-05 .
Nuclear receptor corepressor 1 O75376 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.04091496243589e-06 FC > 5
Nuclear receptor corepressor 1 O75376 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.04091496243589e-06 .
Nuclear receptor corepressor 2 Q9Y618 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.41990394442095e-06 FC > 5
Nuclear receptor corepressor 2 Q9Y618 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.41990394442095e-06 .
Nuclear receptor-interacting protein 1 P48552 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Nucleolar and coiled-body phosphoprotein 1 Q14978 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.48533096858001e-05 FC > 5
Nucleolar and coiled-body phosphoprotein 1 Q14978 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.48533096858001e-05 .
Nucleolar protein 1 P46087 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000636818848898319 .
Nucleolar protein 10 Q9BSC4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.58296929486462e-07 FC > 5
Nucleolar protein 10 Q9BSC4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.58296929486462e-07 .
Nucleolar protein 8 Q76FK4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.64353402840921e-06 FC > 5
Nucleolar protein 8 Q76FK4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.64353402840921e-06 .
Nucleolar RNA helicase 2 Q9NR30 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0255647449103504 .
Nucleolin P19338 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.024339603607e-05 FC > 5
Nucleolin P19338 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.024339603607e-05 .
Nucleophosmin P06748 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000469195752839045 .
Nucleoporin NUP188 Q5SRE5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.23263397136537e-06 FC > 5
Nucleoporin NUP188 Q5SRE5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.23263397136537e-06 .
Nucleoprotein TPR P12270 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00219511545692756 .
Nucleosome assembly protein 1-like 1 P55209 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Obscurin Q5VST9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
OGDH-E1 Q02218 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.99432188872649e-05 .
Oligosaccharyl transferase subunit STT3A P46977 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.11275935456535e-05 .
Oligosaccharyl transferase subunit STT3B Q8TCJ2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.58256426941458e-05 FC > 5
Oligosaccharyl transferase subunit STT3B Q8TCJ2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.58256426941458e-05 .
Osa homolog 2 Q8NFD5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.96406970965167e-05 FC > 5
Osa homolog 2 Q8NFD5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.96406970965167e-05 .
PAICS P22234 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.32038793402723e-06 FC > 5
PAICS P22234 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.32038793402723e-06 .
Paired amphipathic helix protein Sin3a Q96ST3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.99698099976096e-06 FC > 5
Paired amphipathic helix protein Sin3a Q96ST3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.99698099976096e-06 .
Palladin Q8WX93 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.17419283037498e-05 .
Palmitoyltransferase ZDHHC5 Q9C0B5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.53388186524424e-06 FC > 5
Palmitoyltransferase ZDHHC5 Q9C0B5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.53388186524424e-06 .
PAPS transporter 1 Q8TB61 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.95773933279097e-05 FC > 5
PAPS transporter 1 Q8TB61 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.95773933279097e-05 .
Partitioning defective 3 homolog Q8TEW0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.96507384644064e-06 FC > 5
Partitioning defective 3 homolog Q8TEW0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.96507384644064e-06 .
PDZ and LIM domain protein 5 Q96HC4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000269760173822218 .
Pericentriolar material 1 protein Q15154 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.3035067364388e-05 .
Periodic tryptophan protein 2 homolog Q15269 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.55342166517585e-05 .
Perlecan (PLC) P98160 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.93186346339853e-05 .
Peroxiredoxin-1 Q06830 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000206712498834743 .
Peroxiredoxin-2 P32119 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.919956009565605 .
Peroxiredoxin-4 Q13162 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00230936340178495 .
PHD finger protein 3 Q92576 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.44123793485434e-06 .
Phosphate carrier protein Q00325 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.90930004128667e-06 FC > 5
Phosphate carrier protein Q00325 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.90930004128667e-06 .
Phosphatidate cytidylyltransferase 2 O95674 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.57111375913306e-05 FC > 5
Phosphatidate cytidylyltransferase 2 O95674 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.57111375913306e-05 .
Phosphofurin acidic cluster sorting protein 1 Q6VY07 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.24258691467033e-06 FC > 5
Phosphofurin acidic cluster sorting protein 1 Q6VY07 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.24258691467033e-06 .
Phosphoinositide 3-kinase regulatory subunit 4 Q99570 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.693056511330217 .
Phospholipase A-2-activating protein Q9Y263 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.88280684327753e-05 FC > 5
Phospholipase A-2-activating protein Q9Y263 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.88280684327753e-05 .
Phosphoribosylformylglycinamidine synthase O15067 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.81491045484177e-06 FC > 5
Phosphoribosylformylglycinamidine synthase O15067 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.81491045484177e-06 .
Plakophilin-1 Q13835 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.655925110222895 .
Plectin Q15149 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.42526014695899e-06 FC > 5
Plectin Q15149 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.42526014695899e-06 .
Pleiotropic regulator 1 O43660 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.8937872531677e-06 FC > 5
Pleiotropic regulator 1 O43660 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.8937872531677e-06 .
Poly [ADP-ribose] polymerase 1 P09874 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.40975274472265e-06 FC > 5
Poly [ADP-ribose] polymerase 1 P09874 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.40975274472265e-06 .
Poly(rC)-binding protein 1 Q15365 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.24984690542626e-06 FC > 5
Poly(rC)-binding protein 1 Q15365 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.24984690542626e-06 .
Polycomb protein SUZ12 Q15022 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Polypeptide N-acetylgalactosaminyltransferase 2 Q10471 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.66014977486612e-05 FC > 5
Polypeptide N-acetylgalactosaminyltransferase 2 Q10471 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.66014977486612e-05 .
Polypyrimidine tract-binding protein 1 P26599 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00360335843092704 .
PP2A subunit B isoform B55-alpha P63151 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0233676365994727 .
PRA1 family protein 3 O75915 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.07838033195309e-05 FC > 5
PRA1 family protein 3 O75915 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.07838033195309e-05 .
pre-mRNA 3' end processing protein WDR33 Q9C0J8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.9849443305728e-05 FC > 5
pre-mRNA 3' end processing protein WDR33 Q9C0J8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.9849443305728e-05 .
