Home
Search 
BLAST
Manual
DownloadDetails of Virus RNA
| Strain Information | Strain Name |
Dengue virus 2 (strain 16681)
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Flaviviridae
|
||||||||
| RNA Binding Site |
5'UTR - 3'UTR
|
||||||||
| Virus Information | Virus Name |
Dengue virus 2 (DENV2)
|
|||||||
| Taxonomy ID | 11060 | ||||||||
Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 14-3-3 protein beta/alpha | P31946 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 7.15 | . |
| 14-3-3 protein beta/alpha | P31946 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| 14-3-3 protein epsilon | P62258 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.98 | . |
| 14-3-3 protein epsilon | P62258 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| 14-3-3 protein gamma | P61981 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.06 | . |
| 14-3-3 protein gamma | P61981 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| 14-3-3 protein zeta/delta | P63104 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.79 | . |
| 14-3-3 protein zeta/delta | P63104 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| 140 kDa Ser/Arg-rich domain protein | O15042 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 140 kDa Ser/Arg-rich domain protein | O15042 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.53 | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| 26S proteasome regulatory subunit 6B | P43686 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.82 | . |
| 26S proteasome regulatory subunit 6B | P43686 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| 3'-5' RNA helicase YTHDC2 | Q9H6S0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 3'-5' RNA helicase YTHDC2 | Q9H6S0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S10 | P46783 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S10 | P46783 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S13 | P62277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S13 | P62277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S17 | P08708 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S17 | P08708 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S18 | P62269 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S18 | P62269 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S19 | P39019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S19 | P39019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S3 | E9PL09 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S3 | E9PL09 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S4 | P62701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S4 | P62701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S7 | P62081 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S7 | P62081 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 4F2 cell-surface antigen heavy chain | P08195 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 4.14 | . |
| 4F2 cell-surface antigen heavy chain | P08195 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 6-phosphogluconate dehydrogenase | P52209 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 6-phosphogluconate dehydrogenase | P52209 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.66 | . |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L10a | P62906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L10a | P62906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L19 | P84098 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L19 | P84098 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L21 | P46778 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L21 | P46778 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L23a | P62750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L23a | P62750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L27 | P61353 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L27 | P61353 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 7-dehydrocholesterol reductase | Q9UBM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| 7-dehydrocholesterol reductase | Q9UBM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| A-kinase anchor protein 8 | O43823 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| A-kinase anchor protein 8 | O43823 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| A-kinase anchor protein 8-like | Q9ULX6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| A-kinase anchor protein 8-like | Q9ULX6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.33 | . |
| Abasic site processing protein HMCES | Q96FZ2 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.26 | . |
| Abasic site processing protein HMCES | Q96FZ2 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Acetyl-CoA acetyltransferase | Q9BWD1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Acetyl-CoA acetyltransferase | Q9BWD1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.98 | . |
| Acyl-CoA 6-desaturase | O95864 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Acyl-CoA 6-desaturase | O95864 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Alanine--tRNA ligase | P49588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Alanine--tRNA ligase | P49588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.34 | . |
| Annexin A4 | P09525 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Annexin A4 | P09525 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Annexin A6 | P08133 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Annexin A6 | P08133 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| APOBEC1 complementation factor | Q9NQ94 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| APOBEC1 complementation factor | Q9NQ94 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Apolipoprotein B-100 | P04114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Apolipoprotein B-100 | P04114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Apoptosis inhibitor 5 | Q9BZZ5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Apoptosis inhibitor 5 | Q9BZZ5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Apoptotic chromatin condensation inducer in the nucleus | Q9UKV3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Apoptotic chromatin condensation inducer in the nucleus | Q9UKV3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| ASF/SF2-associated protein p32 | Q07021 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.36 | . |
| ASF/SF2-associated protein p32 | Q07021 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP synthase subunit beta | P06576 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.41 | . |
| ATP synthase subunit beta | P06576 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| ATP-binding cassette sub-family E member 1 | P61221 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-binding cassette sub-family E member 1 | P61221 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent DNA/RNA helicase DHX36 | Q9H2U1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent DNA/RNA helicase DHX36 | Q9H2U1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.72 | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DDX19A | Q9NUU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DDX19A | Q9NUU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DDX3X | O00571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DDX3X | O00571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DDX42 | Q86XP3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DDX42 | Q86XP3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| ATP-dependent RNA helicase DHX15 | O43143 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DHX15 | O43143 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DHX29 | Q7Z478 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ATP-dependent RNA helicase DHX29 | Q7Z478 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Barrier-to-autointegration factor | O75531 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.73 | . |
| Barrier-to-autointegration factor | O75531 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Bcl-2-associated transcription factor 1 | Q9NYF8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Bcl-2-associated transcription factor 1 | Q9NYF8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.99 | . |
| Bifunctional purine biosynthesis protein ATIC | P31939 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Bifunctional purine biosynthesis protein ATIC | P31939 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| BRR2 homolog | O75643 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| BRR2 homolog | O75643 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Butyrate-induced protein 1 | Q9P035 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Butyrate-induced protein 1 | Q9P035 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 4.33 | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Calreticulin | P27797 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 4.51 | . |
| Calreticulin | P27797 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Caprin-1 | Q14444 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Caprin-1 | Q14444 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Caspase-14 | P31944 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.83 | . |
| Caspase-14 | P31944 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Catalase | P04040 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.43 | . |
| Catalase | P04040 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Catenin beta-1 | P35222 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.59 | . |
| Catenin beta-1 | P35222 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Cathepsin Z | Q9UBR2 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.81 | . |
| Cathepsin Z | Q9UBR2 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| CCR4-NOT transcription complex subunit 1 | A5YKK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CCR4-NOT transcription complex subunit 1 | A5YKK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CDKN2AIP N-terminal-like protein | Q96HQ2 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.53 | . |
| CDKN2AIP N-terminal-like protein | Q96HQ2 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Cell cycle and apoptosis regulator protein 2 | Q8N163 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cell cycle and apoptosis regulator protein 2 | Q8N163 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cell division cycle 5-like protein | Q99459 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cell division cycle 5-like protein | Q99459 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Chloride intracellular channel protein 1 | O00299 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Chloride intracellular channel protein 1 | O00299 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.96 | . |
| Chromatin target of PRMT1 protein | Q9Y3Y2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Chromatin target of PRMT1 protein | Q9Y3Y2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Chromobox protein homolog 1 | P83916 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.93 | . |
| Chromobox protein homolog 1 | P83916 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Chromobox protein homolog 3 | Q13185 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.91 | . |
| Chromobox protein homolog 3 | Q13185 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Chromodomain-helicase-DNA-binding protein 4 | Q14839 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Chromodomain-helicase-DNA-binding protein 4 | Q14839 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| CLE7 homolog | Q9Y224 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CLE7 homolog | Q9Y224 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cleavage stimulation factor subunit 3 | Q12996 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cleavage stimulation factor subunit 3 | Q12996 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Clusterin | P10909 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.02 | . |
