Home
Search 
BLAST
Manual
DownloadDetails of Virus RNA
| Strain Information | Strain Name |
Sindbis virus (strain Toto1101)
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Togaviridae
|
||||||||
| RNA Binding Site |
5'UTR - 3'UTR
|
||||||||
| Virus Information | Virus Name |
Sindbis virus (SINV)
|
|||||||
| Taxonomy ID | 11034 | ||||||||
Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 10 kDa heat shock protein | P61604 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 10 kDa heat shock protein | P61604 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 10 kDa heat shock protein | P61604 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 14 kDa phosphohistidine phosphatase | Q9NRX4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 14 kDa phosphohistidine phosphatase | Q9NRX4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 14 kDa phosphohistidine phosphatase | Q9NRX4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 14-3-3 protein epsilon | P62258 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 14-3-3 protein epsilon | P62258 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 14-3-3 protein epsilon | P62258 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 4 | P55036 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 4 | P55036 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 4 | P55036 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 9 | O00233 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 9 | O00233 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 9 | O00233 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome regulatory subunit 7 | P35998 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome regulatory subunit 7 | P35998 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome regulatory subunit 7 | P35998 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 3-mercaptopyruvate sulfurtransferase | P25325 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 3-mercaptopyruvate sulfurtransferase | P25325 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 3-mercaptopyruvate sulfurtransferase | P25325 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 4-trimethylaminobutyraldehyde dehydrogenase | P49189 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 4-trimethylaminobutyraldehyde dehydrogenase | P49189 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 4-trimethylaminobutyraldehyde dehydrogenase | P49189 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S21 | P63220 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S21 | P63220 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S21 | P63220 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 6-phosphogluconolactonase | O95336 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 6-phosphogluconolactonase | O95336 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 6-phosphogluconolactonase | O95336 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 78 kDa gastrin-binding protein | P40939 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 78 kDa gastrin-binding protein | P40939 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 78 kDa gastrin-binding protein | P40939 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| A-kinase anchor protein 12 | Q02952 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| A-kinase anchor protein 12 | Q02952 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| A-kinase anchor protein 12 | Q02952 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| A6NL28 | A6NL28 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| A6NL28 | A6NL28 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| A6NL28 | A6NL28 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acetyl-CoA acetyltransferase | P24752 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acetyl-CoA acetyltransferase | P24752 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acetyl-CoA acetyltransferase | P24752 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acireductone dioxygenase | Q9BV57 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acireductone dioxygenase | Q9BV57 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acireductone dioxygenase | Q9BV57 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aconitate hydratase | Q99798 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aconitate hydratase | Q99798 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aconitate hydratase | Q99798 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acyl carrier protein | O14561 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acyl carrier protein | O14561 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acyl carrier protein | O14561 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acyl-CoA-binding protein | P07108 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acyl-CoA-binding protein | P07108 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acyl-CoA-binding protein | P07108 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acylamino-acid-releasing enzyme | P13798 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acylamino-acid-releasing enzyme | P13798 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acylamino-acid-releasing enzyme | P13798 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenosine kinase | P55263 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenosine kinase | P55263 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenosine kinase | P55263 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenylate kinase 2 | P54819 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenylate kinase 2 | P54819 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenylate kinase 2 | P54819 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ADP-sugar pyrophosphatase | Q9UKK9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ADP-sugar pyrophosphatase | Q9UKK9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ADP-sugar pyrophosphatase | Q9UKK9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ADP/ATP translocase 3 | P12236 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ADP/ATP translocase 3 | P12236 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ADP/ATP translocase 3 | P12236 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adrenodoxin | P10109 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adrenodoxin | P10109 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adrenodoxin | P10109 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aldehyde dehydrogenase | P05091 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aldehyde dehydrogenase | P05091 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aldehyde dehydrogenase | P05091 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aldo-keto reductase family 1 member B1 | P15121 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aldo-keto reductase family 1 member B1 | P15121 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aldo-keto reductase family 1 member B1 | P15121 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-2-macroglobulin | P01023 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-2-macroglobulin | P01023 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-2-macroglobulin | P01023 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-actinin-4 | O43707 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-actinin-4 | O43707 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-actinin-4 | O43707 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-aminoadipic semialdehyde dehydrogenase | P49419 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-aminoadipic semialdehyde dehydrogenase | P49419 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-aminoadipic semialdehyde dehydrogenase | P49419 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-ETF | P13804 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-ETF | P13804 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-ETF | P13804 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-SGT | O43765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-SGT | O43765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-SGT | O43765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Apoptosis-inducing factor 1 | O95831 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Apoptosis-inducing factor 1 | O95831 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Apoptosis-inducing factor 1 | O95831 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ASF/SF2-associated protein p32 | Q07021 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ASF/SF2-associated protein p32 | Q07021 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ASF/SF2-associated protein p32 | Q07021 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aspartate aminotransferase | P00505 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aspartate aminotransferase | P00505 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aspartate aminotransferase | P00505 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Astrocytic phosphoprotein PEA-15 | Q15121 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Astrocytic phosphoprotein PEA-15 | Q15121 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Astrocytic phosphoprotein PEA-15 | Q15121 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit beta | P06576 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit beta | P06576 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit beta | P06576 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit d | O75947 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit d | O75947 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit d | O75947 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit delta | P30049 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit delta | P30049 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit delta | P30049 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit O | P48047 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit O | P48047 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit O | P48047 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Barrier-to-autointegration factor | O75531 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Barrier-to-autointegration factor | O75531 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Barrier-to-autointegration factor | O75531 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Binder of ARF2 protein 1 | Q9Y2Y0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Binder of ARF2 protein 1 | Q9Y2Y0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Binder of ARF2 protein 1 | Q9Y2Y0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| C-1-tetrahydrofolate synthase | P11586 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| C-1-tetrahydrofolate synthase | P11586 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| C-1-tetrahydrofolate synthase | P11586 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calcyclin-binding protein | Q9HB71 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calcyclin-binding protein | Q9HB71 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calcyclin-binding protein | Q9HB71 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calreticulin | P27797 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calreticulin | P27797 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calreticulin | P27797 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cathepsin B | P07858 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cathepsin B | P07858 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cathepsin B | P07858 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CD276 antigen | Q5ZPR3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CD276 antigen | Q5ZPR3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CD276 antigen | Q5ZPR3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Citrate synthase | O75390 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Citrate synthase | O75390 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Citrate synthase | O75390 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coatomer subunit delta | P48444 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coatomer subunit delta | P48444 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coatomer subunit delta | P48444 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coiled-coil-helix-coiled-coil-helix domain-containing protein 4 | Q8N4Q1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coiled-coil-helix-coiled-coil-helix domain-containing protein 4 | Q8N4Q1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coiled-coil-helix-coiled-coil-helix domain-containing protein 4 | Q8N4Q1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coiled-coil-helix-coiled-coil-helix domain-containing protein 8 | Q9NYJ1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coiled-coil-helix-coiled-coil-helix domain-containing protein 8 | Q9NYJ1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coiled-coil-helix-coiled-coil-helix domain-containing protein 8 | Q9NYJ1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex I-30kD | O75489 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex I-30kD | O75489 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex I-30kD | O75489 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex III subunit 1 | P31930 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex III subunit 1 | P31930 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex III subunit 1 | P31930 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex III subunit 6 | P07919 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex III subunit 6 | P07919 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex III subunit 6 | P07919 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cooperator of PRMT5 | Q9NQ92 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cooperator of PRMT5 | Q9NQ92 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cooperator of PRMT5 | Q9NQ92 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Costars family protein ABRACL | Q9P1F3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Costars family protein ABRACL | Q9P1F3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Costars family protein ABRACL | Q9P1F3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Creatine kinase B-type | P12277 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Creatine kinase B-type | P12277 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Creatine kinase B-type | P12277 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CTD phosphatase SSU72 | Q9NP77 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CTD phosphatase SSU72 | Q9NP77 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CTD phosphatase SSU72 | Q9NP77 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cyclin-dependent kinase inhibitor 2A | P42771 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cyclin-dependent kinase inhibitor 2A | P42771 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cyclin-dependent kinase inhibitor 2A | P42771 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c | P99999 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c | P99999 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c | P99999 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase assembly factor 7 | Q96BR5 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase assembly factor 7 | Q96BR5 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase assembly factor 7 | Q96BR5 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase polypeptide IV | P13073 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase polypeptide IV | P13073 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase polypeptide IV | P13073 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase subunit 5A | P20674 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase subunit 5A | P20674 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase subunit 5A | P20674 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytosol aminopeptidase | P28838 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytosol aminopeptidase | P28838 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytosol aminopeptidase | P28838 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-3-phosphoglycerate dehydrogenase | O43175 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-3-phosphoglycerate dehydrogenase | O43175 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-3-phosphoglycerate dehydrogenase | O43175 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-aspartate | P22061 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-aspartate | P22061 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-aspartate | P22061 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-dopachrome decarboxylase | P30046 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-dopachrome decarboxylase | P30046 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-dopachrome decarboxylase | P30046 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| dCTP pyrophosphatase 1 | Q9H773 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| dCTP pyrophosphatase 1 | Q9H773 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| dCTP pyrophosphatase 1 | Q9H773 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DDP-like protein | Q9Y5J9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DDP-like protein | Q9Y5J9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DDP-like protein | Q9Y5J9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Deafness dystonia protein 1 | O60220 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Deafness dystonia protein 1 | O60220 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Deafness dystonia protein 1 | O60220 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase | Q13011 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase | Q13011 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase | Q13011 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Dihydrolipoyl dehydrogenase | P09622 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Dihydrolipoyl dehydrogenase | P09622 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Dihydrolipoyl dehydrogenase | P09622 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Dipeptidyl peptidase 1 | P53634 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Dipeptidyl peptidase 1 | P53634 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Dipeptidyl peptidase 1 | P53634 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DNA damage-binding protein 1 | Q16531 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DNA damage-binding protein 1 | Q16531 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DNA damage-binding protein 1 | Q16531 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DNA polymerase epsilon subunit 3 | Q9NRF9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DNA polymerase epsilon subunit 3 | Q9NRF9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DNA polymerase epsilon subunit 3 | Q9NRF9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| dUTPase | P33316 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| dUTPase | P33316 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| dUTPase | P33316 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| E3 ubiquitin-protein ligase HUWE1 | Q7Z6Z7 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| E3 