Pre-mRNA-processing factor 19 Q9UMS4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00686897709505701 .
Pre-mRNA-processing-splicing factor 8 Q6P2Q9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.04916841608372e-06 FC > 5
Pre-mRNA-processing-splicing factor 8 Q6P2Q9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.04916841608372e-06 .
Pre-rRNA-processing protein TSR1 homolog Q2NL82 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00384239810255007 .
Prelamin-A/C P02545 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00361234532927009 .
Probable ATP-dependent RNA helicase DDX23 Q9BUQ8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0103952253809382 .
Probable ATP-dependent RNA helicase DDX27 Q96GQ7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0334072629005579 .
Probable ATP-dependent RNA helicase DDX46 Q7L014 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.977370450791535 .
Probable ATP-dependent RNA helicase DDX5 P17844 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Profilin-1 P07737 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000161468582413758 .
Programmed cell death 6-interacting protein Q8WUM4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.90004443155638e-05 FC > 5
Programmed cell death 6-interacting protein Q8WUM4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.90004443155638e-05 .
Prolactin-inducible protein P12273 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.372726732677471 .
Proliferation marker protein Ki-67 P46013 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.8239026149166e-06 FC > 5
Proliferation marker protein Ki-67 P46013 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.8239026149166e-06 .
Prolyl endopeptidase P48147 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00543649588283975 .
Proteasome adapter and scaffold protein ECM29 Q5VYK3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000105804763612482 .
Protein AHNAK2 Q8IVF2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.05401220121236e-07 FC > 5
Protein AHNAK2 Q8IVF2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.05401220121236e-07 .
Protein arginine N-methyltransferase 5 O14744 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Protein bicaudal C homolog 1 Q9H694 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.54999410147236e-05 .
Protein capicua homolog Q96RK0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Protein diaphanous homolog 1 O60610 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Protein disulfide-isomerase A4 P13667 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0817183452421638 .
Protein ERGIC-53 P49257 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00127673509408587 .
Protein FAM83H Q6ZRV2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.55094584807613e-06 FC > 5
Protein FAM83H Q6ZRV2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.55094584807613e-06 .
Protein ftsJ homolog 3 Q8IY81 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.33135281029212 .
Protein furry homolog-like O94915 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Protein Haymaker O96008 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000396326176606686 .
Protein LL5-beta Q86SQ0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.61998615414161e-06 FC > 5
Protein LL5-beta Q86SQ0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.61998615414161e-06 .
Protein mono-ADP-ribosyltransferase PARP4 Q9UKK3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.45078749927223e-05 FC > 5
Protein mono-ADP-ribosyltransferase PARP4 Q9UKK3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.45078749927223e-05 .
Protein NEDD1 Q8NHV4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.37832304950314e-05 .
Protein POF1B Q8WVV4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Protein PRRC2A P48634 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.2718143437862e-06 FC > 5
Protein PRRC2A P48634 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.2718143437862e-06 .
Protein PRRC2B Q5JSZ5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.40073879348179e-05 FC > 5
Protein PRRC2B Q5JSZ5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.40073879348179e-05 .
Protein PRRC2C Q9Y520 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.45184657360491e-06 FC > 5
Protein PRRC2C Q9Y520 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.45184657360491e-06 .
Protein RCC2 Q9P258 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.02230092697836e-05 FC > 5
Protein RCC2 Q9P258 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.02230092697836e-05 .
Protein RER1 O15258 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000435735824811842 .
Protein RRP5 homolog Q14690 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.16432255262711e-05 FC > 5
Protein RRP5 homolog Q14690 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.16432255262711e-05 .
Protein S100-A7 P31151 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.659804812869171 .
Protein S100-A8 P05109 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00741891599300327 .
Protein S100-A9 P06702 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0250903821776686 .
Protein scribble homolog Q14160 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.15576805159769e-05 FC > 5
Protein scribble homolog Q14160 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.15576805159769e-05 .
Protein strawberry notch homolog 1 A3KN83 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.1191030567653e-06 FC > 5
Protein strawberry notch homolog 1 A3KN83 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.1191030567653e-06 .
Protein TRAM1 Q15629 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.02283916987811e-06 FC > 5
Protein TRAM1 Q15629 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.02283916987811e-06 .
Protein transport protein Sec16A O15027 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.16199699470884e-06 FC > 5
Protein transport protein Sec16A O15027 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.16199699470884e-06 .
Protein transport protein Sec23A Q15436 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000187594198612076 .
Protein transport protein Sec24A O95486 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.06993095471854e-05 .
Protein transport protein Sec24C P53992 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.75761872711418e-05 .
Protein transport protein Sec31A O94979 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.86949449812155e-05 .
Protein tyrosine phosphatase TD14 Q9H3S7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000161937060374319 .
Protein-glutamine gamma-glutamyltransferase 2 P21980 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.83280721618594e-05 .
Protein-glutamine gamma-glutamyltransferase E Q08188 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.138015324752042 .
Protein-tyrosine phosphatase 1D Q06124 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00155478142010071 .
Proto-oncogene tyrosine-protein kinase Src P12931 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.04342125868393e-05 .
PTP-PEST Q05209 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.54336896879485e-05 .
Putative ATP-dependent RNA helicase DHX57 Q6P158 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.38925706613757e-05 FC > 5
Putative ATP-dependent RNA helicase DHX57 Q6P158 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.38925706613757e-05 .
Putative keratin-87 protein A6NCN2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Pyruvate carboxylase P11498 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000649915773587202 .
Pyruvate kinase PKM P14618 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.31445769519153e-05 .
Rab GDP dissociation inhibitor beta P50395 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00451271966659843 .
Rab11 family-interacting protein 1 Q6WKZ4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000381559173651763 .
Rab11 family-interacting protein 5 Q9BXF6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.13124962946095e-06 FC > 5
Rab11 family-interacting protein 5 Q9BXF6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.13124962946095e-06 .
Rac GTPase-activating protein 1 Q9H0H5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.89641967842697e-05 .
Radixin P35241 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.101221602656301 .