| Clusterin | P10909 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Coatomer subunit alpha | P53621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Coatomer subunit alpha | P53621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Coatomer subunit beta | P53618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Coatomer subunit beta | P53618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Coatomer subunit beta' | P35606 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Coatomer subunit beta' | P35606 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Coatomer subunit epsilon | O14579 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.7 | . |
| Coatomer subunit epsilon | O14579 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Coatomer subunit gamma-1 | Q9Y678 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Coatomer subunit gamma-1 | Q9Y678 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Copine-1 | Q99829 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Copine-1 | Q99829 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CPSF 100 kDa subunit | Q9P2I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CPSF 100 kDa subunit | Q9P2I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| CPSF 25 kDa subunit | O43809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CPSF 25 kDa subunit | O43809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CPSF 59 kDa subunit | Q8N684 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CPSF 59 kDa subunit | Q8N684 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CPSF 68 kDa subunit | Q16630 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CPSF 68 kDa subunit | Q16630 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CUGBP Elav-like family member 1 | Q92879 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| CUGBP Elav-like family member 1 | Q92879 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cullin-associated NEDD8-dissociated protein 1 | Q86VP6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cullin-associated NEDD8-dissociated protein 1 | Q86VP6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cyclin-dependent kinase 1 | P06493 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cyclin-dependent kinase 1 | P06493 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cytoskeleton-associated protein 4 | Q07065 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cytoskeleton-associated protein 4 | Q07065 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cytoskeleton-associated protein 5 | Q14008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Cytoskeleton-associated protein 5 | Q14008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DAZ-associated protein 1 | Q96EP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DAZ-associated protein 1 | Q96EP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DBIRD complex subunit ZNF326 | Q5BKZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DBIRD complex subunit ZNF326 | Q5BKZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DDOST 48 kDa subunit | P39656 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DDOST 48 kDa subunit | P39656 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Death inducer with SAP domain | Q8IX12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Death inducer with SAP domain | Q8IX12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Delta(24)-sterol reductase | Q15392 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Delta(24)-sterol reductase | Q15392 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Deubiquitinating enzyme FAF-X | Q93008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Deubiquitinating enzyme FAF-X | Q93008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Developmentally-regulated GTP-binding protein 1 | Q9Y295 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Developmentally-regulated GTP-binding protein 1 | Q9Y295 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Dipeptidyl peptidase 1 | P53634 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.66 | . |
| Dipeptidyl peptidase 1 | P53634 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Dipeptidyl peptidase 4 | P27487 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.51 | . |
| Dipeptidyl peptidase 4 | P27487 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| DNA ligase 3 | P49916 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA ligase 3 | P49916 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| DNA mismatch repair protein Msh6 | P52701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA mismatch repair protein Msh6 | P52701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| DNA replication licensing factor MCM2 | P49736 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA replication licensing factor MCM2 | P49736 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA replication licensing factor MCM3 | P25205 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA replication licensing factor MCM3 | P25205 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| DNA replication licensing factor MCM5 | P33992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA replication licensing factor MCM5 | P33992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA replication licensing factor MCM6 | Q14566 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA replication licensing factor MCM6 | Q14566 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA replication licensing factor MCM7 | P33993 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA replication licensing factor MCM7 | P33993 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.84 | . |
| DNA topoisomerase 1 | P11387 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.67 | . |
| DNA topoisomerase 1 | P11387 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| DNA topoisomerase 2-alpha | P11388 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA topoisomerase 2-alpha | P11388 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA topoisomerase 2-beta | Q02880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA topoisomerase 2-beta | Q02880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| DNA topoisomerase 3-beta-1 | O95985 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA topoisomerase 3-beta-1 | O95985 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA-directed RNA polymerase II subunit RPB1 | P24928 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA-directed RNA polymerase II subunit RPB1 | P24928 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| DNA-directed RNA polymerase II subunit RPB2 | P30876 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| DNA-directed RNA polymerase II subunit RPB2 | P30876 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| DNA-directed RNA polymerase II subunit RPB3 | P19387 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 5.39 | . |
| DNA-directed RNA polymerase II subunit RPB3 | P19387 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| DNA-directed RNA polymerases I | P52434 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.38 | . |
| DNA-directed RNA polymerases I | P52434 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Double-stranded RNA-binding protein Staufen homolog 1 | O95793 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Double-stranded RNA-binding protein Staufen homolog 1 | O95793 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| E3 ubiquitin-protein ligase TRIM56 | Q9BRZ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| E3 ubiquitin-protein ligase TRIM56 | Q9BRZ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| E3 ubiquitin-protein ligase TRIM71 | Q2Q1W2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| E3 ubiquitin-protein ligase TRIM71 | Q2Q1W2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| E3 ubiquitin-protein ligase UBR4 | Q5T4S7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| E3 ubiquitin-protein ligase UBR4 | Q5T4S7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| E3 ubiquitin/ISG15 ligase TRIM25 | Q14258 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| E3 ubiquitin/ISG15 ligase TRIM25 | Q14258 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF-2-alpha kinase activator GCN1 | Q92616 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF-2-alpha kinase activator GCN1 | Q92616 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF-4-gamma 2 | P78344 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF-4-gamma 2 | P78344 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3a | Q14152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3a | Q14152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3b | P55884 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3b | P55884 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3c | Q99613 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3c | Q99613 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3d | O15371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3d | O15371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3f | O00303 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3f | O00303 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3g | O75821 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3g | O75821 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3i | Q13347 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.88 | . |
| eIF3i | Q13347 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| eIF3l | Q9Y262 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eIF3l | Q9Y262 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ELAV-like protein 1 | Q15717 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ELAV-like protein 1 | Q15717 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Elongation factor 1-alpha 1 | P68104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Elongation factor 1-alpha 1 | P68104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Elongation factor 1-delta | P29692 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.24 | . |
| Elongation factor 1-delta | P29692 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Elongation factor 1-delta | P29692 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Elongation factor 1-delta | P29692 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.98 | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Endoplasmin | P14625 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.92 | . |
| Endoplasmin | P14625 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Enhancer of mRNA-decapping protein 4 | Q6P2E9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Enhancer of mRNA-decapping protein 4 | Q6P2E9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Enhancer of rudimentary homolog | P84090 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.5 | . |
| Enhancer of rudimentary homolog | P84090 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| eRF3a | P15170 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| eRF3a | P15170 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| ERPROT 213-21 | Q8IWX8 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.38 | . |
| ERPROT 213-21 | Q8IWX8 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.25 | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic initiation factor 4A-III | P38919 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.25 | . |
| Eukaryotic initiation factor 4A-III | P38919 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Eukaryotic initiation factor 4A-III | P38919 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic initiation factor 4A-III | P38919 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic release factor 1 | P62495 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic release factor 1 | P62495 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic translation initiation factor 3 subunit C-like protein | B5ME19 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic translation initiation factor 3 subunit C-like protein | B5ME19 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic translation initiation factor 5A-1 | P63241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic translation initiation factor 5A-1 | P63241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic translation initiation factor 5B | O60841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic translation initiation factor 5B | O60841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Eukaryotic translation initiation factor 6 | P56537 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.76 | . |