ubiquitin-protein ligase HUWE1 | Q7Z6Z7 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| E3 ubiquitin-protein ligase HUWE1 | Q7Z6Z7 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| EKC/KEOPS complex subunit GON7 | Q9BXV9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| EKC/KEOPS complex subunit GON7 | Q9BXV9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| EKC/KEOPS complex subunit GON7 | Q9BXV9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor 1-beta | P24534 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor 1-beta | P24534 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor 1-beta | P24534 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor Tu | P49411 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor Tu | P49411 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor Tu | P49411 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Emerin | P50402 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Emerin | P50402 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Emerin | P50402 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endopeptidase Clp | Q16740 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endopeptidase Clp | Q16740 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endopeptidase Clp | Q16740 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endoribonuclease MBLAC1 | A4D2B0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endoribonuclease MBLAC1 | A4D2B0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endoribonuclease MBLAC1 | A4D2B0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Enoyl-CoA delta isomerase 1 | P42126 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Enoyl-CoA delta isomerase 1 | P42126 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Enoyl-CoA delta isomerase 1 | P42126 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 6 | P56537 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 6 | P56537 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 6 | P56537 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Fascin | Q16658 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Fascin | Q16658 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Fascin | Q16658 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Flavoprotein subunit of complex II | P31040 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Flavoprotein subunit of complex II | P31040 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Flavoprotein subunit of complex II | P31040 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Fumarylacetoacetase | P16930 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Fumarylacetoacetase | P16930 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Fumarylacetoacetase | P16930 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Galectin-1 | P09382 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Galectin-1 | P09382 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Galectin-1 | P09382 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Gamma-glutamyl hydrolase | Q92820 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Gamma-glutamyl hydrolase | Q92820 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Gamma-glutamyl hydrolase | Q92820 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glucose-induced degradation protein 8 homolog | Q9NWU2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glucose-induced degradation protein 8 homolog | Q9NWU2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glucose-induced degradation protein 8 homolog | Q9NWU2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glucosidase 2 subunit beta | P14314 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glucosidase 2 subunit beta | P14314 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glucosidase 2 subunit beta | P14314 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutamate dehydrogenase 1 | P00367 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutamate dehydrogenase 1 | P00367 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutamate dehydrogenase 1 | P00367 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutathione peroxidase 1 | P07203 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutathione peroxidase 1 | P07203 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutathione peroxidase 1 | P07203 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutathione S-transferase omega-1 | P78417 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutathione S-transferase omega-1 | P78417 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutathione S-transferase omega-1 | P78417 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glycinamide ribonucleotide synthetase | P22102 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glycinamide ribonucleotide synthetase | P22102 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glycinamide ribonucleotide synthetase | P22102 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glycine--tRNA ligase | P41250 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glycine--tRNA ligase | P41250 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glycine--tRNA ligase | P41250 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glyoxalase domain-containing protein 4 | Q9HC38 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glyoxalase domain-containing protein 4 | Q9HC38 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glyoxalase domain-containing protein 4 | Q9HC38 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| HESB-like domain-containing protein 1 | Q86U28 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| HESB-like domain-containing protein 1 | Q86U28 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| HESB-like domain-containing protein 1 | Q86U28 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| HIRA-interacting protein 5 | Q9UMS0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| HIRA-interacting protein 5 | Q9UMS0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| HIRA-interacting protein 5 | Q9UMS0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Histone H1.2 | P16403 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Histone H1.2 | P16403 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Histone H1.2 | P16403 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Histone-lysine N-methyltransferase SETD7 | Q8WTS6 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Histone-lysine N-methyltransferase SETD7 | Q8WTS6 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Histone-lysine N-methyltransferase SETD7 | Q8WTS6 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Hsc70-interacting protein | P50502 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Hsc70-interacting protein | P50502 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Hsc70-interacting protein | P50502 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inactive tyrosine-protein kinase 7 | Q13308 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inactive tyrosine-protein kinase 7 | Q13308 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inactive tyrosine-protein kinase 7 | Q13308 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inorganic pyrophosphatase | Q15181 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inorganic pyrophosphatase | Q15181 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inorganic pyrophosphatase | Q15181 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inosine-5'-monophosphate dehydrogenase 2 | P12268 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inosine-5'-monophosphate dehydrogenase 2 | P12268 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inosine-5'-monophosphate dehydrogenase 2 | P12268 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inositol-3-phosphate synthase 1 | Q9NPH2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inositol-3-phosphate synthase 1 | Q9NPH2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inositol-3-phosphate synthase 1 | Q9NPH2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isoaspartyl peptidase/L-asparaginase | Q7L266 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isoaspartyl peptidase/L-asparaginase | Q7L266 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isoaspartyl peptidase/L-asparaginase | Q7L266 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isocitric dehydrogenase subunit alpha | P50213 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isocitric dehydrogenase subunit alpha | P50213 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isocitric dehydrogenase subunit alpha | P50213 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isopentenyl-diphosphate Delta-isomerase 1 | Q13907 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isopentenyl-diphosphate Delta-isomerase 1 | Q13907 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isopentenyl-diphosphate Delta-isomerase 1 | Q13907 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| JNK-interacting protein 4 | O60271 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| JNK-interacting protein 4 | O60271 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| JNK-interacting protein 4 | O60271 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Jupiter microtubule associated homolog 2 | Q9H910 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Jupiter microtubule associated homolog 2 | Q9H910 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Jupiter microtubule associated homolog 2 | Q9H910 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| LANP-like protein | Q9BTT0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| LANP-like protein | Q9BTT0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| LANP-like