RAPH1 Q70E73 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.75049816072684e-05 .
Ras GTPase-activating-like protein IQGAP1 P46940 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.12643932567109e-06 FC > 5
Ras GTPase-activating-like protein IQGAP1 P46940 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.12643932567109e-06 .
Ras GTPase-activating-like protein IQGAP3 Q86VI3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.2793292551926e-05 FC > 5
Ras GTPase-activating-like protein IQGAP3 Q86VI3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.2793292551926e-05 .
Ras-related protein Rab-10 P61026 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.95576546932905e-06 FC > 5
Ras-related protein Rab-10 P61026 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.95576546932905e-06 .
Ras-related protein Rab-21 Q9UL25 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000332586874070238 .
Receptor of activated protein C kinase 1 P63244 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.02852306360078e-05 .
Regulation of nuclear pre-mRNA domain-containing protein 2 Q5VT52 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.83558144284756e-06 FC > 5
Regulation of nuclear pre-mRNA domain-containing protein 2 Q5VT52 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.83558144284756e-06 .
Regulator of chromosome condensation P18754 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.93346218505481 .
Regulator of nonsense transcripts 1 Q92900 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.10163492365167e-05 FC > 5
Regulator of nonsense transcripts 1 Q92900 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.10163492365167e-05 .
Replication factor C subunit 1 P35251 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.80331841046805e-05 FC > 5
Replication factor C subunit 1 P35251 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.80331841046805e-05 .
Reticulon-4 Q9NQC3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.0987168229803e-05 .
Rho GTPase-activating protein 21 Q5T5U3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.7673399895748e-05 FC > 5
Rho GTPase-activating protein 21 Q5T5U3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.7673399895748e-05 .
Rho GTPase-activating protein 35 Q9NRY4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00519600776325936 .
Rho guanine nucleotide exchange factor 11 O15085 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.06401198870297e-06 FC > 5
Rho guanine nucleotide exchange factor 11 O15085 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.06401198870297e-06 .
Rho-associated protein kinase 1 Q13464 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000568973321115108 .
Rho-associated protein kinase 2 O75116 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.48130406105301e-05 FC > 5
Rho-associated protein kinase 2 O75116 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.48130406105301e-05 .
RIBIIR P04844 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.85314917060955e-05 FC > 5
RIBIIR P04844 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.85314917060955e-05 .
Ribonucleases P/MRP protein subunit POP1 Q99575 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0014249743434992 .
Ribophorin I P04843 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000589379123299888 .
Ribosomal L1 domain-containing protein 1 O76021 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.308192161344148 .
Ribosome biogenesis protein BMS1 homolog Q14692 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000710761259907892 .
Ribosome quality control complex subunit NEMF O60524 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.09649868341257e-05 FC > 5
Ribosome quality control complex subunit NEMF O60524 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.09649868341257e-05 .
Ribosome-binding protein 1 Q9P2E9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.36289924774297e-06 FC > 5
Ribosome-binding protein 1 Q9P2E9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.36289924774297e-06 .
RNA cytidine acetyltransferase Q9H0A0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000229896771210328 .
RNA-binding protein 12 Q9NTZ6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00220381976760282 .
RNA-binding protein 12B Q8IXT5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.13525850435896e-06 FC > 5
RNA-binding protein 12B Q8IXT5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.13525850435896e-06 .
RNA-binding protein 14 Q96PK6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0132062603190348 .
RNA-binding protein 15 Q96T37 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.90490086147902e-06 FC > 5
RNA-binding protein 15 Q96T37 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.90490086147902e-06 .
RNA-binding protein 26 Q5T8P6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.45631527090462e-06 FC > 5
RNA-binding protein 26 Q5T8P6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.45631527090462e-06 .
RNA-binding protein 27 Q9P2N5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
RNA-binding protein 33 Q96EV2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.4966251294542e-06 FC > 5
RNA-binding protein 33 Q96EV2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.4966251294542e-06 .
RNA-binding protein 6 P78332 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
RP-A p70 P27694 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00221416157660303 .
RRP12-like protein Q5JTH9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0960394735055902 .
S-adenosylmethionine synthase isoform type-2 P31153 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.83459812273648e-05 .
Scaffold attachment factor B2 Q14151 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.0521759749653e-05 FC > 5
Scaffold attachment factor B2 Q14151 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.0521759749653e-05 .
Scaffold-attachment factor A2 Q1KMD3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.04061710676304e-05 FC > 5
Scaffold-attachment factor A2 Q1KMD3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.04061710676304e-05 .
SEC23-interacting protein Q9Y6Y8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.0439236779815e-05 .
Septin-2 Q15019 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.34358507913933e-05 FC > 5
Septin-2 Q15019 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.34358507913933e-05 .
Septin-9 Q9UHD8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.8389242698247e-06 FC > 5
Septin-9 Q9UHD8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.8389242698247e-06 .
Sequestosome-1 Q13501 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.76979406610436e-05 .
SERCA2 P16615 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.07236161340171e-05 .
Serine/arginine repetitive matrix protein 2 Q9UQ35 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000744938516712049 .
Serine/arginine-rich splicing factor 6 Q13247 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.29773614465603e-05 .
Serine/threonine-protein kinase WNK1 Q9H4A3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.21457524847903e-06 FC > 5
Serine/threonine-protein kinase WNK1 Q9H4A3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.21457524847903e-06 .
Serpin B12 Q96P63 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.138143315961363 .
SH3 and PX domain-containing protein 2B A1X283 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.82891712419921e-06 FC > 5
SH3 and PX domain-containing protein 2B A1X283 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.82891712419921e-06 .
Shank2 Q9UPX8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.5915734512958e-06 FC > 5
Shank2 Q9UPX8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.5915734512958e-06 .
Sickle tail protein homolog Q5T5P2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.02044539759286e-05 FC > 5
Sickle tail protein homolog Q5T5P2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.02044539759286e-05 .
Signal recognition particle subunit SRP72 O76094 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.20643782052865e-05 .