| Eukaryotic translation initiation factor 6 | P56537 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Exosome complex exonuclease RRP44 | Q9Y2L1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Exosome complex exonuclease RRP44 | Q9Y2L1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Exosome RNA helicase MTR4 | P42285 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Exosome RNA helicase MTR4 | P42285 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Exportin-1 | O14980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Exportin-1 | O14980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Exportin-2 | P55060 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Exportin-2 | P55060 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Extended synaptotagmin-1 | Q9BSJ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Extended synaptotagmin-1 | Q9BSJ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ezrin | P15311 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ezrin | P15311 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| FACT complex subunit SPT16 | Q9Y5B9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| FACT complex subunit SPT16 | Q9Y5B9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Factor for adipocyte differentiation 104 | Q53EP0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Factor for adipocyte differentiation 104 | Q53EP0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Far upstream element-binding protein 1 | Q96AE4 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.78 | . |
| Far upstream element-binding protein 1 | Q96AE4 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Far upstream element-binding protein 1 | Q96AE4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Far upstream element-binding protein 1 | Q96AE4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.75 | . |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Far upstream element-binding protein 3 | Q96I24 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Far upstream element-binding protein 3 | Q96I24 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Fascin | Q16658 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Fascin | Q16658 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Fatty acid CoA ligase Acsl3 | O95573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Fatty acid CoA ligase Acsl3 | O95573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.99 | . |
| Flap endonuclease 1 | P39748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Flap endonuclease 1 | P39748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| FMR1-interacting protein NUFIP2 | Q7Z417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| FMR1-interacting protein NUFIP2 | Q7Z417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Fragile X mental retardation 1 | G3V0J0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Fragile X mental retardation 1 | G3V0J0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Gamma-glutamylcyclotransferase | O75223 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.92 | . |
| Gamma-glutamylcyclotransferase | O75223 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| GAP-associated tyrosine phosphoprotein p62 | Q07666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| GAP-associated tyrosine phosphoprotein p62 | Q07666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Gem-associated protein 5 | Q8TEQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Gem-associated protein 5 | Q8TEQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| General transcription factor II-I | P78347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| General transcription factor II-I | P78347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Glucose-6-phosphate isomerase | P06744 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Glucose-6-phosphate isomerase | P06744 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.16 | . |
| Glutamate-rich WD repeat-containing protein 1 | Q9BQ67 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.29 | . |
| Glutamate-rich WD repeat-containing protein 1 | Q9BQ67 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Glutamine--tRNA ligase | P47897 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Glutamine--tRNA ligase | P47897 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Glutathione S-transferase P | P09211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Glutathione S-transferase P | P09211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.69 | . |
| Glycogen debranching enzyme | P35573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Glycogen debranching enzyme | P35573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| GRB10-interacting GYF protein 2 | Q6Y7W6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| GRB10-interacting GYF protein 2 | Q6Y7W6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| HCLS1-associated protein X-1 | O00165 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.6 | . |
| HCLS1-associated protein X-1 | O00165 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Heat shock 70 kDa protein 1B | P0DMV9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heat shock 70 kDa protein 1B | P0DMV9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.56 | . |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.59 | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Heat shock protein 105 kDa | Q92598 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heat shock protein 105 kDa | Q92598 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heat shock protein beta-1 | P04792 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.32 | . |
| Heat shock protein beta-1 | P04792 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.97 | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Heat shock protein HSP 90-beta | P08238 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.1 | . |
| Heat shock protein HSP 90-beta | P08238 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Helicase with zinc finger | J3QS41 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Helicase with zinc finger | J3QS41 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Helix-destabilizing protein | F8W6I7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Helix-destabilizing protein | F8W6I7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Hematopoietic PBX-interacting protein | Q96AQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Hematopoietic PBX-interacting protein | Q96AQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Hepatoma-derived growth factor | P51858 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Hepatoma-derived growth factor | P51858 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Heterogeneous nuclear ribonucleoprotein A/B | Q99729 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein A/B | Q99729 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.27 | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein D-like | O14979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein D-like | O14979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein D0 | Q14103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein D0 | Q14103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein F | P52597 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.84 | . |
| Heterogeneous nuclear ribonucleoprotein F | P52597 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Heterogeneous nuclear ribonucleoprotein F | P52597 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein F | P52597 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.41 | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein H2 | P55795 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein H2 | P55795 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein H3 | P31942 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein H3 | P31942 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.35 | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.52 | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.89 | . |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein R | O43390 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein R | O43390 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| High mobility group protein B1 | P09429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| High mobility group protein B1 | P09429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Histone-binding protein RBBP4 | Q09028 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.22 | . |
| Histone-binding protein RBBP4 | Q09028 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Histone-binding protein RBBP7 | Q16576 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.09 | . |
| Histone-binding protein RBBP7 | Q16576 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| HTH La-type RNA-binding protein | A0A087WTL9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| HTH La-type RNA-binding protein | A0A087WTL9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| hTom22 | Q9NS69 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.84 | . |
| hTom22 | Q9NS69 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Human gene expressed in odontoblasts | Q9Y2H6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Human gene expressed in odontoblasts | Q9Y2H6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| IGF2 mRNA-binding protein 1 | Q9NZI8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| IGF2 mRNA-binding protein 1 | Q9NZI8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| IGF2 mRNA-binding protein 2 | Q9Y6M1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| IGF2 mRNA-binding protein 2 | Q9Y6M1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| IGF2 mRNA-binding protein 3 | O00425 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| IGF2 mRNA-binding protein 3 | O00425 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Importin subunit alpha-1 | P52292 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Importin subunit alpha-1 | P52292 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.99 | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.99 | . |
| Importin-5 | O00410 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Importin-5 | O00410 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Interferon-inducible protein 4 | P55265 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Interferon-inducible protein 4 | P55265 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Interleukin enhancer-binding factor 2 | Q12905 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.17 | . |
| Interleukin enhancer-binding factor 2 | Q12905 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Interleukin enhancer-binding factor 2 | Q12905 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Interleukin enhancer-binding factor 2 | Q12905 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.81 | . |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Isocitrate dehydrogenase [NADP] cytoplasmic | O75874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Isocitrate dehydrogenase [NADP] cytoplasmic | O75874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Keratin | P02538 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Keratin | P02538 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| KH domain-containing RNA-binding protein QKI | Q96PU8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| KH domain-containing RNA-binding protein QKI | Q96PU8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Kinectin | Q86UP2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Kinectin | Q86UP2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Kinesin-1 heavy chain | P33176 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Kinesin-1 heavy chain | P33176 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.99 | . |