protein | Q9BTT0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| M2 antigen complex 70 kDa subunit | P10515 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| M2 antigen complex 70 kDa subunit | P10515 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| M2 antigen complex 70 kDa subunit | P10515 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Malate dehydrogenase | P40926 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Malate dehydrogenase | P40926 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Malate dehydrogenase | P40926 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mammalian ependymin-related protein 1 | Q9UM22 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mammalian ependymin-related protein 1 | Q9UM22 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mammalian ependymin-related protein 1 | Q9UM22 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mapmodulin | P39687 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mapmodulin | P39687 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mapmodulin | P39687 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| MARCKS-related protein | P49006 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| MARCKS-related protein | P49006 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| MARCKS-related protein | P49006 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| MCCase subunit beta | Q9HCC0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| MCCase subunit beta | Q9HCC0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| MCCase subunit beta | Q9HCC0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Medium tumor antigen-associated 61 kDa protein | P30153 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Medium tumor antigen-associated 61 kDa protein | P30153 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Medium tumor antigen-associated 61 kDa protein | P30153 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Methionine adenosyltransferase 2 subunit beta | Q9NZL9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Methionine adenosyltransferase 2 subunit beta | Q9NZL9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Methionine adenosyltransferase 2 subunit beta | Q9NZL9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Methylosome subunit pICln | P54105 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Methylosome subunit pICln | P54105 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Methylosome subunit pICln | P54105 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mitochondrial import inner membrane translocase subunit Tim13 | Q9Y5L4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mitochondrial import inner membrane translocase subunit Tim13 | Q9Y5L4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mitochondrial import inner membrane translocase subunit Tim13 | Q9Y5L4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mitochondrial proton/calcium exchanger protein | O95202 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mitochondrial proton/calcium exchanger protein | O95202 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mitochondrial proton/calcium exchanger protein | O95202 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| mPR | O00264 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| mPR | O00264 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| mPR | O00264 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Myosin regulatory light chain 12B | O14950 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Myosin regulatory light chain 12B | O14950 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Myosin regulatory light chain 12B | O14950 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Myristoylated alanine-rich C-kinase substrate | P29966 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Myristoylated alanine-rich C-kinase substrate | P29966 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Myristoylated alanine-rich C-kinase substrate | P29966 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| N-sulphoglucosamine sulphohydrolase | P51688 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| N-sulphoglucosamine sulphohydrolase | P51688 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| N-sulphoglucosamine sulphohydrolase | P51688 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| NAC-alpha | Q13765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| NAC-alpha | Q13765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| NAC-alpha | Q13765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| NADH-ubiquinone oxidoreductase 24 kDa subunit | P19404 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| NADH-ubiquinone oxidoreductase 24 kDa subunit | P19404 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| NADH-ubiquinone oxidoreductase 24 kDa subunit | P19404 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Neuronal calcium sensor 1 | P62166 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Neuronal calcium sensor 1 | P62166 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Neuronal calcium sensor 1 | P62166 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| OGDC-E2 | P36957 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| OGDC-E2 | P36957 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| OGDC-E2 | P36957 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PABP-interacting protein 2 | Q9BPZ3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PABP-interacting protein 2 | Q9BPZ3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PABP-interacting protein 2 | Q9BPZ3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PAF acetylhydrolase 29 kDa subunit | Q15102 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PAF acetylhydrolase 29 kDa subunit | Q15102 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PAF acetylhydrolase 29 kDa subunit | Q15102 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PDHE1-A type I | P08559 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PDHE1-A type I | P08559 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PDHE1-A type I | P08559 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PDHE1-B | P11177 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PDHE1-B | P11177 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PDHE1-B | P11177 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase F | P30405 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase F | P30405 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase F | P30405 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase FKBP10 | Q96AY3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase FKBP10 | Q96AY3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase FKBP10 | Q96AY3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase FKBP4 | Q02790 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase FKBP4 | Q02790 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase FKBP4 | Q02790 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-5 | P30044 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-5 | P30044 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-5 | P30044 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxisomal biogenesis factor 19 | P40855 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxisomal biogenesis factor 19 | P40855 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxisomal biogenesis factor 19 | P40855 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Phosphoribosylformylglycinamidine synthase | O15067 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Phosphoribosylformylglycinamidine synthase | O15067 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Phosphoribosylformylglycinamidine synthase | O15067 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Positive cofactor 4 | P53999 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Positive cofactor 4 | P53999 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Positive cofactor 4 | P53999 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PP2A-beta | P62714 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PP2A-beta | P62714 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PP2A-beta | P62714 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 2 | Q9UHV9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 2 | Q9UHV9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 2 | Q9UHV9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 4 | Q9NQP4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 4 | Q9NQP4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 4 | Q9NQP4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 5 | Q99471 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 5 | Q99471 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 5 | Q99471 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prohibitin 1 | P35232 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prohibitin 1 | P35232 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prohibitin 1 | P35232 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prohibitin-2 | Q99623 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prohibitin-2 | Q99623 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prohibitin-2 | Q99623 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proliferating cell nuclear antigen | P12004 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proliferating cell nuclear antigen | P12004 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proliferating cell nuclear antigen | P12004 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prolyl endopeptidase | P48147 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prolyl endopeptidase | P48147 