SIPA1-like protein 1 O43166 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
SIPA1-like protein 3 O60292 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.19882354481869e-06 FC > 5
SIPA1-like protein 3 O60292 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.19882354481869e-06 .
SMC hinge domain-containing protein 1 A6NHR9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.28000903024961e-06 FC > 5
SMC hinge domain-containing protein 1 A6NHR9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.28000903024961e-06 .
SMC protein 1A Q14683 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0146962286601744 .
SNU114 homolog Q15029 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.54063130036187e-05 FC > 5
SNU114 homolog Q15029 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.54063130036187e-05 .
Solute carrier family 38 member 10 Q9HBR0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.72880860274449e-05 FC > 5
Solute carrier family 38 member 10 Q9HBR0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.72880860274449e-05 .
Spectrin alpha chain Q13813 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.38986349251425e-05 .
Spectrin beta chain Q01082 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.17174864996048e-05 FC > 5
Spectrin beta chain Q01082 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.17174864996048e-05 .
Sperm flagellar protein 2 Q9C093 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000757412160039979 .
Splicing factor P23246 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.43133984246658e-05 FC > 5
Splicing factor P23246 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.43133984246658e-05 .
Splicing factor 3B subunit 1 O75533 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00557697579004542 .
Splicing factor 3B subunit 3 Q15393 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.88930684629772e-05 FC > 5
Splicing factor 3B subunit 3 Q15393 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.88930684629772e-05 .
Statherin P02808 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.132310523626487 .
STE20-like serine/threonine-protein kinase Q9H2G2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000155857347427484 .
Sterol O-acyltransferase 1 P35610 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.64873480745824e-05 FC > 5
Sterol O-acyltransferase 1 P35610 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.64873480745824e-05 .
Stress-70 protein P38646 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000120192348560354 .
Stress-induced-phosphoprotein 1 P31948 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000132814465489596 .
Structural maintenance of chromosomes protein 2 O95347 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.60752020217155e-05 FC > 5
Structural maintenance of chromosomes protein 2 O95347 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.60752020217155e-05 .
Structural maintenance of chromosomes protein 4 Q9NTJ3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.31680092807969e-06 FC > 5
Structural maintenance of chromosomes protein 4 Q9NTJ3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.31680092807969e-06 .
Sucrose nonfermenting protein 2 homolog O60264 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0107321754343851 .
SUMO-activating enzyme subunit 2 Q9UBT2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.18570760894008e-05 FC > 5
SUMO-activating enzyme subunit 2 Q9UBT2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.18570760894008e-05 .
Supervillin O95425 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.41581352771425e-06 FC > 5
Supervillin O95425 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.41581352771425e-06 .
Suppressor of SWI4 1 homolog Q9NQ55 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0444249186929164 .
Suprabasin Q6UWP8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0296523507496356 .
Surfeit locus protein 4 O15260 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.28491307780123e-06 FC > 5
Surfeit locus protein 4 O15260 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.28491307780123e-06 .
Synaptotagmin-like protein 2 Q9HCH5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.76435330739737e-06 FC > 5
Synaptotagmin-like protein 2 Q9HCH5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.76435330739737e-06 .
Synemin O15061 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.61926556097705e-05 .
T-complex protein 1 subunit alpha P17987 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000488418854535643 .
T-complex protein 1 subunit beta P78371 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.52077304523057e-05 FC > 5
T-complex protein 1 subunit beta P78371 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.52077304523057e-05 .
T-complex protein 1 subunit delta P50991 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.72739933133316e-05 FC > 5
T-complex protein 1 subunit delta P50991 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.72739933133316e-05 .
T-complex protein 1 subunit epsilon P48643 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.25652759821748e-05 FC > 5
T-complex protein 1 subunit epsilon P48643 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.25652759821748e-05 .
T-complex protein 1 subunit eta Q99832 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
T-complex protein 1 subunit theta P50990 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000211330484121102 .
T-complex protein 1 subunit zeta P40227 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.84409406866783e-06 FC > 5
T-complex protein 1 subunit zeta P40227 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.84409406866783e-06 .
Talin-1 Q9Y490 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.06109944957177e-05 FC > 5
Talin-1 Q9Y490 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.06109944957177e-05 .
TAR DNA-binding protein 43 Q13148 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00128738639785905 .
Tenascin P24821 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000287799839934592 .
Tensin-3 Q68CZ2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.80763089312079e-06 FC > 5
Tensin-3 Q68CZ2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.80763089312079e-06 .
Tensin-4 Q8IZW8 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000118647839451724 .
Thioredoxin P10599 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00226327317654591 .
Thioredoxin reductase 1 Q16881 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.7273782900194e-05 .
THO complex subunit 2 Q8NI27 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.06800259518713e-05 .
Threonine--tRNA ligase 1 P26639 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.6437876613336e-05 FC > 5
Threonine--tRNA ligase 1 P26639 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.6437876613336e-05 .
Thyroid hormone receptor-associated protein 3 Q9Y2W1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000892193661274519 .
Tight junction protein ZO-1 Q07157 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.42952133877246e-06 FC > 5
Tight junction protein ZO-1 Q07157 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.42952133877246e-06 .
TP53-binding protein 1 Q12888 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.29503409293768e-05 .
Transcription elongation factor SPT6 Q7KZ85 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.54047203937538e-05 FC > 5
Transcription elongation factor SPT6 Q7KZ85 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.54047203937538e-05 .
Transcription factor 20 Q9UGU0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Transcription factor p65 Q04206 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000128453945849677 .
Transcription intermediary factor 1-beta Q13263 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.92314790849983e-05 FC > 5
Transcription intermediary factor 1-beta Q13263 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.92314790849983e-05 .
Transcription termination factor 2 Q9UNY4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.82695673810095e-06 FC > 5
Transcription termination factor 2 Q9UNY4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.82695673810095e-06 .
Transcriptional regulator ATRX P46100 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.24357422017573e-05 FC > 5
Transcriptional regulator ATRX P46100 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.24357422017573e-05 .
Transcriptional repressor NF-X1 Q12986 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.52555583951181e-06 FC > 5
Transcriptional repressor NF-X1 Q12986 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.52555583951181e-06 .