| Kinesin-like protein KIF1C | O43896 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Kinesin-like protein KIF1C | O43896 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| L-lactate dehydrogenase A chain | P00338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| L-lactate dehydrogenase A chain | P00338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.41 | . |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| La-related protein 4B | Q92615 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| La-related protein 4B | Q92615 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Lamin-B2 | Q03252 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 5.36 | . |
| Lamin-B2 | Q03252 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Lamina-associated polypeptide 2 | P42166 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Lamina-associated polypeptide 2 | P42166 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Laminin subunit gamma-1 | P11047 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.67 | . |
| Laminin subunit gamma-1 | P11047 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Leucine-rich repeat-containing protein 47 | Q8N1G4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Leucine-rich repeat-containing protein 47 | Q8N1G4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Leucine-rich repeat-containing protein 59 | Q96AG4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Leucine-rich repeat-containing protein 59 | Q96AG4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| LINE-1 retrotransposable element ORF1 protein | Q9UN81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| LINE-1 retrotransposable element ORF1 protein | Q9UN81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Long-chain-fatty-acid--CoA ligase 4 | O60488 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Long-chain-fatty-acid--CoA ligase 4 | O60488 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Luc7-like protein 3 | O95232 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Luc7-like protein 3 | O95232 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.37 | . |
| Magnesium transporter protein 1 | Q9H0U3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Magnesium transporter protein 1 | Q9H0U3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| MAP activator with WD repeats | Q9Y3F4 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.74 | . |
| MAP activator with WD repeats | Q9Y3F4 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| MAP activator with WD repeats | Q9Y3F4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| MAP activator with WD repeats | Q9Y3F4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.57 | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Methionine--tRNA ligase | P56192 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Methionine--tRNA ligase | P56192 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Microsomal triglyceride transfer protein large subunit | P55157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Microsomal triglyceride transfer protein large subunit | P55157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Microtubule-associated protein | E7EVA0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Microtubule-associated protein | E7EVA0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Midasin | Q9NU22 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Midasin | Q9NU22 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| mRNA cap guanine-N7 methyltransferase | O43148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| mRNA cap guanine-N7 methyltransferase | O43148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.17 | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Myosin-10 | P35580 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Myosin-10 | P35580 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.71 | . |
| NADPH--cytochrome P450 reductase | P16435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| NADPH--cytochrome P450 reductase | P16435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Neutral alpha-glucosidase AB | Q14697 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Neutral alpha-glucosidase AB | Q14697 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Neutral amino acid transporter B(0) | Q15758 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.99 | . |
| Neutral amino acid transporter B(0) | Q15758 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.84 | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nuclear receptor coactivator 5 | Q9HCD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nuclear receptor coactivator 5 | Q9HCD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Nuclear RNA export factor 1 | Q9UBU9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nuclear RNA export factor 1 | Q9UBU9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.67 | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleolysin TIA-1 isoform p40 | P31483 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleolysin TIA-1 isoform p40 | P31483 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleolysin TIAR | Q01085 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleolysin TIAR | Q01085 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.29 | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleoprotein TPR | P12270 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleoprotein TPR | P12270 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Nucleoside diphosphate kinase | Q32Q12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleoside diphosphate kinase | Q32Q12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Nucleosome assembly protein 1-like 1 | P55209 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.99 | . |
| Nucleosome assembly protein 1-like 1 | P55209 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Nucleosome assembly protein 1-like 1 | P55209 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Nucleosome assembly protein 1-like 1 | P55209 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Obg-like ATPase 1 | Q9NTK5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Obg-like ATPase 1 | Q9NTK5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Oligosaccharyl transferase subunit STT3A | P46977 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Oligosaccharyl transferase subunit STT3A | P46977 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Oligosaccharyl transferase subunit STT3B | Q8TCJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Oligosaccharyl transferase subunit STT3B | Q8TCJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Oxidative stress-associated Src activator | Q9NZB2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Oxidative stress-associated Src activator | Q9NZB2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| P0DN76 | P0DN76 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| P0DN76 | P0DN76 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| p59scr | Q86XZ4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| p59scr | Q86XZ4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Paraspeckle component 1 | Q8WXF1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Paraspeckle component 1 | Q8WXF1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| PDZ and LIM domain protein 5 | Q96HC4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| PDZ and LIM domain protein 5 | Q96HC4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Peptidyl-prolyl cis-trans isomerase A | P62937 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Peptidyl-prolyl cis-trans isomerase A | P62937 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.99 | . |
| Peptidyl-prolyl cis-trans isomerase B | P23284 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Peptidyl-prolyl cis-trans isomerase B | P23284 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Peptidyl-prolyl cis-trans isomerase FKBP11 | Q9NYL4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Peptidyl-prolyl cis-trans isomerase FKBP11 | Q9NYL4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Peptidyl-prolyl cis-trans isomerase-like 4 | Q8WUA2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Peptidyl-prolyl cis-trans isomerase-like 4 | Q8WUA2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.99 | . |
| Phosphoglycerate mutase 1 | P18669 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Phosphoglycerate mutase 1 | P18669 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pinin | Q9H307 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pinin | Q9H307 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Poly(rC)-binding protein 1 | Q15365 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.91 | . |
| Poly(rC)-binding protein 1 | Q15365 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Poly(rC)-binding protein 2 | Q15366 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Poly(rC)-binding protein 2 | Q15366 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Poly(U)-binding-splicing factor | Q9UHX1 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.93 | . |
| Poly(U)-binding-splicing factor | Q9UHX1 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Poly(U)-binding-splicing factor | Q9UHX1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Poly(U)-binding-splicing factor | Q9UHX1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.37 | . |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polyadenylate-binding protein 2 | Q86U42 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polyadenylate-binding protein 2 | Q86U42 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polyadenylate-binding protein 4 | Q13310 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polyadenylate-binding protein 4 | Q13310 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polymerase delta-interacting protein 3 | Q9BY77 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polymerase delta-interacting protein 3 | Q9BY77 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.79 | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polypyrimidine tract-binding protein 3 | O95758 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Polypyrimidine tract-binding protein 3 | O95758 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| PP-1A | P62136 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| PP-1A | P62136 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| pre-mRNA 3' end processing protein WDR33 | Q9C0J8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| pre-mRNA 3' end processing protein WDR33 | Q9C0J8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Pre-mRNA 3'-end-processing factor FIP1 | Q6UN15 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.7 | . |
| Pre-mRNA 3'-end-processing factor FIP1 | Q6UN15 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Pre-mRNA 3'-end-processing factor FIP1 | Q6UN15 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pre-mRNA 3'-end-processing factor FIP1 | Q6UN15 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.62 | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pre-mRNA-processing factor 40 homolog A | O75400 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pre-mRNA-processing factor 40 homolog A | O75400 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pre-mRNA-processing factor 6 | O94906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pre-mRNA-processing factor 6 | O94906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pre-mRNA-splicing factor SPF27 | O75934 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.49 | . |
| Pre-mRNA-splicing factor SPF27 | O75934 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Prelamin-A/C | P02545 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 4.36 | . |