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prolyl endopeptidase | P48147 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-1 | P25786 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-1 | P25786 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-1 | P25786 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-2 | P25787 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-2 | P25787 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-2 | P25787 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-3 | P25788 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-3 | P25788 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-3 | P25788 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-4 | P25789 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-4 | P25789 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-4 | P25789 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-5 | P28066 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-5 | P28066 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-5 | P28066 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-6 | P60900 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-6 | P60900 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-6 | P60900 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-7 | O14818 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-7 | O14818 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-7 | O14818 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-1 | P20618 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-1 | P20618 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-1 | P20618 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-2 | P49721 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-2 | P49721 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-2 | P49721 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-3 | P49720 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-3 | P49720 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-3 | P49720 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-4 | P28070 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-4 | P28070 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-4 | P28070 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-5 | P28074 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-5 | P28074 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-5 | P28074 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-6 | P28072 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-6 | P28072 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-6 | P28072 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein CutA | O60888 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein CutA | O60888 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein CutA | O60888 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A3 | P30101 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A3 | P30101 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A3 | P30101 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A4 | P13667 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A4 | P13667 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A4 | P13667 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A6 | Q15084 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A6 | Q15084 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A6 | Q15084 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein FAM136A | Q96C01 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein FAM136A | Q96C01 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein FAM136A | Q96C01 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein LZIC | Q8WZA0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein LZIC | Q8WZA0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein LZIC | Q8WZA0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein NipSnap homolog 3A | Q9UFN0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein NipSnap homolog 3A | Q9UFN0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein NipSnap homolog 3A | Q9UFN0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase 1 regulatory subunit 14B | Q96C90 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase 1 regulatory subunit 14B | Q96C90 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase 1 regulatory subunit 14B | Q96C90 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase 1G | O15355 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase 1G | O15355 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase 1G | O15355 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase inhibitor 2 | P41236 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase inhibitor 2 | P41236 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase inhibitor 2 | P41236 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein SET | Q01105 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein SET | Q01105 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein SET | Q01105 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Pterin-4-alpha-carbinolamine dehydratase | P61457 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Pterin-4-alpha-carbinolamine dehydratase | P61457 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Pterin-4-alpha-carbinolamine dehydratase | P61457 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Puromycin-sensitive aminopeptidase | P55786 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Puromycin-sensitive aminopeptidase | P55786 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Puromycin-sensitive aminopeptidase | P55786 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ragulator complex protein LAMTOR5 | O43504 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ragulator complex protein LAMTOR5 | O43504 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ragulator complex protein LAMTOR5 | O43504 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ras-related protein Rab-11A | P62491 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ras-related protein Rab-11A | P62491 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ras-related protein Rab-11A | P62491 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Regulator of G-protein signaling 10 | O43665 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Regulator of G-protein signaling 10 | O43665 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Regulator of G-protein signaling 10 | O43665 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Reticulocalbin-1 | Q15293 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Reticulocalbin-1 | Q15293 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Reticulocalbin-1 | Q15293 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Reticulocalbin-2 | Q14257 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Reticulocalbin-2 | Q14257 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Reticulocalbin-2 | Q14257 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| RuvB-like 1 | Q9Y265 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| RuvB-like 1 | Q9Y265 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| RuvB-like 1 | Q9Y265 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| S-phase kinase-associated protein 1 | P63208 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| S-phase kinase-associated protein 1 | P63208 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| S-phase kinase-associated protein 1 | P63208 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SAP domain-containing ribonucleoprotein | P82979 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SAP domain-containing ribonucleoprotein | P82979 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SAP domain-containing ribonucleoprotein | P82979 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Secernin-1 | Q12765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Secernin-1 | Q12765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Secernin-1 | Q12765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine hydroxymethyltransferase | P34897 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine hydroxymethyltransferase | P34897 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine hydroxymethyltransferase | P34897 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine/threonine-protein phosphatase CPPED1 | Q9BRF8 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine/threonine-protein phosphatase CPPED1 | Q9BRF8 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine/threonine-protein phosphatase CPPED1 | Q9BRF8 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serpin B6 | P35237 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serpin B6 | P35237 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serpin B6 | P35237 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Sideroflexin-1 | Q9H9B4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Sideroflexin-1 | Q9H9B4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Sideroflexin-1 | Q9H9B4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Small nuclear ribonucleoprotein F | P62306 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Small nuclear ribonucleoprotein F | P62306 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Small nuclear ribonucleoprotein F | P62306 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Sorcin | P30626 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Sorcin | P30626 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Sorcin | P30626 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Stress-70 protein | P38646 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Stress-70 protein | P38646 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Stress-70 