Transducin beta-like protein 3 Q12788 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.65488790814641e-05 FC > 5
Transducin beta-like protein 3 Q12788 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.65488790814641e-05 .
Transferrin receptor protein 1 P02786 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.75743984833707e-05 FC > 5
Transferrin receptor protein 1 P02786 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.75743984833707e-05 .
Transitional endoplasmic reticulum ATPase P55072 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.67113045504947e-05 FC > 5
Transitional endoplasmic reticulum ATPase P55072 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.67113045504947e-05 .
Transketolase P29401 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000387066458512342 .
Transmembrane 9 superfamily member 2 Q99805 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.06593175496039e-05 .
Transmembrane 9 superfamily member 3 Q9HD45 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00010699655558585 .
Transmembrane 9 superfamily member 4 Q92544 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.17006337337329e-05 FC > 5
Transmembrane 9 superfamily member 4 Q92544 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.17006337337329e-05 .
Transmembrane protein 205 Q6UW68 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.45386143212598E-05 FC > 5
Transmembrane protein 205 Q6UW68 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.45386143212598e-05 .
Treacle protein Q13428 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.07648216332569e-05 FC > 5
Treacle protein Q13428 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.07648216332569e-05 .
Trinucleotide repeat-containing gene 6A protein Q8NDV7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.34909986039862e-05 FC > 5
Trinucleotide repeat-containing gene 6A protein Q8NDV7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.34909986039862e-05 .
Trinucleotide repeat-containing gene 6B protein Q9UPQ9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.2553153163395e-05 FC > 5
Trinucleotide repeat-containing gene 6B protein Q9UPQ9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.2553153163395e-05 .
Trip4 complex subunit p200 Q8N3C0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.80422975129626e-05 FC > 5
Trip4 complex subunit p200 Q8N3C0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.80422975129626e-05 .
Tripartite motif-containing protein 16 O95361 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000324030473131414 .
Tripeptidyl-peptidase 2 P29144 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000148311338813107 .
Triple functional domain protein O75962 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Tubulin alpha-4A chain P68366 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.36832896929382e-05 .
Tubulin beta chain P07437 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.86513945941625e-05 FC > 5
Tubulin beta chain P07437 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.86513945941625e-05 .
Tyrosine-protein kinase ABL1 P00519 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Tyrosine-protein kinase BAZ1B Q9UIG0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000141064121119063 .
Tyrosine-protein kinase JAK1 P23458 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.21792673844655e-06 FC > 5
Tyrosine-protein kinase JAK1 P23458 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.21792673844655e-06 .
U4/U6 small nuclear ribonucleoprotein Prp3 O43395 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.23406506778376e-06 FC > 5
U4/U6 small nuclear ribonucleoprotein Prp3 O43395 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.23406506778376e-06 .
Ubiquitin carboxyl-terminal hydrolase 10 Q14694 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.00425692084777e-05 FC > 5
Ubiquitin carboxyl-terminal hydrolase 10 Q14694 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.00425692084777e-05 .
Ubiquitin carboxyl-terminal hydrolase 24 Q9UPU5 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00297185472437532 .
Ubiquitin carboxyl-terminal hydrolase 5 P45974 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000454331806194119 .
Ubiquitin carboxyl-terminal hydrolase 7 Q93009 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.000137704213515577 FC > 5
Ubiquitin carboxyl-terminal hydrolase 7 Q93009 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000137704213515577 .
Ubiquitin carboxyl-terminal hydrolase 8 P40818 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.92933844561969e-06 FC > 5
Ubiquitin carboxyl-terminal hydrolase 8 P40818 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.92933844561969e-06 .
Ubiquitin-associated protein 2 Q5T6F2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000174899987117345 .
Ubiquitin-like modifier-activating enzyme 1 P22314 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.10557626765368e-06 FC > 5
Ubiquitin-like modifier-activating enzyme 1 P22314 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.10557626765368e-06 .
UDP-glucose 6-dehydrogenase O60701 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000172733006876275 .
UDP-glucose:glycoprotein glucosyltransferase 1 Q9NYU2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.01334970078805e-05 FC > 5
UDP-glucose:glycoprotein glucosyltransferase 1 Q9NYU2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.01334970078805e-05 .
Uncharacterized protein FLJ45252 Q6ZSR9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 5.32094660826435e-06 .
Uncharacterized protein FLJ45252 Q6ZSR9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 5.32094660826435e-06 FC > 5
Uncharacterized protein KIAA1671 Q9BY89 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.08464338159103e-06 FC > 5
Uncharacterized protein KIAA1671 Q9BY89 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.08464338159103e-06 .
Unconventional myosin-Ib O43795 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.95702493191359e-05 FC > 5
Unconventional myosin-Ib O43795 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.95702493191359e-05 .
Unconventional myosin-Ic O00159 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.000430406205566185 FC > 5
Unconventional myosin-Ic O00159 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000430406205566185 .
Unconventional myosin-Ie Q12965 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.34163355194797e-06 FC > 5
Unconventional myosin-Ie Q12965 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.34163355194797e-06 .
Unconventional myosin-Va Q9Y4I1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.6835233190506e-06 FC > 5
Unconventional myosin-Va Q9Y4I1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.6835233190506e-06 .
Unconventional myosin-VI Q9UM54 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Unconventional myosin-XVB Q96JP2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.41589000141694e-06 FC > 5
Unconventional myosin-XVB Q96JP2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.41589000141694e-06 .
Unconventional myosin-XVIIIa Q92614 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.6267938538075e-05 .
Utrophin P46939 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.61679823349017e-05 .
Uveal autoantigen with coiled-coil domains and ankyrin repeats Q9BZF9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Valine--tRNA ligase P26640 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.50979442576538e-05 .
Vasodilator-stimulated phosphoprotein P50552 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000495338448546659 .
VDAC-2 P45880 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000412292641462644 .
Very large A-kinase anchor protein Q68DQ2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Very-long-chain enoyl-CoA reductase Q9NZ01 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 0.000118089793825349 FC > 5
Very-long-chain enoyl-CoA reductase Q9NZ01 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000118089793825349 .