| Prelamin-A/C | P02545 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Probable ATP-dependent RNA helicase DDX20 | Q9UHI6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Probable ATP-dependent RNA helicase DDX20 | Q9UHI6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Probable ATP-dependent RNA helicase DDX23 | Q9BUQ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Probable ATP-dependent RNA helicase DDX23 | Q9BUQ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Probable ATP-dependent RNA helicase DDX46 | Q7L014 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Probable ATP-dependent RNA helicase DDX46 | Q7L014 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Probable ATP-dependent RNA helicase DDX5 | J3KTA4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Probable ATP-dependent RNA helicase DDX5 | J3KTA4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Probable ATP-dependent RNA helicase DDX6 | P26196 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Probable ATP-dependent RNA helicase DDX6 | P26196 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Probable global transcription activator SNF2L1 | P28370 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Probable global transcription activator SNF2L1 | P28370 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.71 | . |
| Programmed cell death 6-interacting protein | Q8WUM4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Programmed cell death 6-interacting protein | Q8WUM4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Proliferating cell nuclear antigen | P12004 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.76 | . |
| Proliferating cell nuclear antigen | P12004 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Proteasome subunit alpha type-5 | P28066 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.19 | . |
| Proteasome subunit alpha type-5 | P28066 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Protein arginine N-methyltransferase 1 | Q99873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein arginine N-methyltransferase 1 | Q99873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein argonaute-2 | Q9UKV8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein argonaute-2 | Q9UKV8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein disulfide-isomerase | P07237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein disulfide-isomerase | P07237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein disulfide-isomerase A3 | P30101 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein disulfide-isomerase A3 | P30101 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein disulfide-isomerase A4 | P13667 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein disulfide-isomerase A4 | P13667 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein disulfide-isomerase A6 | Q15084 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein disulfide-isomerase A6 | Q15084 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein FAM98A | Q8NCA5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein FAM98A | Q8NCA5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein lin-28 homolog B | Q6ZN17 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein lin-28 homolog B | Q6ZN17 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein LSM12 | Q3MHD2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein LSM12 | Q3MHD2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein LSM14 homolog A | Q8ND56 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein LSM14 homolog A | Q8ND56 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein LSM14 homolog B | Q9BX40 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein LSM14 homolog B | Q9BX40 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein mago nashi homolog | P61326 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.9 | . |
| Protein mago nashi homolog | P61326 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Protein PRRC2A | P48634 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein PRRC2A | P48634 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein PRRC2C | Q9Y520 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein PRRC2C | Q9Y520 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein SON | P18583 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein SON | P18583 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.66 | . |
| Protein TRAM1 | Q15629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein TRAM1 | Q15629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein transport protein Sec24C | P53992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein transport protein Sec24C | P53992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein transport protein Sec61 subunit beta | P60468 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein transport protein Sec61 subunit beta | P60468 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Protein-glutamine gamma-glutamyltransferase E | Q08188 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.28 | . |
| Protein-glutamine gamma-glutamyltransferase E | Q08188 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Pumilio homolog 1 | Q14671 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pumilio homolog 1 | Q14671 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pumilio homolog 2 | Q8TB72 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Pumilio homolog 2 | Q8TB72 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Putative ATP-dependent RNA helicase DHX57 | Q6P158 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Putative ATP-dependent RNA helicase DHX57 | Q6P158 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Putative RNA-binding protein Luc7-like 2 | Q9Y383 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Putative RNA-binding protein Luc7-like 2 | Q9Y383 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Rab GDP dissociation inhibitor beta | P50395 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Rab GDP dissociation inhibitor beta | P50395 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Radixin | P35241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Radixin | P35241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ran-specific GTPase-activating protein | P43487 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ran-specific GTPase-activating protein | P43487 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.98 | . |
| Ras GTPase-activating protein-binding protein 1 | Q13283 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ras GTPase-activating protein-binding protein 1 | Q13283 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ras GTPase-activating protein-binding protein 2 | Q9UN86 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ras GTPase-activating protein-binding protein 2 | Q9UN86 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ras-related protein Rab-1A | P62820 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ras-related protein Rab-1A | P62820 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ras-related protein Rab-1B | Q9H0U4 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.39 | . |
| Ras-related protein Rab-1B | Q9H0U4 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Ras-related protein Rab-1B | Q9H0U4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ras-related protein Rab-1B | Q9H0U4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ras-related protein Rab-7a | P51149 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ras-related protein Rab-7a | P51149 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Retrotransposon-derived protein PEG10 | Q86TG7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Retrotransposon-derived protein PEG10 | Q86TG7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Rho GTPase-activating protein 5 | Q13017 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Rho GTPase-activating protein 5 | Q13017 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RIBIIR | P04844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RIBIIR | P04844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ribonuclease inhibitor | P13489 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 46.57 | . |
| Ribonuclease inhibitor | P13489 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Ribonucleoprotein | E9PAU2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ribonucleoprotein | E9PAU2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ribosomal protein S6 kinase alpha-3 | P51812 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ribosomal protein S6 kinase alpha-3 | P51812 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ribosome biogenesis protein WDR12 | Q9GZL7 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.83 | . |
| Ribosome biogenesis protein WDR12 | Q9GZL7 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| RNA helicase aquarius | O60306 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA helicase aquarius | O60306 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| RNA polymerase II-associated factor 1 homolog | Q8N7H5 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.27 | . |
| RNA polymerase II-associated factor 1 homolog | Q8N7H5 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.32 | . |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 10 | A0A0A0MR66 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 10 | A0A0A0MR66 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.67 | . |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 12B | Q8IXT5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 12B | Q8IXT5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 15 | Q96T37 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 15 | Q96T37 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| RNA-binding protein 25 | P49756 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 25 | P49756 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 4 | Q9BWF3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 4 | Q9BWF3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 47 | A0AV96 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 47 | A0AV96 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 6 | P78332 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein 6 | P78332 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| RNA-binding protein EWS | Q01844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein EWS | Q01844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein FUS | P35637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein FUS | P35637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein FXR2 | P51116 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein FXR2 | P51116 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein Raly | Q9UKM9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-binding protein Raly | Q9UKM9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-splicing ligase RtcB homolog | Q9Y3I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RNA-splicing ligase RtcB homolog | Q9Y3I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| RuvB-like 2 | Q9Y230 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| RuvB-like 2 | Q9Y230 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.99 | . |
| SAFB-like transcription modulator | Q9NWH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| SAFB-like transcription modulator | Q9NWH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| SART-3 | Q15020 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| SART-3 | Q15020 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Scaffold attachment factor B2 | Q14151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Scaffold attachment factor B2 | Q14151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Scaffold-attachment factor A2 | Q1KMD3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Scaffold-attachment factor A2 | Q1KMD3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Sec1 family domain-containing protein 1 | Q8WVM8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Sec1 family domain-containing protein 1 | Q8WVM8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Sec61 alpha-1 | P61619 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Sec61 alpha-1 | P61619 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 10 | O75494 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 10 | O75494 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 3 | P84103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 3 | P84103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 6 | Q13247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 6 | Q13247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 9 | Q13242 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serine/arginine-rich splicing factor 9 | Q13242 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serpin B3 | P29508 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.64 | . |