protein | P38646 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Stress-induced-phosphoprotein 1 | P31948 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Stress-induced-phosphoprotein 1 | P31948 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Stress-induced-phosphoprotein 1 | P31948 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SUMO-activating enzyme subunit 1 | Q9UBE0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SUMO-activating enzyme subunit 1 | Q9UBE0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SUMO-activating enzyme subunit 1 | Q9UBE0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SUMO-activating enzyme subunit 2 | Q9UBT2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SUMO-activating enzyme subunit 2 | Q9UBT2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SUMO-activating enzyme subunit 2 | Q9UBT2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Superoxide dismutase [Cu-Zn] | P00441 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Superoxide dismutase [Cu-Zn] | P00441 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Superoxide dismutase [Cu-Zn] | P00441 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Superoxide dismutase [Mn] | P04179 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Superoxide dismutase [Mn] | P04179 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Superoxide dismutase [Mn] | P04179 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Synapse-associated protein 1 | Q96A49 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Synapse-associated protein 1 | Q96A49 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Synapse-associated protein 1 | Q96A49 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit beta | P78371 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit beta | P78371 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit beta | P78371 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit epsilon | P48643 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit epsilon | P48643 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit epsilon | P48643 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit gamma | P49368 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit gamma | P49368 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit gamma | P49368 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thioredoxin domain-containing protein 5 | Q8NBS9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thioredoxin domain-containing protein 5 | Q8NBS9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thioredoxin domain-containing protein 5 | Q8NBS9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Threonine--tRNA ligase 1 | P26639 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Threonine--tRNA ligase 1 | P26639 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Threonine--tRNA ligase 1 | P26639 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thymosin beta-15A | P0CG34 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thymosin beta-15A | P0CG34 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thymosin beta-15A | P0CG34 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Torsin-1A-interacting protein 1 | Q5JTV8 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Torsin-1A-interacting protein 1 | Q5JTV8 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Torsin-1A-interacting protein 1 | Q5JTV8 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| TP-beta | P55084 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| TP-beta | P55084 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| TP-beta | P55084 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transcription factor A | Q00059 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transcription factor A | Q00059 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transcription factor A | Q00059 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transcriptional coactivator YAP1 | P46937 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transcriptional coactivator YAP1 | P46937 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transcriptional coactivator YAP1 | P46937 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transforming protein RhoA | P61586 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transforming protein RhoA | P61586 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transforming protein RhoA | P61586 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Triosephosphate isomerase | P60174 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Triosephosphate isomerase | P60174 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Triosephosphate isomerase | P60174 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tripeptidyl-peptidase 2 | P29144 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tripeptidyl-peptidase 2 | P29144 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tripeptidyl-peptidase 2 | P29144 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tubulin-specific chaperone A | O75347 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tubulin-specific chaperone A | O75347 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tubulin-specific chaperone A | O75347 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tumor protein D54 | O43399 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tumor protein D54 | O43399 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tumor protein D54 | O43399 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| U6 snRNA-associated Sm-like protein LSm5 | Q9Y4Y9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| U6 snRNA-associated Sm-like protein LSm5 | Q9Y4Y9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| U6 snRNA-associated Sm-like protein LSm5 | Q9Y4Y9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| U6 snRNA-associated Sm-like protein LSm8 | O95777 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| U6 snRNA-associated Sm-like protein LSm8 | O95777 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| U6 snRNA-associated Sm-like protein LSm8 | O95777 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ubiquitin thioesterase OTUB1 | Q96FW1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ubiquitin thioesterase OTUB1 | Q96FW1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ubiquitin thioesterase OTUB1 | Q96FW1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UBX domain-containing protein 7 | O94888 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UBX domain-containing protein 7 | O94888 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UBX domain-containing protein 7 | O94888 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UCH-L3 | P15374 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UCH-L3 | P15374 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UCH-L3 | P15374 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UMP-CMP kinase | P30085 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UMP-CMP kinase | P30085 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UMP-CMP kinase | P30085 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UV excision repair protein RAD23 homolog B | P54727 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UV excision repair protein RAD23 homolog B | P54727 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UV excision repair protein RAD23 homolog B | P54727 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| VDAC-2 | P45880 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| VDAC-2 | P45880 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| VDAC-2 | P45880 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Vimentin | P08670 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Vimentin | P08670 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Vimentin | P08670 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Xaa-Pro dipeptidase | P12955 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Xaa-Pro dipeptidase | P12955 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Xaa-Pro dipeptidase | P12955 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Zinc finger protein 428 | Q96B54 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Zinc finger protein 428 | Q96B54 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Zinc finger protein 428 | Q96B54 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) and UV cross-linking and immunoprecipitation sequencing (CLIP-seq) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| GO Term | GO Category | GO ID | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|---|
| RNA Binding | Molecular Function |
GO:0003723
|
1.35E-24 | 5.407457392 | 328.5312493 |
| Cadherin Binding | Molecular Function |
GO:0045296
|
1.87E-05 | 4.767919897 | 76.24195976 |
| Ubiquitin Protein Ligase Binding | Molecular Function |
GO:0031625
|
0.000143041 | 4.680159267 | 63.41533382 |
| Ubiquitin-Like Protein Ligase Binding | Molecular Function |
GO:0044389
|
0.000247329 | 4.367535402 | 55.53127105 |
| Intramolecular Oxidoreductase Activity, Transposing C=C Bonds | Molecular Function |
GO:0016863
|
0.001074454 | 36.10805861 | 398.003318 |
| Poly-Pyrimidine Tract Binding | Molecular Function |
GO:0008187
|
0.00114106 | 18.109375 | 195.2207988 |
| 3-hydroxyacyl-CoA Dehydrogenase Activity | Molecular Function |
GO:0003857
|
0.001210046 | 107.9616788 | 1140.857455 |
| mRNA Binding | Molecular Function |
GO:0003729
|
0.001725644 | 3.864281255 | 38.94720619 |
| acetyl-CoA C-acyltransferase Activity | Molecular Function |
GO:0003988
|
0.001862988 | 71.97080292 | 711.3887038 |
| Protein Heterodimerization Activity | Molecular Function |
GO:0046982
|
0.002367009 | 4.515142605 | 43.07265785 |