Vesicle-fusing ATPase P46459 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.63378075512761e-05 FC > 5
Vesicle-fusing ATPase P46459 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.63378075512761e-05 .
Vigilin Q00341 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.88926803126119e-05 FC > 5
Vigilin Q00341 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.88926803126119e-05 .
Vimentin P08670 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0014709843094543 .
Vinculin P18206 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 6.39247083340689e-06 FC > 5
Vinculin P18206 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 6.39247083340689e-06 .
WASH complex subunit 2A Q641Q2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.12139275050783e-05 FC > 5
WASH complex subunit 2A Q641Q2 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.12139275050783e-05 .
WASH complex subunit 2C Q9Y4E1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.71618296049966e-06 FC > 5
WASH complex subunit 2C Q9Y4E1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.71618296049966e-06 .
WD repeat and HMG-box DNA-binding protein 1 O75717 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.73504791108145e-05 FC > 5
WD repeat and HMG-box DNA-binding protein 1 O75717 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.73504791108145e-05 .
WD repeat-containing protein 1 O75083 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00814572518054782 .
WD repeat-containing protein 11 Q9BZH6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
WD repeat-containing protein 36 Q8NI36 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.98954414174335e-06 FC > 5
WD repeat-containing protein 36 Q8NI36 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.98954414174335e-06 .
WD repeat-containing protein 62 O43379 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.1449988105137e-05 FC > 5
WD repeat-containing protein 62 O43379 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.1449988105137e-05 .
WD repeat-containing protein 70 Q9NW82 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.92375248802458e-05 .
WD repeat-containing protein 75 Q8IWA0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.14046765334799e-05 FC > 5
WD repeat-containing protein 75 Q8IWA0 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.14046765334799e-05 .
WD40 repeat-containing protein SMU1 Q2TAY7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.0584768483294433 .
X-ray repair cross-complementing protein 5 P13010 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.58593414603814e-05 .
X-ray repair cross-complementing protein 6 P12956 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 8.03267073301091e-06 FC > 5
X-ray repair cross-complementing protein 6 P12956 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 8.03267073301091e-06 .
YLP motif-containing protein 1 P49750 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 3.54629861262294e-06 FC > 5
YLP motif-containing protein 1 P49750 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.54629861262294e-06 .
YTH domain-containing family protein 2 Q9Y5A9 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.000198493194540411 .
YTH domain-containing family protein 3 Q7Z739 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.64130740416315e-05 .
Zinc finger CCCH domain-containing protein 11A O75152 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.24673460390651e-06 FC > 5
Zinc finger CCCH domain-containing protein 11A O75152 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.24673460390651e-06 .
Zinc finger CCCH domain-containing protein 14 Q6PJT7 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 3.93012113996989e-05 .
Zinc finger CCCH-type antiviral protein 1 Q7Z2W4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 1.89134425475866e-05 FC > 5
Zinc finger CCCH-type antiviral protein 1 Q7Z2W4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 1.89134425475866e-05 .
Zinc finger protein 207 O43670 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.51348252853929e-05 .
Zinc finger protein 217 O75362 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 7.22451720249343e-06 FC > 5
Zinc finger protein 217 O75362 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 7.22451720249343e-06 .
Zinc finger protein 318 Q5VUA4 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Zinc finger protein 609 O15014 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 2.32563688625882e-05 FC > 5
Zinc finger protein 609 O15014 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 2.32563688625882e-05 .
Zinc finger protein 638 Q14966 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.37022854104246e-06 FC > 5
Zinc finger protein 638 Q14966 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.37022854104246e-06 .
Zinc finger protein 828 Q96JM3 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00015706954615587 .
Zinc finger RNA-binding protein Q96KR1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 4.7769421552258e-06 FC > 5
Zinc finger RNA-binding protein Q96KR1 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 4.7769421552258e-06 .
Zinc finger ZZ-type and EF-hand domain-containing protein 1 O43149 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h . .
Zinc-alpha-2-glycoprotein P25311 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 0.00791130634337191 .
[F-actin]-monooxygenase MICAL3 Q7RTP6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) A549 Cells (Adenocarcinoma human alveolar basal epithelial cell) . Lung . P-value = 9.88023126086367e-06 FC > 5
[F-actin]-monooxygenase MICAL3 Q7RTP6 Homo sapiens Pro Info VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) BHK-21 Cells (Small hamster kidney fibroblast) . Kidney 1 h P = 9.88023126086367e-06 .

Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain

GO Term GO Category GO ID Adjusted P-value Odds Ratio Combined Score
RNA Binding Molecular Function GO:0003723 3.14E-107 8.366733295 2104.110703
Cadherin Binding Molecular Function GO:0045296 6.62E-47 10.88042961 1217.40883
mRNA Binding Molecular Function GO:0003729 1.27E-11 4.699148884 142.1133539
Actin Binding Molecular Function GO:0003779 5.36E-11 5.748372219 163.9181537
Double-Stranded RNA Binding Molecular Function GO:0003725 7.02E-10 10.64979707 273.907589
Microtubule Binding Molecular Function GO:0008017 2.10E-09 4.515724714 110.3739192
Tubulin Binding Molecular Function GO:0015631 6.64E-09 3.784310027 87.55345908
ATP Binding Molecular Function GO:0005524 2.33E-08 3.909733124 84.84203626
Adenyl Ribonucleotide Binding Molecular Function GO:0032559 2.33E-08 3.720676949 80.47992756
Protein Kinase Binding Molecular Function GO:0019901 1.15E-06 2.733486076 48.18365006
DNA Binding Molecular Function GO:0003677 2.54E-06 2.258464034 37.80159387
Purine Ribonucleoside Triphosphate Binding Molecular Function GO:0035639 2.69E-06 2.731697895 45.32714678
Single-Stranded DNA Binding Molecular Function GO:0003697 1.01E-05 5.536023055 84.09902873
aminoacyl-tRNA Ligase Activity Molecular Function GO:0004812 1.56E-05 10.19206349 149.2711321
Ubiquitin Protein Ligase Binding Molecular Function GO:0031625 1.56E-05 3.218058723 47.01953392
mRNA 3'-UTR Binding Molecular Function GO:0003730 2.99E-05 5.315993359 73.86839559
mRNA 5'-UTR Binding Molecular Function GO:0048027 3.29E-05 13.72792023 188.6452416
Ubiquitin-Like Protein Ligase Binding Molecular Function GO:0044389 4.73E-05 2.99329221 39.86979941
Kinase Binding Molecular Function GO:0019900 9.50E-05 2.452161909 30.82053365
Oligosaccharyl Transferase Activity Molecular Function GO:0004576 0.000198611 109.286119 1287.427201
Cell-Substrate Junction Cellular Component GO:0030055 2.10E-35 7.649281935 654.4559251
Focal Adhesion Cellular Component GO:0005925 1.31E-34 7.581203146 629.4634986
Nucleus Cellular Component GO:0005634 3.69E-27 2.483049117 162.5745559
Intracellular Membrane-Bounded Organelle Cellular Component GO:0043231 1.95E-26 2.39626984 152.2115314
Intracellular Non-Membrane-Bounded Organelle Cellular Component GO:0043232 4.89E-25 3.522570072 211.6190025
Polymeric Cytoskeletal Fiber Cellular Component GO:0099513 1.42E-17 6.032802443 257.6605216
Nuclear Lumen Cellular Component GO:0031981 3.34E-17 3.477962513 145.0311679
Cytoskeleton Cellular Component GO:0005856 4.56E-17 3.878987476 160.0217317
Actin Cytoskeleton Cellular Component GO:0015629 3.58E-16 5.069645947 198.1033156
Nucleolus Cellular Component GO:0005730 1.63E-15 3.311975999 124.0401613
Ficolin-1-Rich Granule Cellular Component GO:0101002 5.59E-14 6.417751479 217.0748903
Microtubule Cellular Component GO:0005874 2.37E-12 5.90340679 177.0430689
Ficolin-1-Rich Granule Lumen Cellular Component GO:1904813 3.63E-12 7.521221438 221.7627147
Microtubule Cytoskeleton Cellular Component GO:0015630 2.08E-10 3.866280311 98.05937225
Secretory Granule Lumen Cellular Component GO:0034774 1.03E-09 3.867206235 91.63143385
Cytoplasmic Vesicle Lumen Cellular Component GO:0060205 1.75E-09 6.600618905 152.473042
Adherens Junction Cellular Component GO:0005912 1.98E-09 5.595620438 128.2171035
Nuclear Chromosome Cellular Component GO:0000228 1.34E-08 6.951519537 145.5739407
Cell-Cell Junction Cellular Component GO:0005911 3.71E-08 3.610863012 71.75270703
Cytoplasmic Stress Granule Cellular Component GO:0010494 1.20E-07 7.389048991 137.7617236
Regulation Of Translation Biological Process GO:0006417 3.39E-09 5.308346347 145.944014
Gene Expression Biological Process GO:0010467 1.05E-08 4.1713732 107.0887566
Translation Biological Process GO:0006412 6.21E-08 4.459943339 104.757685
mRNA Splicing, Via Spliceosome Biological Process GO:0000398 6.98E-08 4.657702307 107.5147835
Positive Regulation Of Protein Localization To Nucleus Biological Process GO:1900182 2.42E-07 8.579168306 185.4707311
mRNA Processing Biological Process GO:0006397 3.05E-07 4.397706076 93.24348979
DNA Metabolic Process Biological Process GO:0006259 3.71E-07 3.769417136 78.60891456
RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile Biological Process GO:0000377 4.42E-07 4.72332346 97.0413898
Mitotic Cytokinesis Biological Process GO:0000281 4.75E-07 9.440483976 192.1646679
Cytoskeleton-Dependent Cytokinesis Biological Process GO:0061640 8.49E-07 7.369273088 144.9442853
Regulation Of Focal Adhesion Assembly Biological Process GO:0051893 1.04E-06 9.680316092 187.5105262
Regulation Of Cell Migration Biological Process GO:0030334 1.08E-06 3.031116339 58.34988458
RNA Transport Biological Process GO:0050658 1.35E-06 12.26552053 232.3680248