| Serpin B3 | P29508 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Serrate RNA effector molecule homolog | Q9BXP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Serrate RNA effector molecule homolog | Q9BXP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Signal recognition particle subunit SRP68 | Q9UHB9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Signal recognition particle subunit SRP68 | Q9UHB9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Signal recognition particle subunit SRP72 | O76094 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Signal recognition particle subunit SRP72 | O76094 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Single-stranded DNA-binding protein MSSP-1 | P29558 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Single-stranded DNA-binding protein MSSP-1 | P29558 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Small nuclear ribonucleoprotein F | P62306 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.85 | . |
| Small nuclear ribonucleoprotein F | P62306 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Small nuclear ribonucleoprotein Sm D1 | P62314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Small nuclear ribonucleoprotein Sm D1 | P62314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| SMC protein 1A | Q14683 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| SMC protein 1A | Q14683 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| snRNP-N | P63162 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| snRNP-N | P63162 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.8 | . |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.72 | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| SPATS2-like protein | Q9NUQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| SPATS2-like protein | Q9NUQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Spermatid perinuclear RNA-binding protein | Q96SI9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Spermatid perinuclear RNA-binding protein | Q96SI9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Spliceosome RNA helicase DDX39B | Q13838 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Spliceosome RNA helicase DDX39B | Q13838 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.76 | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 1 | Q15637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 1 | Q15637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 3A subunit 1 | Q15459 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 3A subunit 1 | Q15459 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 3A subunit 3 | Q12874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 3A subunit 3 | Q12874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Splicing factor 3B subunit 1 | O75533 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 3B subunit 1 | O75533 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.5 | . |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor 3B subunit 5 | Q9BWJ5 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.89 | . |
| Splicing factor 3B subunit 5 | Q9BWJ5 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Splicing factor U2AF 65 kDa subunit | P26368 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Splicing factor U2AF 65 kDa subunit | P26368 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Src substrate cortactin | Q14247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Src substrate cortactin | Q14247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Structural maintenance of chromosomes protein 3 | Q9UQE7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Structural maintenance of chromosomes protein 3 | Q9UQE7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Sucrose nonfermenting protein 2 homolog | O60264 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Sucrose nonfermenting protein 2 homolog | O60264 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Surfeit locus protein 4 | O15260 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Surfeit locus protein 4 | O15260 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| SURP and G-patch domain-containing protein 2 | Q8IX01 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| SURP and G-patch domain-containing protein 2 | Q8IX01 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Symplekin | Q92797 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Symplekin | Q92797 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.65 | . |
| Talin-1 | Q9Y490 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Talin-1 | Q9Y490 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| TAR DNA-binding protein 43 | Q13148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| TAR DNA-binding protein 43 | Q13148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| TATA-binding protein-associated factor 2N | Q92804 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| TATA-binding protein-associated factor 2N | Q92804 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Thioredoxin | P10599 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.92 | . |
| Thioredoxin | P10599 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Thioredoxin-related transmembrane protein 2 | Q9Y320 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Thioredoxin-related transmembrane protein 2 | Q9Y320 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| THO complex subunit 4 | Q86V81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| THO complex subunit 4 | Q86V81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Thyroid hormone receptor-associated protein 3 | Q9Y2W1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Thyroid hormone receptor-associated protein 3 | Q9Y2W1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transcription elongation factor SPT5 | O00267 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transcription elongation factor SPT5 | O00267 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Transcription elongation factor SPT6 | Q7KZ85 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transcription elongation factor SPT6 | Q7KZ85 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Transcription elongation regulator 1 | O14776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transcription elongation regulator 1 | O14776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Transcription intermediary factor 1-beta | Q13263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transcription intermediary factor 1-beta | Q13263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.65 | . |
| Transcriptional activator protein Pur-alpha | Q00577 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transcriptional activator protein Pur-alpha | Q00577 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transcriptional activator protein Pur-beta | Q96QR8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transcriptional activator protein Pur-beta | Q96QR8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transformer-2 protein homolog alpha | Q13595 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transformer-2 protein homolog alpha | Q13595 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transformer-2 protein homolog beta | P62995 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transformer-2 protein homolog beta | P62995 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Translocation protein SEC63 homolog | Q9UGP8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Translocation protein SEC63 homolog | Q9UGP8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Translocon-associated protein subunit delta | P51571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Translocon-associated protein subunit delta | P51571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transmembrane protein 214 | Q6NUQ4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transmembrane protein 214 | Q6NUQ4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transportin-1 | Q92973 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transportin-1 | Q92973 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transportin-2 | O14787 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transportin-2 | O14787 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transportin-3 | Q9Y5L0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Transportin-3 | Q9Y5L0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Trinucleotide repeat-containing gene 6B protein | Q9UPQ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Trinucleotide repeat-containing gene 6B protein | Q9UPQ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Trip4 complex subunit p200 | Q8N3C0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Trip4 complex subunit p200 | Q8N3C0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Tubulin alpha-1B chain | P68363 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.98 | . |
| Tubulin alpha-1B chain | P68363 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Tubulin alpha-1B chain | P68363 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Tubulin alpha-1B chain | P68363 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Tubulin alpha-1C chain | Q9BQE3 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.85 | . |
| Tubulin alpha-1C chain | Q9BQE3 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.54 | . |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Tubulin beta-2A chain | Q13885 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Tubulin beta-2A chain | Q13885 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Tubulin beta-2B chain | Q9BVA1 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 3.09 | . |
| Tubulin beta-2B chain | Q9BVA1 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Tubulin beta-3 chain | Q13509 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 4.09 | . |
| Tubulin beta-3 chain | Q13509 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Tubulin beta-4B chain | P68371 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 2.74 | . |
| Tubulin beta-4B chain | P68371 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Tubulin beta-4B chain | P68371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Tubulin beta-4B chain | P68371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Tubulin beta-6 chain | Q9BUF5 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 4.87 | . |
| Tubulin beta-6 chain | Q9BUF5 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| U1 small nuclear ribonucleoprotein 70 kDa | P08621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| U1 small nuclear ribonucleoprotein 70 kDa | P08621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| U1 small nuclear ribonucleoprotein A | P09012 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| U1 small nuclear ribonucleoprotein A | P09012 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| U4/U6.U5 tri-snRNP-associated protein 1 | O43290 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| U4/U6.U5 tri-snRNP-associated protein 1 | O43290 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| U4/U6.U5 tri-snRNP-associated protein 2 | Q53GS9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| U4/U6.U5 tri-snRNP-associated protein 2 | Q53GS9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin carboxyl-terminal hydrolase 5 | P45974 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin carboxyl-terminal hydrolase 5 | P45974 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.4 | . |