| Oxidoreduction-Driven Active Transmembrane Transporter Activity | Molecular Function |
GO:0015453
|
0.002956776 | 9.075184502 | 83.68970154 |
| Active Monoatomic Ion Transmembrane Transporter Activity | Molecular Function |
GO:0022853
|
0.008430427 | 14.43443223 | 116.7321044 |
| Oxidoreductase Activity, Acting On The CH-OH Group Of Donors, NAD Or NADP As Acceptor | Molecular Function |
GO:0016616
|
0.008708143 | 5.784722222 | 45.95839989 |
| Metal Ion Binding | Molecular Function |
GO:0046872
|
0.008708143 | 2.655572357 | 20.97028049 |
| enoyl-CoA Hydratase Activity | Molecular Function |
GO:0004300
|
0.008708143 | 26.98220803 | 211.1534532 |
| Hydro-Lyase Activity | Molecular Function |
GO:0016836
|
0.008708143 | 8.824426112 | 68.53901499 |
| Transition Metal Ion Binding | Molecular Function |
GO:0046914
|
0.011742631 | 2.686590038 | 19.66287386 |
| 4 Iron, 4 Sulfur Cluster Binding | Molecular Function |
GO:0051539
|
0.011742631 | 21.58357664 | 157.4769734 |
| Ribosomal Large Subunit Binding | Molecular Function |
GO:0043023
|
0.011742631 | 21.58357664 | 157.4769734 |
| pre-mRNA Binding | Molecular Function |
GO:0036002
|
0.012221531 | 11.10002818 | 79.9743877 |
| Intracellular Organelle Lumen | Cellular Component |
GO:0070013
|
5.83E-27 | 7.182055295 | 471.6373461 |
| Mitochondrial Matrix | Cellular Component |
GO:0005759
|
7.78E-21 | 9.733352692 | 495.1590208 |
| Nucleus | Cellular Component |
GO:0005634
|
7.73E-20 | 3.308673867 | 159.3826951 |
| Intracellular Membrane-Bounded Organelle | Cellular Component |
GO:0043231
|
4.37E-17 | 2.98105959 | 123.8485279 |
| Ficolin-1-Rich Granule Lumen | Cellular Component |
GO:1904813
|
5.77E-10 | 11.23844308 | 280.1427472 |
| Organelle Inner Membrane | Cellular Component |
GO:0019866
|
2.08E-09 | 5.388403376 | 126.4319565 |
| Ficolin-1-Rich Granule | Cellular Component |
GO:0101002
|
2.46E-09 | 8.187793646 | 188.5323649 |
| Secretory Granule Lumen | Cellular Component |
GO:0034774
|
2.46E-09 | 6.004810406 | 138.1371258 |
| Mitochondrial Envelope | Cellular Component |
GO:0005740
|
4.42E-09 | 9.239257294 | 206.0550042 |
| Mitochondrial Inner Membrane | Cellular Component |
GO:0005743
|
8.08E-09 | 5.312527131 | 114.7196973 |
| Mitochondrial Intermembrane Space | Cellular Component |
GO:0005758
|
1.41E-08 | 15.95105411 | 334.0746374 |
| Organelle Envelope Lumen | Cellular Component |
GO:0031970
|
3.62E-08 | 14.26764279 | 284.1140523 |
| Cytoplasmic Vesicle Lumen | Cellular Component |
GO:0060205
|
1.07E-07 | 9.472407903 | 177.5609528 |
| Mitochondrial Membrane | Cellular Component |
GO:0031966
|
1.32E-07 | 4.044210526 | 74.66370849 |
| Focal Adhesion | Cellular Component |
GO:0005925
|
0.000107008 | 3.645164328 | 42.63839768 |
| Cell-Substrate Junction | Cellular Component |
GO:0030055
|
0.00013242 | 3.566338601 | 40.72628898 |
| Vacuolar Lumen | Cellular Component |
GO:0005775
|
0.000178027 | 5.396065163 | 59.69694067 |
| Cytosolic Small Ribosomal Subunit | Cellular Component |
GO:0022627
|
0.000214524 | 12.45419083 | 134.7469612 |
| Small Ribosomal Subunit | Cellular Component |
GO:0015935
|
0.000234372 | 12.10762608 | 129.271354 |
| Mitochondrial Proton-Transporting ATP Synthase Complex | Cellular Component |
GO:0005753
|
0.000868829 | 20.62689691 | 191.1397897 |
| Proteasome-Mediated Ubiquitin-Dependent Protein Catabolic Process | Biological Process |
GO:0043161
|
3.98E-10 | 6.869178576 | 195.4838131 |
| Proteasomal Protein Catabolic Process | Biological Process |
GO:0010498
|
3.98E-10 | 8.507625272 | 241.0099949 |
| Ubiquitin-Dependent Protein Catabolic Process | Biological Process |
GO:0006511
|
1.02E-06 | 5.101137612 | 102.4126198 |
| Oxidative Phosphorylation | Biological Process |
GO:0006119
|
5.91E-06 | 13.90007773 | 250.6135298 |
| Positive Regulation Of Telomere Maintenance Via Telomere Lengthening | Biological Process |
GO:1904358
|
6.66E-06 | 21.69461655 | 383.7104842 |
| Cellular Respiration | Biological Process |
GO:0045333
|
6.77E-06 | 10.98044097 | 192.0266529 |
| Regulation Of Telomere Maintenance Via Telomerase | Biological Process |
GO:0032210
|
6.88E-06 | 15.73640725 | 272.5228172 |
| Protein Stabilization | Biological Process |
GO:0050821
|
7.16E-06 | 6.235951469 | 106.9150311 |
| De Novo' Post-Translational Protein Folding | Biological Process |
GO:0051084
|
3.63E-05 | 20.42755556 | 312.5255777 |
| Positive Regulation Of Telomere Maintenance Via Telomerase | Biological Process |
GO:0032212
|
3.63E-05 | 20.42755556 | 312.5255777 |
| Positive Regulation Of DNA Biosynthetic Process | Biological Process |
GO:2000573
|
3.88E-05 | 11.79390991 | 178.5021916 |
| acetyl-CoA Biosynthetic Process | Biological Process |
GO:0006085
|
4.79E-05 | 51.77521008 | 768.2628684 |
| Aerobic Electron Transport Chain | Biological Process |
GO:0019646
|
4.89E-05 | 11.19251202 | 164.9611206 |
| Mitochondrial ATP Synthesis Coupled Electron Transport | Biological Process |
GO:0042775
|
5.85E-05 | 10.82444336 | 156.7952189 |
| Proton Motive Force-Driven Mitochondrial ATP Synthesis | Biological Process |
GO:0042776
|
6.53E-05 | 13.00487402 | 185.631643 |
| Positive Regulation Of Protein Localization To Nucleus | Biological Process |
GO:1900182
|
6.53E-05 | 10.47974414 | 149.2353301 |
| Positive Regulation Of Telomerase RNA Localization To Cajal Body | Biological Process |
GO:1904874
|
8.36E-05 | 40.26552288 | 561.0529637 |
| Proton Motive Force-Driven ATP Synthesis | Biological Process |
GO:0015986
|
0.000149106 | 11.25021447 | 149.6009933 |
| Regulation Of Telomerase RNA Localization To Cajal Body | Biological Process |
GO:1904872
|
0.000223352 | 30.19454657 | 387.6815165 |
| Positive Regulation Of Establishment Of Protein Localization To Telomere | Biological Process |
GO:1904851
|
0.000343409 | 57.78168498 | 714.0654574 |
Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| Prion disease | KEGG Pathway | 1.08E-24 | 13.18515089 | 798.0743809 |
| Parkinson disease | KEGG Pathway | 4.65E-23 | 13.18481115 | 739.3713786 |
| Huntington disease | KEGG Pathway | 2.91E-22 | 11.14928748 | 600.2461637 |
| Amyotrophic lateral sclerosis | KEGG Pathway | 1.04E-20 | 9.460251046 | 472.7791051 |
| Proteasome | KEGG Pathway | 7.94E-19 | 44.40291777 | 2016.52952 |
| Alzheimer disease | KEGG Pathway | 6.31E-17 | 8.097684417 | 330.2171695 |
| Pathways of neurodegeneration | KEGG Pathway | 6.31E-17 | 7.016918319 | 285.6085063 |
| Spinocerebellar ataxia | KEGG Pathway | 1.93E-14 | 13.17946337 | 459.2308428 |
| Citrate cycle | KEGG Pathway | 2.98E-12 | 42.88563514 | 1273.275366 |
| Diabetic cardiomyopathy | KEGG Pathway | 1.06E-08 | 7.339747469 | 157.1393689 |
| Pyruvate metabolism | KEGG Pathway | 1.39E-08 | 19.92711813 | 419.2834939 |
| Protein processing in endoplasmic reticulum | KEGG Pathway | 2.92E-07 | 7.18107751 | 128.5960896 |
| Cysteine and methionine metabolism | KEGG Pathway | 4.06E-07 | 16.12104114 | 282.1189257 |
| Glycolysis / Gluconeogenesis | KEGG Pathway | 4.10E-07 | 12.92200539 | 225.0424402 |
| Oxidative phosphorylation | KEGG Pathway | 5.93E-07 | 8.044160354 | 136.5711389 |
| Valine, leucine and isoleucine degradation | KEGG Pathway | 3.75E-06 | 14.63420074 | 220.5089083 |
| Tryptophan metabolism | KEGG Pathway | 2.00E-05 | 14.5837037 | 194.4907877 |
| Fatty acid degradation | KEGG Pathway | 2.22E-05 | 14.17788066 | 186.7271149 |
| Lysine degradation | KEGG Pathway | 2.71E-05 | 10.63494424 | 137.3923106 |
| Glyoxylate and dicarboxylate metabolism | KEGG Pathway | 3.15E-05 | 18.17250923 | 231.0852585 |
Virus RNA Sequence Information
|
>NC_001547.1 Sindbis virus, complete genome
ATTGACGGCGTAGTACACACTATTGAATCAAACAGCCGACCAATTGCACTACCATCACAATGGAGAAGCC
AGTAGTAAACGTAGACGTAGACCCCCAGAGTCCGTTTGTCGTGCAACTGCAAAAAAGCTTCCCGCAATTT
GAGGTAGTAGCACAGCAGGTCACTCCAAATGACCATGCTAATGCCAGAGCATTTTCGCATCTGGCCAGTA
AACTAATCGAGCTGGAGGTTCCTACCACAGCGACGATCTTGGACATAGGCAGCGCACCGGCTCGTAGAAT
GTTTTCCGAGCACCAGTATCATTGTGTCTGCCCCATGCGTAGTCCAGAAGACCCGGACCGCATGATGAAA
TACGCCAGTAAACTGGCGGAAAAAGCGTGCAAGATTACAAACAAGAACTTGCATGAGAAGATTAAGGATC
TCCGGACCGTACTTGATACGCCGGATGCTGAAACACCATCGCTCTGCTTTCACAACGATGTTACCTGCAA
CATGCGTGCCGAATATTCCGTCATGCAGGACGTGTATATCAACGCTCCCGGAACTATCTATCATCAGGCT
ATGAAAGGCGTGCGGACCCTGTACTGGATTGGCTTCGACACCACCCAGTTCATGTTCTCGGCTATGGCAG
GTTCGTACCCTGCGTACAACACCAACTGGGCCGACGAGAAAGTCCTTGAAGCGCGTAACATCGGACTTTG
CAGCACAAAGCTGAGTGAAGGTAGGACAGGAAAATTGTCGATAATGAGGAAGAAGGAGTTGAAGCCCGGG
TCGCGGGTTTATTTCTCCGTAGGATCGACACTTTATCCAGAACACAGAGCCAGCTTGCAGAGCTGGCATC
TTCCATCGGTGTTCCACTTGAATGGAAAGCAGTCGTACACTTGCCGCTGTGATACAGTGGTGAGTTGCGA
AGGCTACGTAGTGAAGAAAATCACCATCAGTCCCGGGATCACGGGAGAAACCGTGGGATACGCGGTTACA
CACAATAGCGAGGGCTTCTTGCTATGCAAAGTTACTGACACAGTAAAAGGAGAACGGGTATCGTTCCCTG
TGTGCACGTACATCCCGGCCACCATATGCGATCAGATGACTGGTATAATGGCCACGGATATATCACCTGA
CGATGCACAAAAACTTCTGGTTGGGCTCAACCAGCGAATTGTCATTAACGGTAGGACTAACAGGAACACC
AACACCATGCAAAATTACCTTCTGCCGATCATAGCACAAGGGTTCAGCAAATGGGCTAAGGAGCGCAAGG
ATGATCTTGATAACGAGAAAATGCTGGGTACTAGAGAACGCAAGCTTACGTATGGCTGCTTGTGGGCGTT
TCGCACTAAGAAAGTACATTCGTTTTATCGCCCACCTGGAACGCAGACCTGCGTAAAAGTCCCAGCCTCT
TTTAGCGCTTTTCCCATGTCGTCCGTATGGACGACCTCTTTGCCCATGTCGCTGAGGCAGAAATTGAAAC
TGGCATTGCAACCAAAGAAGGAGGAAAAACTGCTGCAGGTCTCGGAGGAATTAGTCATGGAGGCCAAGGC
TGCTTTTGAGGATGCTCAGGAGGAAGCCAGAGCGGAGAAGCTCCGAGAAGCACTTCCACCATTAGTGGCA
GACAAAGGCATCGAGGCAGCCGCAGAAGTTGTCTGCGAAGTGGAGGGGCTCCAGGCGGACATCGGAGCAG
CATTAGTTGAAACCCCGCGCGGTCACGTAAGGATAATACCTCAAGCAAATGACCGTATGATCGGACAGTA
TATCGTTGTCTCGCCAAACTCTGTGCTGAAGAATGCCAAACTCGCACCAGCGCACCCGCTAGCAGATCAG
GTTAAGATCATAACACACTCCGGAAGATCAGGAAGGTACGCGGTCGAACCATACGACGCTAAAGTACTGA
TGCCAGCAGGAGGTGCCGTACCATGGCCAGAATTCCTAGCACTGAGTGAGAGCGCCACGTTAGTGTACAA
CGAAAGAGAGTTTGTGAACCGCAAACTATACCACATTGCCATGCATGGCCCCGCCAAGAATACAGAAGAG
GAGCAGTACAAGGTTACAAAGGCAGAGCTTGCAGAAACAGAGTACGTGTTTGACGTGGACAAGAAGCGTT
GCGTTAAGAAGGAAGAAGCCTCAGGTCTGGTCCTCTCGGGAGAACTGACCAACCCTCCCTATCATGAGCT