Negative Regulation Of Translation Biological Process GO:0017148 1.38E-06 5.999835548 113.0956313
DNA Duplex Unwinding Biological Process GO:0032508 2.21E-06 11.41843691 209.0382911
Nucleocytoplasmic Transport Biological Process GO:0006913 2.49E-06 9.705261933 175.8947727
Translational Elongation Biological Process GO:0006414 2.64E-06 11.03724928 198.7059615
Regulation Of Cell-Substrate Junction Assembly Biological Process GO:0090109 2.80E-06 20.62553495 368.9157914
Positive Regulation Of Telomere Maintenance Via Telomere Lengthening Biological Process GO:1904358 3.12E-06 12.63268956 223.9361407
Ribosome Biogenesis Biological Process GO:0042254 4.60E-06 4.605853296 79.61527761

Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain

Pathways Category Adjusted P-value Odds Ratio Combined Score
Protein processing in endoplasmic reticulum KEGG Pathway 6.12E-10 5.74230109 153.8764909
Spliceosome KEGG Pathway 2.25E-06 4.787018532 85.66447894
Pathogenic Escherichia coli infection KEGG Pathway 3.18E-06 4.056611781 69.54494401
RNA transport KEGG Pathway 1.35E-05 3.928532519 60.54938997
Tight junction KEGG Pathway 3.34E-05 3.94208214 56.29529015
Amyotrophic lateral sclerosis KEGG Pathway 3.63E-05 2.791982578 38.894057
Regulation of actin cytoskeleton KEGG Pathway 3.63E-05 3.443719756 47.73008508
Focal adhesion KEGG Pathway 9.86E-05 3.414008705 43.45646391
Salmonella infection KEGG Pathway 0.000289584 2.964431487 34.18979184
Aminoacyl-tRNA biosynthesis KEGG Pathway 0.000503455 5.503576538 59.8509904
HIF-1 signaling pathway KEGG Pathway 0.000762798 4.064277072 42.12264835
Endocytosis KEGG Pathway 0.000786073 2.786642767 28.54176824
Adherens junction KEGG Pathway 0.000786073 5.043633763 51.27866551
Ferroptosis KEGG Pathway 0.001557974 6.65009065 62.5694277
Glycolysis / Gluconeogenesis KEGG Pathway 0.002107443 4.820300752 43.56455784
Leukocyte transendothelial migration KEGG Pathway 0.003399936 3.5435743 30.10233167
DNA replication KEGG Pathway 0.003666828 6.613381076 55.27934341
Bacterial invasion of epithelial cells KEGG Pathway 0.005488993 4.098720682 32.25200821
Proteoglycans in cancer KEGG Pathway 0.005488993 2.657213069 20.84335968
Ribosome biogenesis in eukaryotes KEGG Pathway 0.005971528 3.437320917 26.47551436

Virus RNA Sequence Information

>NC_002023.1 Influenza A virus (A/Puerto Rico/8/1934(H1N1)) segment 1, complete sequence AGCGAAAGCAGGTCAATTATATTCAATATGGAAAGAATAAAAGAACTAAGAAATCTAATGTCGCAGTCTC GCACCCGCGAGATACTCACAAAAACCACCGTGGACCATATGGCCATAATCAAGAAGTACACATCAGGAAG ACAGGAGAAGAACCCAGCACTTAGGATGAAATGGATGATGGCAATGAAATATCCAATTACAGCAGACAAG AGGATAACGGAAATGATTCCTGAGAGAAATGAGCAAGGACAAACTTTATGGAGTAAAATGAATGATGCCG GATCAGACCGAGTGATGGTATCACCTCTGGCTGTGACATGGTGGAATAGGAATGGACCAATGACAAATAC AGTTCATTATCCAAAAATCTACAAAACTTATTTTGAAAGAGTCGAAAGGCTAAAGCATGGAACCTTTGGC CCTGTCCATTTTAGAAACCAAGTCAAAATACGTCGGAGAGTTGACATAAATCCTGGTCATGCAGATCTCA GTGCCAAGGAGGCACAGGATGTAATCATGGAAGTTGTTTTCCCTAACGAAGTGGGAGCCAGGATACTAAC ATCGGAATCGCAACTAACGATAACCAAAGAGAAGAAAGAAGAACTCCAGGATTGCAAAATTTCTCCTTTG ATGGTTGCATACATGTTGGAGAGAGAACTGGTCCGCAAAACGAGATTCCTCCCAGTGGCTGGTGGAACAA GCAGTGTGTACATTGAAGTGTTGCATTTGACTCAAGGAACATGCTGGGAACAGATGTATACTCCAGGAGG GGAAGTGAAGAATGATGATGTTGATCAAAGCTTGATTATTGCTGCTAGGAACATAGTGAGAAGAGCTGCA GTATCAGCAGACCCACTAGCATCTTTATTGGAGATGTGCCACAGCACACAGATTGGTGGAATTAGGATGG TAGACATCCTTAAGCAGAACCCAACAGAAGAGCAAGCCGTGGGTATATGCAAGGCTGCAATGGGACTGAG AATTAGCTCATCCTTCAGTTTTGGTGGATTCACATTTAAGAGAACAAGCGGATCATCAGTCAAGAGAGAG GAAGAGGTGCTTACGGGCAATCTTCAAACATTGAAGATAAGAGTGCATGAGGGATATGAAGAGTTCACAA TGGTTGGGAGAAGAGCAACAGCCATACTCAGAAAAGCAACCAGGAGATTGATTCAGCTGATAGTGAGTGG GAGAGACGAACAGTCGATTGCCGAAGCAATAATTGTGGCCATGGTATTTTCACAAGAGGATTGTATGATA AAAGCAGTTAGAGGTGATCTGAATTTCGTCAATAGGGCGAATCAGCGACTGAATCCTATGCATCAACTTT TAAGACATTTTCAGAAGGATGCGAAAGTGCTTTTTCAAAATTGGGGAGTTGAACCTATCGACAATGTGAT GGGAATGATTGGGATATTGCCCGACATGACTCCAAGCATCGAGATGTCAATGAGAGGAGTGAGAATCAGC AAAATGGGTGTAGATGAGTACTCCAGCACGGAGAGGGTAGTGGTGAGCATTGACCGGTTCTTGAGAGTCC GGGACCAACGAGGAAATGTACTACTGTCTCCCGAGGAGGTCAGTGAAACACAGGGAACAGAGAAACTGAC AATAACTTACTCATCGTCAATGATGTGGGAGATTAATGGTCCTGAATCAGTGTTGGTCAATACCTATCAA TGGATCATCAGAAACTGGGAAACTGTTAAAATTCAGTGGTCCCAGAACCCTACAATGCTATACAATAAAA TGGAATTTGAACCATTTCAGTCTTTAGTACCTAAGGCCATTAGAGGCCAATACAGTGGGTTTGTGAGAAC TCTGTTCCAACAAATGAGGGATGTGCTTGGGACATTTGATACCGCACAGATAATAAAACTTCTTCCCTTC GCAGCCGCTCCACCAAAGCAAAGTAGAATGCAGTTCTCCTCATTTACTGTGAATGTGAGGGGATCAGGAA TGAGAATACTTGTAAGGGGCAATTCTCCTGTATTCAACTACAACAAGGCCACGAAGAGACTCACAGTTCT CGGAAAGGATGCTGGCACTTTAACCGAAGACCCAGATGAAGGCACAGCTGGAGTGGAGTCCGCTGTTCTG AGGGGATTCCTCATTCTGGGCAAAGAAGACAGGAGATATGGGCCAGCATTAAGCATCAATGAACTGAGCA ACCTTGCGAAAGGAGAGAAGGCTAATGTGCTAATTGGGCAAGGAGACGTGGTGTTGGTAATGAAACGAAA ACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAGTGT CGAATAGTTTAAAAACGACCTTGTTTCTACT
    Click to Show/Hide