| Ubiquitin carboxyl-terminal hydrolase 7 | Q93009 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin carboxyl-terminal hydrolase 7 | Q93009 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 4.28 | . |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin-associated protein 2 | Q5T6F2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin-associated protein 2 | Q5T6F2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin-associated protein 2-like | Q14157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin-associated protein 2-like | Q14157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin-like modifier-activating enzyme 1 | P22314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Ubiquitin-like modifier-activating enzyme 1 | P22314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| UDP-glucose:glycoprotein glucosyltransferase 1 | Q9NYU2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| UDP-glucose:glycoprotein glucosyltransferase 1 | Q9NYU2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Valine--tRNA ligase | P26640 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Valine--tRNA ligase | P26640 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Vesicle-trafficking protein SEC22b | O75396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Vesicle-trafficking protein SEC22b | O75396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Vigilin | Q00341 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Vigilin | Q00341 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Villin-1 | P09327 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Villin-1 | P09327 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.72 | . |
| Vinculin | P18206 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Vinculin | P18206 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| WD repeat-containing protein 1 | O75083 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| WD repeat-containing protein 1 | O75083 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| WD40 repeat-containing protein SMU1 | Q2TAY7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| WD40 repeat-containing protein SMU1 | Q2TAY7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| WW domain-binding protein 11 | Q9Y2W2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| WW domain-binding protein 11 | Q9Y2W2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Y-box-binding protein 3 | P16989 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Y-box-binding protein 3 | P16989 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| YLP motif-containing protein 1 | P49750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| YLP motif-containing protein 1 | P49750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| YTH domain-containing family protein 2 | Q9Y5A9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| YTH domain-containing family protein 2 | Q9Y5A9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| YTH domain-containing family protein 3 | Q7Z739 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| YTH domain-containing family protein 3 | Q7Z739 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| YTH domain-containing protein 1 | Q96MU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| YTH domain-containing protein 1 | Q96MU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Zinc finger CCCH domain-containing protein 11A | O75152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger CCCH domain-containing protein 11A | O75152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0.33 | . |
| Zinc finger CCCH domain-containing protein 14 | Q6PJT7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger CCCH domain-containing protein 14 | Q6PJT7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Zinc finger CCCH domain-containing protein 4 | Q9UPT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger CCCH domain-containing protein 4 | Q9UPT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 0 | . |
| Zinc finger CCCH domain-containing protein 7B | Q9UGR2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger CCCH domain-containing protein 7B | Q9UGR2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger CCHC domain-containing protein 3 | Q9NUD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger CCHC domain-containing protein 3 | Q9NUD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger CCHC domain-containing protein 8 | Q6NZY4 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | MIST = 1.79 | . |
| Zinc finger CCHC domain-containing protein 8 | Q6NZY4 | Homo sapiens | Pro Info | Thiouracil cross-linking mass spectrometry (TUX-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | 28 h | . | . |
| Zinc finger protein 638 | Q14966 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger protein 638 | Q14966 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc transporter SLC39A7 | Q92504 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
| Zinc transporter SLC39A7 | Q92504 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | Saint score = 1 | . |
Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| GO Term | GO Category | GO ID | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|---|
| RNA Binding | Molecular Function |
GO:0003723
|
7.63E-288 | 35.99605246 | 24012.82248 |
| mRNA Binding | Molecular Function |
GO:0003729
|
2.13E-95 | 28.58875813 | 6383.370756 |
| Cadherin Binding | Molecular Function |
GO:0045296
|
9.49E-36 | 10.41758353 | 891.0007353 |
| mRNA 3'-UTR Binding | Molecular Function |
GO:0003730
|
1.18E-33 | 27.43573155 | 2206.415275 |
| mRNA 5'-UTR Binding | Molecular Function |
GO:0048027
|
2.07E-18 | 76.18395303 | 3435.296308 |
| Ribosome Binding | Molecular Function |
GO:0043022
|
6.26E-18 | 16.11304781 | 705.8272561 |
| Single-Stranded DNA Binding | Molecular Function |
GO:0003697
|
1.90E-15 | 12.85685885 | 487.7303931 |
| DNA Binding | Molecular Function |
GO:0003677
|
2.56E-15 | 3.625027398 | 135.9553746 |
| Poly-Purine Tract Binding | Molecular Function |
GO:0070717
|
1.51E-14 | 35.62683105 | 1268.617768 |
| miRNA Binding | Molecular Function |
GO:0035198
|
1.40E-13 | 35.40116959 | 1177.980381 |
| N6-methyladenosine-containing RNA Binding | Molecular Function |
GO:1990247
|
2.02E-12 | 338.3166023 | 10323.7042 |
| Regulatory RNA Binding | Molecular Function |
GO:0061980
|
2.85E-12 | 21.10026042 | 634.7267933 |
| Single-Stranded RNA Binding | Molecular Function |
GO:0003727
|
3.95E-12 | 20.34563337 | 603.7919927 |
| poly Binding | Molecular Function |
GO:0008143
|
9.97E-12 | 34.87976102 | 997.8122798 |
| Poly-Pyrimidine Tract Binding | Molecular Function |
GO:0008187
|
9.97E-12 | 34.87976102 | 997.8122798 |
| Double-Stranded RNA Binding | Molecular Function |
GO:0003725
|
1.59E-11 | 13.48958333 | 378.7595726 |
| Translation Initiation Factor Activity | Molecular Function |
GO:0003743
|
5.34E-10 | 17.56427182 | 430.3421506 |
| pre-mRNA Binding | Molecular Function |
GO:0036002
|
2.93E-09 | 21.82721338 | 496.3542027 |
| snRNA Binding | Molecular Function |
GO:0017069
|
1.51E-08 | 14.61346696 | 307.612055 |
| Purine Ribonucleoside Triphosphate Binding | Molecular Function |
GO:0035639
|
2.85E-08 | 3.377174552 | 68.75865256 |
| Nucleus | Cellular Component |
GO:0005634
|
2.22E-83 | 5.91879737 | 1158.674698 |
| Intracellular Membrane-Bounded Organelle | Cellular Component |
GO:0043231
|
2.57E-75 | 5.365413068 | 947.0188983 |
| Cytoplasmic Stress Granule | Cellular Component |
GO:0010494
|
1.42E-44 | 49.51109763 | 5214.187903 |
| Intracellular Non-Membrane-Bounded Organelle | Cellular Component |
GO:0043232
|
4.90E-28 | 4.304961047 | 288.1867097 |
| Focal Adhesion | Cellular Component |
GO:0005925
|
2.22E-27 | 7.522542876 | 490.5351533 |
| Cell-Substrate Junction | Cellular Component |
GO:0030055
|
5.80E-27 | 7.33983189 | 470.2395561 |
| Nucleolus | Cellular Component |
GO:0005730
|
2.01E-23 | 4.707719897 | 262.5190745 |
| Nuclear Lumen | Cellular Component |
GO:0031981
|
3.70E-23 | 4.645137342 | 255.571837 |
| Ribosome | Cellular Component |
GO:0005840
|
1.13E-19 | 23.33986007 | 1094.079275 |
| Cytosolic Small Ribosomal Subunit | Cellular Component |
GO:0022627
|
2.38E-18 | 33.06809234 | 1445.896174 |
| Small Ribosomal Subunit | Cellular Component |
GO:0015935
|
3.85E-18 | 31.62872304 | 1364.686257 |
| Spliceosomal snRNP Complex | Cellular Component |
GO:0097525
|
7.90E-18 | 22.4076087 | 948.761795 |
| U2-type Spliceosomal Complex | Cellular Component |
GO:0005684
|
7.95E-18 | 14.86975176 | 628.3272025 |
| Ficolin-1-Rich Granule Lumen | Cellular Component |
GO:1904813
|
2.35E-14 | 9.845820798 | 336.605473 |
| Ficolin-1-Rich Granule | Cellular Component |
GO:0101002
|
9.91E-13 | 6.948204101 | 211.076164 |
| Cytosolic Large Ribosomal Subunit | Cellular Component |
GO:0022625
|
2.54E-12 | 16.90541422 | 495.5321715 |
| Large Ribosomal Subunit | Cellular Component |
GO:0015934
|
2.54E-12 | 16.90541422 | 495.5321715 |
| Cytoplasmic Vesicle Lumen | Cellular Component |
GO:0060205
|
3.49E-12 | 9.07824976 | 262.7005563 |
| Secretory Granule Lumen | Cellular Component |
GO:0034774
|
9.55E-12 | 4.858663889 | 135.441358 |
| U2-type Precatalytic Spliceosome | Cellular Component |
GO:0071005
|
1.35E-11 | 16.75005744 | 460.3037105 |
| mRNA Processing | Biological Process |
GO:0006397
|
2.43E-63 | 24.1503974 | 3667.493617 |
| mRNA Splicing, Via Spliceosome | Biological Process |
GO:0000398
|
4.64E-60 | 23.05576771 | 3311.08047 |
| RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile | Biological Process |
GO:0000377
|
2.85E-56 | 24.95421316 | 3355.986596 |
| RNA Processing | Biological Process |
GO:0006396
|
2.27E-50 | 21.89725216 | 2640.963439 |
| Regulation Of Translation | Biological Process |
GO:0006417
|
1.12E-48 | 19.36707672 | 2256.028364 |
| Gene Expression | Biological Process |
GO:0010467
|
1.72E-48 | 14.16556291 | 1641.466605 |
| protein-RNA Complex Assembly | Biological Process |
GO:0022618
|
1.37E-41 | 21.6433942 | 2160.634295 |
| Regulation Of mRNA Splicing, Via Spliceosome | Biological Process |
GO:0048024
|
1.91E-34 | 28.21542474 | 2348.910724 |
| Cytoplasmic Translation | Biological Process |
GO:0002181
|
2.86E-33 | 27.43573155 | 2206.415275 |
| Translation | Biological Process |
GO:0006412
|
6.23E-32 | 11.91780311 | 920.4868362 |
| Macromolecule Biosynthetic Process | Biological Process |
GO:0009059
|
1.03E-29 | 13.49767061 | 972.2607371 |
| Positive Regulation Of Translation | Biological Process |
GO:0045727
|
3.85E-29 | 20.63449267 | 1457.340771 |
| Negative Regulation Of Translation | Biological Process |
GO:0017148
|
4.94E-28 | 20.03591406 | 1362.329261 |
| Peptide Biosynthetic Process | Biological Process |
GO:0043043
|
6.73E-26 | 13.47231406 | 848.8499383 |
| mRNA Metabolic Process | Biological Process |
GO:0016071
|
2.66E-25 | 22.47569444 | 1383.719827 |
| Regulation Of RNA Splicing | Biological Process |
GO:0043484
|
4.65E-25 | 18.78577715 | 1144.809051 |
| RNA Splicing | Biological Process |
GO:0008380
|
3.62E-23 | 18.10261194 | 1023.273718 |
| Regulation Of Alternative mRNA Splicing, Via Spliceosome | Biological Process |
GO:0000381
|
3.46E-22 | 31.99122506 | 1734.260945 |
| Spliceosomal Complex Assembly | Biological Process |
GO:0000245
|
1.28E-21 | 26.16022397 | 1382.439436 |
| Negative Regulation Of Amide Metabolic Process | Biological Process |
GO:0034249
|
3.04E-20 | 16.75424696 | 831.5300271 |
Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| Spliceosome | KEGG Pathway | 4.63E-50 | 26.0521461 | 3096.654104 |
| RNA transport | KEGG Pathway | 3.98E-21 | 10.14688001 | 523.0533451 |
| mRNA surveillance pathway | KEGG Pathway | 6.95E-20 | 15.55350701 | 747.0104048 |
| Ribosome | KEGG Pathway | 6.95E-20 | 10.76140156 | 516.4940306 |
| Coronavirus disease | KEGG Pathway | 2.24E-15 | 6.960711485 | 260.2509801 |
| Protein processing in endoplasmic reticulum | KEGG Pathway | 3.89E-14 | 7.927470445 | 272.3396388 |