AGCTCTGGAGGGACTGAAGACCCGACCTGCGGTCCCGTACAAGGTCGAAACAATAGGAGTGATAGGCACA
CCGGGGTCGGGCAAGTCAGCTATTATCAAGTCAACTGTCACGGCACGAGATCTTGTTACCAGCGGAAAGA
AAGAAAATTGTCGCGAAATTGAGGCCGACGTGCTAAGACTGAGGGGTATGCAGATTACGTCGAAGACAGT
AGATTCGGTTATGCTCAACGGATGCCACAAAGCCGTAGAAGTGCTGTACGTTGACGAAGCGTTCGCGTGC
CACGCAGGAGCACTACTTGCCTTGATTGCTATCGTCAGGCCCCGCAAGAAGGTAGTACTATGCGGAGACC
CCATGCAATGCGGATTCTTCAACATGATGCAACTAAAGGTACATTTCAATCACCCTGAAAAAGACATATG
CACCAAGACATTCTACAAGTATATCTCCCGGCGTTGCACACAGCCAGTTACAGCTATTGTATCGACACTG
CATTACGATGGAAAGATGAAAACCACGAACCCGTGCAAGAAGAACATTGAAATCGATATTACAGGGGCCA
CAAAGCCGAAGCCAGGGGATATCATCCTGACATGTTTCCGCGGGTGGGTTAAGCAATTGCAAATCGACTA
TCCCGGACATGAAGTAATGACAGCCGCGGCCTCACAAGGGCTAACCAGAAAAGGAGTGTATGCCGTCCGG
CAAAAAGTCAATGAAAACCCACTGTACGCGATCACATCAGAGCATGTGAACGTGTTGCTCACCCGCACTG
AGGACAGGCTAGTGTGGAAAACCTTGCAGGGCGACCCATGGATTAAGCAGCCCACTAACATACCTAAAGG
AAACTTTCAGGCTACTATAGAGGACTGGGAAGCTGAACACAAGGGAATAATTGCTGCAATAAACAGCCCC
ACTCCCCGTGCCAATCCGTTCAGCTGCAAGACCAACGTTTGCTGGGCGAAAGCATTGGAACCGATACTAG
CCACGGCCGGTATCGTACTTACCGGTTGCCAGTGGAGCGAACTGTTCCCACAGTTTGCGGATGACAAACC
ACATTCGGCCATTTACGCCTTAGACGTAATTTGCATTAAGTTTTTCGGCATGGACTTGACAAGCGGACTG
TTTTCTAAACAGAGCATCCCACTAACGTACCATCCCGCCGATTCAGCGAGGCCGGTAGCTCATTGGGACA
ACAGCCCAGGAACCCGCAAGTATGGGTACGATCACGCCATTGCCGCCGAACTCTCCCGTAGATTTCCGGT
GTTCCAGCTAGCTGGGAAGGGCACACAACTTGATTTGCAGACGGGGAGAACCAGAGTTATCTCTGCACAG
CATAACCTGGTCCCGGTGAACCGCAATCTTCCTCACGCCTTAGTCCCCGAGTACAAGGAGAAGCAACCCG
GCCCGGTCAAAAAATTCTTGAACCAGTTCAAACACCACTCAGTACTTGTGGTATCAGAGGAAAAAATTGA
AGCTCCCCGTAAGAGAATCGAATGGATCGCCCCGATTGGCATAGCCGGTGCAGATAAGAACTACAACCTG
GCTTTCGGGTTTCCGCCGCAGGCACGGTACGACCTGGTGTTCATCAACATTGGAACTAAATACAGAAACC
ACCACTTTCAGCAGTGCGAAGACCATGCGGCGACCTTAAAAACCCTTTCGCGTTCGGCCCTGAATTGCCT
TAACCCAGGAGGCACCCTCGTGGTGAAGTCCTATGGCTACGCCGACCGCAACAGTGAGGACGTAGTCACC
GCTCTTGCCAGAAAGTTTGTCAGGGTGTCTGCAGCGAGACCAGATTGTGTCTCAAGCAATACAGAAATGT
ACCTGATTTTCCGACAACTAGACAACAGCCGTACACGGCAATTCACCCCGCACCATCTGAATTGCGTGAT
TTCGTCCGTGTATGAGGGTACAAGAGATGGAGTTGGAGCCGCGCCGTCATACCGCACCAAAAGGGAGAAT
ATTGCTGACTGTCAAGAGGAAGCAGTTGTCAACGCAGCCAATCCGCTGGGTAGACCAGGCGAAGGAGTCT
GCCGTGCCATCTATAAACGTTGGCCGACCAGTTTTACCGATTCAGCCACGGAGACAGGCACCGCAAGAAT
GACTGTGTGCCTAGGAAAGAAAGTGATCCACGCGGTCGGCCCTGATTTCCGGAAGCACCCAGAAGCAGAA
GCCTTGAAATTGCTACAAAACGCCTACCATGCAGTGGCAGACTTAGTAAATGAACATAACATCAAGTCTG
TCGCCATTCCACTGCTATCTACAGGCATTTACGCAGCCGGAAAAGACCGCCTTGAAGTATCACTTAACTG
CTTGACAACCGCGCTAGACAGAACTGACGCGGACGTAACCATCTATTGCCTGGATAAGAAGTGGAAGGAA
AGAATCGACGCGGCACTCCAACTTAAGGAGTCTGTAACAGAGCTGAAGGATGAAGATATGGAGATCGACG
ATGAGTTAGTATGGATCCATCCAGACAGTTGCTTGAAGGGAAGAAAGGGATTCAGTACTACAAAAGGAAA
ATTGTATTCGTACTTCGAAGGCACCAAATTCCATCAAGCAGCAAAAGACATGGCGGAGATAAAGGTCCTG
TTCCCTAATGACCAGGAAAGTAATGAACAACTGTGTGCCTACATATTGGGTGAGACCATGGAAGCAATCC
GCGAAAAGTGCCCGGTCGACCATAACCCGTCGTCTAGCCCGCCCAAAACGTTGCCGTGCCTTTGCATGTA
TGCCATGACGCCAGAAAGGGTCCACAGACTTAGAAGCAATAACGTCAAAGAAGTTACAGTATGCTCCTCC
ACCCCCCTTCCTAAGCACAAAATTAAGAATGTTCAGAAGGTTCAGTGCACGAAAGTAGTCCTGTTTAATC
CGCACACTCCCGCATTCGTTCCCGCCCGTAAGTACATAGAAGTGCCAGAACAGCCTACCGCTCCTCCTGC
ACAGGCCGAGGAGGCCCCCGAAGTTGTAGCGACACCGTCACCATCTACAGCTGATAACACCTCGCTTGAT
GTCACAGACATCTCACTGGATATGGATGACAGTAGCGAAGGCTCACTTTTTTCGAGCTTTAGCGGATCGG
ACAACTCTATTACTAGTATGGACAGTTGGTCGTCAGGACCTAGTTCACTAGAGATAGTAGACCGAAGGCA
GGTGGTGGTGGCTGACGTTCATGCCGTCCAAGAGCCTGCCCCTATTCCACCGCCAAGGCTAAAGAAGATG
GCCCGCCTGGCAGCGGCAAGAAAAGAGCCCACTCCACCGGCAAGCAATAGCTCTGAGTCCCTCCACCTCT
CTTTTGGTGGGGTATCCATGTCCCTCGGATCAATTTTCGACGGAGAGACGGCCCGCCAGGCAGCGGTACA
ACCCCTGGCAACAGGCCCCACGGATGTGCCTATGTCTTTCGGATCGTTTTCCGACGGAGAGATTGATGAG
CTGAGCCGCAGAGTAACTGAGTCCGAACCCGTCCTGTTTGGATCATTTGAACCGGGCGAAGTGAACTCAA
TTATATCGTCCCGATCAGCCGTATCTTTTCCACTACGCAAGCAGAGACGTAGACGCAGGAGCAGGAGGAC
TGAATACTGACTAACCGGGGTAGGTGGGTACATATTTTCGACGGACACAGGCCCTGGGCACTTGCAAAAG
AAGTCCGTTCTGCAGAACCAGCTTACAGAACCGACCTTGGAGCGCAATGTCCTGGAAAGAATTCATGCCC
CGGTGCTCGACACGTCGAAAGAGGAACAACTCAAACTCAGGTACCAGATGATGCCCACCGAAGCCAACAA
AAGTAGGTACCAGTCTCGTAAAGTAGAAAATCAGAAAGCCATAACCACTGAGCGACTACTGTCAGGACTA
CGACTGTATAACTCTGCCACAGATCAGCCAGAATGCTATAAGATCACCTATCCGAAACCATTGTACTCCA
GTAGCGTACCGGCGAACTACTCCGATCCACAGTTCGCTGTAGCTGTCTGTAACAACTATCTGCATGAGAA
CTATCCGACAGTAGCATCTTATCAGATTACTGACGAGTACGATGCTTACTTGGATATGGTAGACGGGACA
GTCGCCTGCCTGGATACTGCAACCTTCTGCCCCGCTAAGCTTAGAAGTTACCCGAAAAAACATGAGTATA
GAGCCCCGAATATCCGCAGTGCGGTTCCATCAGCGATGCAGAACACGCTACAAAATGTGCTCATTGCCGC
AACTAAAAGAAATTGCAACGTCACGCAGATGCGTGAACTGCCAACACTGGACTCAGCGACATTCAATGTC
GAATGCTTTCGAAAATATGCATGTAATGACGAGTATTGGGAGGAGTTCGCTCGGAAGCCAATTAGGATTA
CCACTGAGTTTGTCACCGCATATGTAGCTAGACTGAAAGGCCCTAAGGCCGCCGCACTATTTGCAAAGAC
GTATAATTTGGTCCCATTGCAAGAAGTGCCTATGGATAGATTCGTCATGGACATGAAAAGAGACGTGAAA
GTTACACCAGGCACGAAACACACAGAAGAAAGACCGAAAGTACAAGTGATACAAGCCGCAGAACCCCTGG
CGACTGCTTACTTATGCGGGATTCACCGGGAATTAGTGCGTAGGCTTACGGCCGTCTTGCTTCCAAACAT
TCACACGCTTTTTGACATGTCGGCGGAGGATTTTGATGCAATCATAGCAGAACACTTCAAGCAAGGCGAC
CCGGTACTGGAGACGGATATCGCATCATTCGACAAAAGCCAAGACGACGCTATGGCGTTAACCGGTCTGA
TGATCTTGGAGGACCTGGGTGTGGATCAACCACTACTCGACTTGATCGAGTGCGCCTTTGGAGAAATATC
ATCCACCCATCTACCTACGGGTACTCGTTTTAAATTCGGGGCGATGATGAAATCCGGAATGTTCCTCACA
CTTTTTGTCAACACAGTTTTGAATGTCGTTATCGCCAGCAGAGTACTAGAAGAGCGGCTTAAAACGTCCA
GATGTGCAGCGTTCATTGGCGACGACAACATCATACATGGAGTAGTATCTGACAAAGAAATGGCTGAGAG
GTGCGCCACCTGGCTCAACATGGAGGTTAAGATCATCGACGCAGTCATCGGTGAGAGACCACCTTACTTC
TGCGGCGGATTTATCTTGCAAGATTCGGTTACTTCCACAGCGTGCCGCGTGGCGGATCCCCTGAAAAGGC
TGTTTAAGTTGGGTAAACCGCTCCCAGCCGACGACGAGCAAGACGAAGACAGAAGACGCGCTCTGCTAGA
TGAAACAAAGGCGTGGTTTAGAGTAGGTATAACAGGCACTTTAGCAGTGGCCGTGACGACCCGGTATGAG
GTAGACAATATTACACCTGTCCTACTGGCATTGAGAACTTTTGCCCAGAGCAAAAGAGCATTCCAAGCCA
TCAGAGGGGAAATAAAGCATCTCTACGGTGGTCCTAAATAGTCAGCATAGTACATTTCATCTGACTAATA
CTACAACACCACCACCATGAATAGAGGATTCTTTAACATGCTCGGCCGCCGCCCCTTCCCGGCCCCCACT
GCCATGTGGAGGCCGCGGAGAAGGAGGCAGGCGGCCCCGATGCCTGCCCGCAACGGGCTGGCTTCTCAAA
TCCAGCAACTGACCACAGCCGTCAGTGCCCTAGTCATTGGACAGGCAACTAGACCTCAACCCCCACGTCC
ACGCCCGCCACCGCGCCAGAAGAAGCAGGCGCCCAAGCAACCACCGAAGCCGAAGAAACCAAAAACGCAG
GAGAAGAAGAAGAAGCAACCTGCAAAACCCAAACCCGGAAAGAGACAGCGCATGGCACTTAAGTTGGAGG
CCGACAGATTGTTCGACGTCAAGAACGAGGACGGAGATGTCATCGGGCACGCACTGGCCATGGAAGGAAA
GGTAATGAAACCTCTGCACGTGAAAGGAACCATCGACCACCCTGTGCTATCAAAGCTCAAATTTACCAAG
TCGTCAGCATACGACATGGAGTTCGCACAGTTGCCAGTCAACATGAGAAGTGAGGCATTCACCTACACCA
GTGAACACCCCGAAGGATTCTATAACTGGCACCACGGAGCGGTGCAGTATAGTGGAGGTAGATTTACCAT
CCCTCGCGGAGTAGGAGGCAGAGGAGACAGCGGTCGTCCGATCATGGATAACTCCGGTCGGGTTGTCGCG
ATAGTCCTCGGTGGCGCTGATGAAGGAACACGAACTGCCCTTTCGGTCGTCACCTGGAATAGTAAAGGGA
AGACAATTAAGACGACCCCGGAAGGGACAGAAGAGTGGTCCGCAGCACCACTGGTCACGGCAATGTGTTT
GCTCGGAAATGTGAGCTTCCCATGCGACCGCCCGCCCACATGCTATACCCGCGAACCTTCCAGAGCCCTC
GACATCCTTGAAGAGAACGTGAACCATGAGGCCTACGATACCCTGCTCAATGCCATATTGCGGTGCGGAT
CGTCTGGCAGAAGCAAAAGAAGCGTCATTGACGACTTTACCCTGACCAGCCCCTACTTGGGCACATGCTC
GTACTGCCACCATACTGTACCGTGCTTCAGCCCTGTTAAGATCGAGCAGGTCTGGGACGAAGCGGACGAT
AACACCATACGCATACAGACTTCCGCCCAGTTTGGATACGACCAAAGCGGAGCAGCAAGCGCAAACAAGT
ACCGCTACATGTCGCTTAAGCAGGATCACACCGTTAAAGAAGGCACCATGGATGACATCAAGATTAGCAC
CTCAGGACCGTGTAGAAGGCTTAGCTACAAAGGATACTTTCTCCTCGCAAAATGCCCTCCAGGGGACAGC
GTAACGGTTAGCATAGTGAGTAGCAACTCAGCAACGTCATGTACACTGGCCCGCAAGATAAAACCAAAAT
TCGTGGGACGGGAAAAATATGATCTACCTCCCGTTCACGGTAAAAAAATTCCTTGCACAGTGTACGACCG
TCTGAAAGAAACAACTGCAGGCTACATCACTATGCACAGGCCGAGACCGCACGCTTATACATCCTACCTG
GAAGAATCATCAGGGAAAGTTTACGCAAAGCCGCCATCTGGGAAGAACATTACGTATGAGTGCAAGTGCG
GCGACTACAAGACCGGAACCGTTTCGACCCGCACCGAAATCACTGGTTGCACCGCCATCAAGCAGTGCGT
CGCCTATAAGAGCGACCAAACGAAGTGGGTCTTCAACTCACCGGACTTGATCAGACATGACGACCACACG
GCCCAAGGGAAATTGCATTTGCCTTTCAAGTTGATCCCGAGTACCTGCATGGTCCCTGTTGCCCACGCGC
CGAATGTAATACATGGCTTTAAACACATCAGCCTCCAATTAGATACAGACCACTTGACATTGCTCACCAC
CAGGAGACTAGGGGCAAACCCGGAACCAACCACTGAATGGATCGTCGGAAAGACGGTCAGAAACTTCACC
GTCGACCGAGATGGCCTGGAATACATATGGGGAAATCATGAGCCAGTGAGGGTCTATGCCCAAGAGTCAG
CACCAGGAGACCCTCACGGATGGCCACACGAAATAGTACAGCATTACTACCATCGCCATCCTGTGTACAC
CATCTTAGCCGTCGCATCAGCTACCGTGGCGATGATGATTGGCGTAACTGTTGCAGTGTTATGTGCCTGT
AAAGCGCGCCGTGAGTGCCTGACGCCATACGCCCTGGCCCCAAACGCCGTAATCCCAACTTCGCTGGCAC
TCTTGTGCTGCGTTAGGTCGGCCAATGCTGAAACGTTCACCGAGACCATGAGTTACTTGTGGTCGAACAG
TCAGCCGTTCTTCTGGGTCCAGTTGTGCATACCTTTGGCCGCTTTCATCGTTCTAATGCGCTGCTGCTCC
TGCTGCCTGCCTTTTTTAGTGGTTGCCGGCGCCTACCTGGCGAAGGTAGACGCCTACGAACATGCGACCA
CTGTTCCAAATGTGCCACAGATACCGTATAAGGCACTTGTTGAAAGGGCAGGGTATGCCCCGCTCAATTT
GGAGATCACTGTCATGTCCTCGGAGGTTTTGCCTTCCACCAACCAAGAGTACATTACCTGCAAATTCACC
ACTGTGGTCCCCTCCCCAAAAATCAAATGCTGCGGCTCCTTGGAATGTCAGCCGGCCGCTCATGCAGACT
ATACCTGCAAGGTCTTCGGAGGGGTCTACCCCTTTATGTGGGGAGGAGCGCAATGTTTTTGCGACAGTGA
GAACAGCCAGATGAGTGAGGCGTACGTCGAATTGTCAGCAGATTGCGCGTCTGACCACGCGCAGGCGATT
AAGGTGCACACTGCCGCGATGAAAGTAGGACTGCGTATTGTGTACGGGAACACTACCAGTTTCCTAGATG
TGTACGTGAACGGAGTCACACCAGGAACGTCTAAAGACTTGAAAGTCATAGCTGGACCAATTTCAGCATC
GTTTACGCCATTCGATCATAAGGTCGTTATCCATCGCGGCCTGGTGTACAACTATGACTTCCCGGAATAT
GGAGCGATGAAACCAGGAGCGTTTGGAGACATTCAAGCTACCTCCTTGACTAGCAAGGATCTCATCGCCA
GCACAGACATTAGGCTACTCAAGCCTTCCGCCAAGAACGTGCATGTCCCGTACACGCAGGCCTCATCAGG
ATTTGAGATGTGGAAAAACAACTCAGGCCGCCCACTGCAGGAAACCGCACCTTTCGGGTGTAAGATTGCA
GTAAATCCGCTCCGAGCGGTGGACTGTTCATACGGGAACATTCCCATTTCTATTGACATCCCGAACGCTG
CCTTTATCAGGACATCAGATGCACCACTGGTCTCAACAGTCAAATGTGAAGTCAGTGAGTGCACTTATTC
AGCAGACTTCGGCGGGATGGCCACCCTGCAGTATGTATCCGACCGCGAAGGTCAATGCCCCGTACATTCG
CATTCGAGCACAGCAACTCTCCAAGAGTCGACAGTACATGTCCTGGAGAAAGGAGCGGTGACAGTACACT
TTAGCACCGCGAGTCCACAGGCGAACTTTATCGTATCGCTGTGTGGGAAGAAGACAACATGCAATGCAGA
ATGTAAACCACCAGCTGACCATATCGTGAGCACCCCGCACAAAAATGACCAAGAATTTCAAGCCGCCATC
TCAAAAACATCATGGAGTTGGCTGTTTGCCCTTTTCGGCGGCGCCTCGTCGCTATTAATTATAGGACTTA
TGATTTTTGCTTGCAGCATGATGCTGACTAGCACACGAAGATGACCGCTACGCCCCAATGATCCGACCAG
CAAAACTCGATGTACTTCCGAGGAACTGATGTGCATAATGCATCAGGCTGGTACATTAGATCCCCGCTTA
CCGCGGGCAATATAGCAACACTAAAAACTCGATGTACTTCCGAGGAAGCGCAGTGCATAATGCTGCGCAG
TGTTGCCACATAACCACTATATTAACCATTTATCTAGCGGACGCCAAAAACTCAATGTATTTCTGAGGAA
GCGTGGTGCATAATGCCACGCAGCGTCTGCATAACTTTTATTATTTCTTTTATTAATCAACAAAATTTTG
TTTTTAACATTTC
Click to Show/Hide
|