| Amyotrophic lateral sclerosis | KEGG Pathway | 8.05E-08 | 3.727102349 | 73.26442164 |
| DNA replication | KEGG Pathway | 4.93E-07 | 14.46734117 | 256.223109 |
| Cell cycle | KEGG Pathway | 2.07E-05 | 5.204630161 | 72.12770771 |
| Salmonella infection | KEGG Pathway | 5.87E-05 | 3.503094446 | 44.51598041 |
| Phagosome | KEGG Pathway | 0.000215761 | 4.134922445 | 46.77136422 |
| Protein export | KEGG Pathway | 0.000362344 | 13.18008355 | 141.1042446 |
| Pathogenic Escherichia coli infection | KEGG Pathway | 0.001053625 | 3.337319307 | 31.89952315 |
| Parkinson disease | KEGG Pathway | 0.001513255 | 2.945730105 | 26.71364892 |
| Legionellosis | KEGG Pathway | 0.001513255 | 6.110337777 | 55.31872079 |
| Antigen processing and presentation | KEGG Pathway | 0.00251635 | 4.886016451 | 41.43447173 |
| RNA degradation | KEGG Pathway | 0.002611488 | 4.815968009 | 40.36975597 |
| Non-homologous end-joining | KEGG Pathway | 0.003039148 | 16.54047164 | 135.196267 |
| Prion disease | KEGG Pathway | 0.003655088 | 2.665156593 | 21.14816204 |
| Gap junction | KEGG Pathway | 0.005001699 | 4.26533405 | 32.28902032 |
Virus RNA Sequence Information
|
>U87411.1 Dengue virus type 2 (strain 16681) polyprotein mRNA, complete cds
AGTTGTTAGTCTACGTGGACCGACAAAGACAGATTCTTTGAGGGAGCTAAGCTCAACGTAGTTCTAACAG
TTTTTTAATTAGAGAGCAGATCTCTGATGAATAACCAACGGAAAAAGGCGAAAAACACGCCTTTCAATAT
GCTGAAACGCGAGAGAAACCGCGTGTCGACTGTGCAACAGCTGACAAAGAGATTCTCACTTGGAATGCTG
CAGGGACGAGGACCATTAAAACTGTTCATGGCCCTGGTGGCGTTCCTTCGTTTCCTAACAATCCCACCAA
CAGCAGGGATATTGAAGAGATGGGGAACAATTAAAAAATCAAAAGCTATTAATGTTTTGAGAGGGTTCAG
GAAAGAGATTGGAAGGATGCTGAACATCTTGAATAGGAGACGCAGATCTGCAGGCATGATCATTATGCTG
ATTCCAACAGTGATGGCGTTCCATTTAACCACACGTAACGGAGAACCACACATGATCGTCAGCAGACAAG
AGAAAGGGAAAAGTCTTCTGTTTAAAACAGAGGATGGCGTGAACATGTGTACCCTCATGGCCATGGACCT
TGGTGAATTGTGTGAAGACACAATCACGTACAAGTGTCCCCTTCTCAGGCAGAATGAGCCAGAAGACATA
GACTGTTGGTGCAACTCTACGTCCACGTGGGTAACTTATGGGACGTGTACCACCATGGGAGAACATAGAA
GAGAAAAAAGATCAGTGGCACTCGTTCCACATGTGGGAATGGGACTGGAGACACGAACTGAAACATGGAT
GTCATCAGAAGGGGCCTGGAAACATGTCCAGAGAATTGAAACTTGGATCTTGAGACATCCAGGCTTCACC
ATGATGGCAGCAATCCTGGCATACACCATAGGAACGACACATTTCCAAAGAGCCCTGATTTTCATCTTAC
TGACAGCTGTCACTCCTTCAATGACAATGCGTTGCATAGGAATGTCAAATAGAGACTTTGTGGAAGGGGT
TTCAGGAGGAAGCTGGGTTGACATAGTCTTAGAACATGGAAGCTGTGTGACGACGATGGCAAAAAACAAA
CCAACATTGGATTTTGAACTGATAAAAACAGAAGCCAAACAGCCTGCCACCCTAAGGAAGTACTGTATAG
AGGCAAAGCTAACCAACACAACAACAGAATCTCGCTGCCCAACACAAGGGGAACCCAGCCTAAATGAAGA
GCAGGACAAAAGGTTCGTCTGCAAACACTCCATGGTAGACAGAGGATGGGGAAATGGATGTGGACTATTT
GGAAAGGGAGGCATTGTGACCTGTGCTATGTTCAGATGCAAAAAGAACATGGAAGGAAAAGTTGTGCAAC
CAGAAAACTTGGAATACACCATTGTGATAACACCTCACTCAGGGGAAGAGCATGCAGTCGGAAATGACAC
AGGAAAACATGGCAAGGAAATCAAAATAACACCACAGAGTTCCATCACAGAAGCAGAATTGACAGGTTAT
GGCACTGTCACAATGGAGTGCTCTCCAAGAACGGGCCTCGACTTCAATGAGATGGTGTTGCTGCAGATGG
AAAATAAAGCTTGGCTGGTGCACAGGCAATGGTTCCTAGACCTGCCGTTACCATGGTTGCCCGGAGCGGA
CACACAAGGGTCAAATTGGATACAGAAAGAGACATTGGTCACTTTCAAAAATCCCCATGCGAAGAAACAG
GATGTTGTTGTTTTAGGATCCCAAGAAGGGGCCATGCACACAGCACTTACAGGGGCCACAGAAATCCAAA
TGTCATCAGGAAACTTACTCTTCACAGGACATCTCAAGTGCAGGCTGAGAATGGACAAGCTACAGCTCAA
AGGAATGTCATACTCTATGTGCACAGGAAAGTTTAAAGTTGTGAAGGAAATAGCAGAAACACAACATGGA
ACAATAGTTATCAGAGTGCAATATGAAGGGGACGGCTCTCCATGCAAGATCCCTTTTGAGATAATGGATT
TGGAAAAAAGACATGTCTTAGGTCGCCTGATTACAGTCAACCCAATTGTGACAGAAAAAGATAGCCCAGT
CAACATAGAAGCAGAACCTCCATTCGGAGACAGCTACATCATCATAGGAGTAGAGCCGGGACAACTGAAG
CTCAACTGGTTTAAGAAAGGAAGTTCTATCGGCCAAATGTTTGAGACAACAATGAGGGGGGCGAAGAGAA
TGGCCATTTTAGGTGACACAGCCTGGGATTTTGGATCCTTGGGAGGAGTGTTTACATCTATAGGAAAGGC
TCTCCACCAAGTCTTTGGAGCAATCTATGGAGCTGCCTTCAGTGGGGTTTCATGGACTATGAAAATCCTC
ATAGGAGTCATTATCACATGGATAGGAATGAATTCACGCAGCACCTCACTGTCTGTGACACTAGTATTGG
TGGGAATTGTGACACTGTATTTGGGAGTCATGGTGCAGGCCGATAGTGGTTGCGTTGTGAGCTGGAAAAA
CAAAGAACTGAAATGTGGCAGTGGGATTTTCATCACAGACAACGTGCACACATGGACAGAACAATACAAG
TTCCAACCAGAATCCCCTTCAAAACTAGCTTCAGCTATCCAGAAAGCCCATGAAGAGGGCATTTGTGGAA
TCCGCTCAGTAACAAGACTGGAGAATCTGATGTGGAAACAAATAACACCAGAATTGAATCACATTCTATC
AGAAAATGAGGTGAAGTTAACTATTATGACAGGAGACATCAAAGGAATCATGCAGGCAGGAAAACGATCT
CTGCGGCCTCAGCCCACTGAGCTGAAGTATTCATGGAAAACATGGGGCAAAGCAAAAATGCTCTCTACAG
AGTCTCATAACCAGACCTTTCTCATTGATGGCCCCGAAACAGCAGAATGCCCCAACACAAATAGAGCTTG
GAATTCGTTGGAAGTTGAAGACTATGGCTTTGGAGTATTCACCACCAATATATGGCTAAAATTGAAAGAA
AAACAGGATGTATTCTGCGACTCAAAACTCATGTCAGCGGCCATAAAAGACAACAGAGCCGTCCATGCCG
ATATGGGTTATTGGATAGAAAGTGCACTCAATGACACATGGAAGATAGAGAAAGCCTCTTTCATTGAAGT
TAAAAACTGCCACTGGCCAAAATCACACACCCTCTGGAGCAATGGAGTGCTAGAAAGTGAGATGATAATT
CCAAAGAATCTCGCTGGACCAGTGTCTCAACACAACTATAGACCAGGCTACCATACACAAATAACAGGAC
CATGGCATCTAGGTAAGCTTGAGATGGACTTTGATTTCTGTGATGGAACAACAGTGGTAGTGACTGAGGA
CTGCGGAAATAGAGGACCCTCTTTGAGAACAACCACTGCCTCTGGAAAACTCATAACAGAATGGTGCTGC
CGATCTTGCACATTACCACCGCTAAGATACAGAGGTGAGGATGGGTGCTGGTACGGGATGGAAATCAGAC
CATTGAAGGAGAAAGAAGAGAATTTGGTCAACTCCTTGGTCACAGCTGGACATGGGCAGGTCGACAACTT
TTCACTAGGAGTCTTGGGAATGGCATTGTTCCTGGAGGAAATGCTTAGGACCCGAGTAGGAACGAAACAT
GCAATACTACTAGTTGCAGTTTCTTTTGTGACATTGATCACAGGGAACATGTCCTTTAGAGACCTGGGAA
GAGTGATGGTTATGGTAGGCGCCACTATGACGGATGACATAGGTATGGGCGTGACTTATCTTGCCCTACT
AGCAGCCTTCAAAGTCAGACCAACTTTTGCAGCTGGACTACTCTTGAGAAAGCTGACCTCCAAGGAATTG
ATGATGACTACTATAGGAATTGTACTCCTCTCCCAGAGCACCATACCAGAGACCATTCTTGAGTTGACTG
ATGCGTTAGCCTTAGGCATGATGGTCCTCAAAATGGTGAGAAATATGGAAAAGTATCAATTGGCAGTGAC
TATCATGGCTATCTTGTGCGTCCCAAACGCAGTGATATTACAAAACGCATGGAAAGTGAGTTGCACAATA
TTGGCAGTGGTGTCCGTTTCCCCACTGCTCTTAACATCCTCACAGCAAAAAACAGATTGGATACCATTAG
CATTGACGATCAAAGGTCTCAATCCAACAGCTATTTTTCTAACAACCCTCTCAAGAACCAGCAAGAAAAG
GAGCTGGCCATTAAATGAGGCTATCATGGCAGTCGGGATGGTGAGCATTTTAGCCAGTTCTCTCCTAAAA
AATGATATTCCCATGACAGGACCATTAGTGGCTGGAGGGCTCCTCACTGTGTGCTACGTGCTCACTGGAC
GATCGGCCGATTTGGAACTGGAGAGAGCAGCCGATGTCAAATGGGAAGACCAGGCAGAGATATCAGGAAG
CAGTCCAATCCTGTCAATAACAATATCAGAAGATGGTAGCATGTCGATAAAAAATGAAGAGGAAGAACAA
ACACTGACCATACTCATTAGAACAGGATTGCTGGTGATCTCAGGACTTTTTCCTGTATCAATACCAATCA
CGGCAGCAGCATGGTACCTGTGGGAAGTGAAGAAACAACGGGCCGGAGTATTGTGGGATGTTCCTTCACC
CCCACCCATGGGAAAGGCTGAACTGGAAGATGGAGCCTATAGAATTAAGCAAAAAGGGATTCTTGGATAT
TCCCAGATCGGAGCCGGAGTTTACAAAGAAGGAACATTCCATACAATGTGGCATGTCACACGTGGCGCTG
TTCTAATGCATAAAGGAAAGAGGATTGAACCATCATGGGCGGACGTCAAGAAAGACCTAATATCATATGG
AGGAGGCTGGAAGTTAGAAGGAGAATGGAAGGAAGGAGAAGAAGTCCAGGTATTGGCACTGGAGCCTGGA
AAAAATCCAAGAGCCGTCCAAACGAAACCTGGTCTTTTCAAAACCAACGCCGGAACAATAGGTGCTGTAT
CTCTGGACTTTTCTCCTGGAACGTCAGGATCTCCAATTATCGACAAAAAAGGAAAAGTTGTGGGTCTTTA
TGGTAATGGTGTTGTTACAAGGAGTGGAGCATATGTGAGTGCTATAGCCCAGACTGAAAAAAGCATTGAA
GACAACCCAGAGATCGAAGATGACATTTTCCGAAAGAGAAGACTGACCATCATGGACCTCCACCCAGGAG
CGGGAAAGACGAAGAGATACCTTCCGGCCATAGTCAGAGAAGCTATAAAACGGGGTTTGAGAACATTAAT
CTTGGCCCCCACTAGAGTTGTGGCAGCTGAAATGGAGGAAGCCCTTAGAGGACTTCCAATAAGATACCAG
ACCCCAGCCATCAGAGCTGAGCACACCGGGCGGGAGATTGTGGACCTAATGTGTCATGCCACATTTACCA
TGAGGCTGCTATCACCAGTTAGAGTGCCAAACTACAACCTGATTATCATGGACGAAGCCCATTTCACAGA
CCCAGCAAGTATAGCAGCTAGAGGATACATCTCAACTCGAGTGGAGATGGGTGAGGCAGCTGGGATTTTT
ATGACAGCCACTCCCCCGGGAAGCAGAGACCCATTTCCTCAGAGCAATGCACCAATCATAGATGAAGAAA
GAGAAATCCCTGAACGTTCGTGGAATTCCGGACATGAATGGGTCACGGATTTTAAAGGGAAGACTGTTTG
GTTCGTTCCAAGTATAAAAGCAGGAAATGATATAGCAGCTTGCCTGAGGAAAAATGGAAAGAAAGTGATA
CAACTCAGTAGGAAGACCTTTGATTCTGAGTATGTCAAGACTAGAACCAATGATTGGGACTTCGTGGTTA
CAACTGACATTTCAGAAATGGGTGCCAATTTCAAGGCTGAGAGGGTTATAGACCCCAGACGCTGCATGAA
ACCAGTCATACTAACAGATGGTGAAGAGCGGGTGATTCTGGCAGGACCTATGCCAGTGACCCACTCTAGT
GCAGCACAAAGAAGAGGGAGAATAGGAAGAAATCCAAAAAATGAGAATGACCAGTACATATACATGGGGG
AACCTCTGGAAAATGATGAAGACTGTGCACACTGGAAAGAAGCTAAAATGCTCCTAGATAACATCAACAC
GCCAGAAGGAATCATTCCTAGCATGTTCGAACCAGAGCGTGAAAAGGTGGATGCCATTGATGGCGAATAC
CGCTTGAGAGGAGAAGCAAGGAAAACCTTTGTAGACTTAATGAGAAGAGGAGACCTACCAGTCTGGTTGG
CCTACAGAGTGGCAGCTGAAGGCATCAACTACGCAGACAGAAGGTGGTGTTTTGATGGAGTCAAGAACAA
CCAAATCCTAGAAGAAAACGTGGAAGTTGAAATCTGGACAAAAGAAGGGGAAAGGAAGAAATTGAAACCC
AGATGGTTGGATGCTAGGATCTATTCTGACCCACTGGCGCTAAAAGAATTTAAGGAATTTGCAGCCGGAA
GAAAGTCTCTGACCCTGAACCTAATCACAGAAATGGGTAGGCTCCCAACCTTCATGACTCAGAAGGCAAG
AGACGCACTGGACAACTTAGCAGTGCTGCACACGGCTGAGGCAGGTGGAAGGGCGTACAACCATGCTCTC
AGTGAACTGCCGGAGACCCTGGAGACATTGCTTTTACTGACACTTCTGGCTACAGTCACGGGAGGGATCT
TTTTATTCTTGATGAGCGGAAGGGGCATAGGGAAGATGACCCTGGGAATGTGCTGCATAATCACGGCTAG
CATCCTCCTATGGTACGCACAAATACAGCCACACTGGATAGCAGCTTCAATAATACTGGAGTTTTTTCTC
ATAGTTTTGCTTATTCCAGAACCTGAAAAACAGAGAACACCCCAAGACAACCAACTGACCTACGTTGTCA
TAGCCATCCTCACAGTGGTGGCCGCAACCATGGCAAACGAGATGGGTTTCCTAGAAAAAACGAAGAAAGA
TCTCGGATTGGGAAGCATTGCAACCCAGCAACCCGAGAGCAACATCCTGGACATAGATCTACGTCCTGCA
TCAGCATGGACGCTGTATGCCGTGGCCACAACATTTGTTACACCAATGTTGAGACATAGCATTGAAAATT
CCTCAGTGAATGTGTCCCTAACAGCTATAGCCAACCAAGCCACAGTGTTAATGGGTCTCGGGAAAGGATG
GCCATTGTCAAAGATGGACATCGGAGTTCCCCTTCTCGCCATTGGATGCTACTCACAAGTCAACCCCATA
ACTCTCACAGCAGCTCTTTTCTTATTGGTAGCACATTATGCCATCATAGGGCCAGGACTCCAAGCAAAAG
CAACCAGAGAAGCTCAGAAAAGAGCAGCGGCGGGCATCATGAAAAACCCAACTGTCGATGGAATAACAGT
GATTGACCTAGATCCAATACCTTATGATCCAAAGTTTGAAAAGCAGTTGGGACAAGTAATGCTCCTAGTC
CTCTGCGTGACTCAAGTATTGATGATGAGGACTACATGGGCTCTGTGTGAGGCTTTAACCTTAGCTACCG
GGCCCATCTCCACATTGTGGGAAGGAAATCCAGGGAGGTTTTGGAACACTACCATTGCGGTGTCAATGGC
TAACATTTTTAGAGGGAGTTACTTGGCCGGAGCTGGACTTCTCTTTTCTATTATGAAGAACACAACCAAC
ACAAGAAGGGGAACTGGCAACATAGGAGAGACGCTTGGAGAGAAATGGAAAAGCCGATTGAACGCATTGG
GAAAAAGTGAATTCCAGATCTACAAGAAAAGTGGAATCCAGGAAGTGGATAGAACCTTAGCAAAAGAAGG
CATTAAAAGAGGAGAAACGGACCATCACGCTGTGTCGCGAGGCTCAGCAAAACTGAGATGGTTCGTTGAG
AGAAACATGGTCACACCAGAAGGGAAAGTAGTGGACCTCGGTTGTGGCAGAGGAGGCTGGTCATACTATT
GTGGAGGACTAAAGAATGTAAGAGAAGTCAAAGGCCTAACAAAAGGAGGACCAGGACACGAAGAACCCAT
CCCCATGTCAACATATGGGTGGAATCTAGTGCGTCTTCAAAGTGGAGTTGACGTTTTCTTCATCCCGCCA
GAAAAGTGTGACACATTATTGTGTGACATAGGGGAGTCATCACCAAATCCCACAGTGGAAGCAGGACGAA
CACTCAGAGTCCTTAACTTAGTAGAAAATTGGTTGAACAACAACACTCAATTTTGCATAAAGGTTCTCAA
CCCATATATGCCCTCAGTCATAGAAAAAATGGAAGCACTACAAAGGAAATATGGAGGAGCCTTAGTGAGG
AATCCACTCTCACGAAACTCCACACATGAGATGTACTGGGTATCCAATGCTTCCGGGAACATAGTGTCAT
CAGTGAACATGATTTCAAGGATGTTGATCAACAGATTTACAATGAGATACAAGAAAGCCACTTACGAGCC
GGATGTTGACCTCGGAAGCGGAACCCGTAACATCGGGATTGAAAGTGAGATACCAAACCTAGATATAATT
GGGAAAAGAATAGAAAAAATAAAGCAAGAGCATGAAACATCATGGCACTATGACCAAGACCACCCATACA
AAACGTGGGCATACCATGGTAGCTATGAAACAAAACAGACTGGATCAGCATCATCCATGGTCAACGGAGT
GGTCAGGCTGCTGACAAAACCTTGGGACGTCGTCCCCATGGTGACACAGATGGCAATGACAGACACGACT
CCATTTGGACAACAGCGCGTTTTTAAAGAGAAAGTGGACACGAGAACCCAAGAACCGAAAGAAGGCACGA
AGAAACTAATGAAAATAACAGCAGAGTGGCTTTGGAAAGAATTAGGGAAGAAAAAGACACCCAGGATGTG
CACCAGAGAAGAATTCACAAGAAAGGTGAGAAGCAATGCAGCCTTGGGGGCCATATTCACTGATGAGAAC
AAGTGGAAGTCGGCACGTGAGGCTGTTGAAGATAGTAGGTTTTGGGAGCTGGTTGACAAGGAAAGGAATC
TCCATCTTGAAGGAAAGTGTGAAACATGTGTGTACAACATGATGGGAAAAAGAGAGAAGAAGCTAGGGGA
ATTCGGCAAGGCAAAAGGCAGCAGAGCCATATGGTACATGTGGCTTGGAGCACGCTTCTTAGAGTTTGAA
GCCCTAGGATTCTTAAATGAAGATCACTGGTTCTCCAGAGAGAACTCCCTGAGTGGAGTGGAAGGAGAAG
GGCTGCACAAGCTAGGTTACATTCTAAGAGACGTGAGCAAGAAAGAGGGAGGAGCAATGTATGCCGATGA
CACCGCAGGATGGGATACAAGAATCACACTAGAAGACCTAAAAAATGAAGAAATGGTAACAAACCACATG
GAAGGAGAACACAAGAAACTAGCCGAGGCCATTTTCAAACTAACGTACCAAAACAAGGTGGTGCGTGTGC
AAAGACCAACACCAAGAGGCACAGTAATGGACATCATATCGAGAAGAGACCAAAGAGGTAGTGGACAAGT
TGGCACCTATGGACTCAATACTTTCACCAATATGGAAGCCCAACTAATCAGACAGATGGAGGGAGAAGGA
GTCTTTAAAAGCATTCAGCACCTAACAATCACAGAAGAAATCGCTGTGCAAAACTGGTTAGCAAGAGTGG
GGCGCGAAAGGTTATCAAGAATGGCCATCAGTGGAGATGATTGTGTTGTGAAACCTTTAGATGACAGGTT
CGCAAGCGCTTTAACAGCTCTAAATGACATGGGAAAGATTAGGAAAGACATACAACAATGGGAACCTTCA
AGAGGATGGAATGATTGGACACAAGTGCCCTTCTGTTCACACCATTTCCATGAGTTAATCATGAAAGACG
GTCGCGTACTCGTTGTTCCATGTAGAAACCAAGATGAACTGATTGGCAGAGCCCGAATCTCCCAAGGAGC
AGGGTGGTCTTTGCGGGAGACGGCCTGTTTGGGGAAGTCTTACGCCCAAATGTGGAGCTTGATGTACTTC
CACAGACGCGACCTCAGGCTGGCGGCAAATGCTATTTGCTCGGCAGTACCATCACATTGGGTTCCAACAA
GTCGAACAACCTGGTCCATACATGCTAAACATGAATGGATGACAACGGAAGACATGCTGACAGTCTGGAA
CAGGGTGTGGATTCAAGAAAACCCATGGATGGAAGACAAAACTCCAGTGGAATCATGGGAGGAAATCCCA
TACTTGGGGAAAAGAGAAGACCAATGGTGCGGCTCATTGATTGGGTTAACAAGCAGGGCCACCTGGGCAA
AGAACATCCAAGCAGCAATAAATCAAGTTAGATCCCTTATAGGCAATGAAGAATACACAGATTACATGCC
ATCCATGAAAAGATTCAGAAGAGAAGAGGAAGAAGCAGGAGTTCTGTGGTAGAAAGCAAAACTAACATGA
AACAAGGCTAGAAGTCAGGTCGGATTAAGCCATAGTACGGAAAAAACTATGCTACCTGTGAGCCCCGTCC
AAGGACGTTAAAAGAAGTCAGGCCATCATAAATGCCATAGCTTGAGTAAACTATGCAGCCTGTAGCTCCA
CCTGAGAAGGTGTAAAAAATCCGGGAGGCCACAAACCATGGAAGCTGTACGCATGGCGTAGTGGACTAGC
GGTTAGAGGAGACCCCTCCCTTACAAATCGCAGCAACAATGGGGGCCCAAGGCGAGATGAAGCTGTAGTC
TCGCTGGAAGGACTAGAGGTTAGAGGAGACCCCCCCGAAACAAAAAACAGCATATTGACGCTGGGAAAGA
CCAGAGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAATGGTGCTGTTGA
ATCAACAGGTTCT
Click to Show/Hide
|