Home
Search 
BLAST
Manual
DownloadDetails of Virus RNA
| Strain Information | Strain Name |
Dengue virus
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Flaviviridae
|
||||||||
| RNA Binding Site |
5'UTR - 3'UTR
|
||||||||
| Virus Information | Virus Name |
Dengue virus (DENV)
|
|||||||
| Taxonomy ID | 12637 | ||||||||
| GeneBank ID | KF907503 | ||||||||
Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.46098830367973 |
| 130 kDa leucine-rich protein | P42704 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 140 kDa Ser/Arg-rich domain protein | O15042 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.95654366569277 |
| 2-hydroxyacyl-CoA lyase 1 | Q9UJ83 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 26S proteasome regulatory subunit 7 | P35998 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 3'-5' RNA helicase YTHDC2 | Q9H6S0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.783515324860985 |
| 3-hydroxyacyl-CoA dehydratase 2 | Q6Y1H2 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 3-keto acyl-CoA synthase ELOVL1 | Q9BW60 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 39S ribosomal protein L21 | Q7Z2W9 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S10 | P46783 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.1627836481758 |
| 40S ribosomal protein S11 | P62280 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S13 | P62277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.49310417181706 |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.24728954933884 |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.77977240070257 |
| 40S ribosomal protein S17 | P08708 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.73853006971098 |
| 40S ribosomal protein S18 | P62269 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.66001586532566 |
| 40S ribosomal protein S19 | P39019 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S19 | P39019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.31833998212248 |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.17746498590472 |
| 40S ribosomal protein S27 | P42677 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S3 | E9PL09 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.5853888820103 |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.13868998030811 |
| 40S ribosomal protein S4 | P62701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.33290552995009 |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.92484480061473 |
| 40S ribosomal protein S7 | P62081 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.08724896707439 |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.57419356629672 |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.39139930185283 |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.66919008023247 |
| 4F2 light chain | Q01650 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.71155920860398 |
| 6-phosphogluconate dehydrogenase | P52209 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.37741197032806 |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.41391897713882 |
| 60S ribosomal protein L10a | P62906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.30999103926007 |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.75450273218095 |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.30299161561275 |
| 60S ribosomal protein L17 | P18621 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L19 | P84098 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.33236995258555 |
| 60S ribosomal protein L21 | P46778 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.21987168711204 |
| 60S ribosomal protein L23a | P62750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.56426596813814 |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25363837948655 |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.16229383654145 |
| 60S ribosomal protein L27 | P61353 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.22310740867806 |
| 60S ribosomal protein L28 | P46779 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L29 | P47914 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.64532352979229 |
| 60S ribosomal protein L38 | P63173 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.03026191099122 |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.90947359144812 |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.05588281880951 |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.0625706974788 |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.04397436519754 |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.46320915288338 |
| 7-dehydrocholesterol reductase | Q9UBM7 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 7-dehydrocholesterol reductase | Q9UBM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.7521491276947 |
| 7SK snRNA methylphosphate capping enzyme | Q7L2J0 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| A-kinase anchor protein 1 | Q92667 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| A-kinase anchor protein 8 | O43823 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.71932365004289 |
| A-kinase anchor protein 8-like | Q9ULX6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26607888450808 |
| Acetyl-CoA acetyltransferase | Q9BWD1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.11681534650332 |
| Actin | P68133 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Actin | P68133 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Acyl-CoA (8-3)-desaturase | O60427 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Acyl-CoA 6-desaturase | O95864 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.05106577930302 |
| ADAM 9 | Q13443 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.47293794697783 |
| Adhesion molecule in glia | P14415 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ADP/ATP translocase 2 | P05141 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Afadin | P55196 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Alanine--tRNA ligase | P49588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.1189263440579 |
| Albumin | P02768 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Aldehyde dehydrogenase 1A1 | P00352 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Alpha-adducin | P35611 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Anion exchange protein 2 | P04920 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Annexin A4 | P09525 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.15637719930629 |
| Annexin A6 | P08133 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.83342447163389 |
| AP2-associated protein kinase 1 | Q2M2I8 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Apo-1 antigen | P25445 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| APOBEC1 complementation factor | Q9NQ94 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.00439891679829 |
| Apolipoprotein B-100 | P04114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.13718216042858 |
| Apoptosis inhibitor 5 | Q9BZZ5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.61934727197875 |
| Apoptosis-inducing factor 1 | O95831 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Apoptotic chromatin condensation inducer in the nucleus | Q9UKV3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.15374697869486 |
| Arginine-rich protein | P55145 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.10290331829951 |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.31372546090225 |
| ATP synthase subunit alpha | P25705 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP synthase subunit ATP5MJ | P56378 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP-binding cassette sub-family D member 1 | P33897 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP-binding cassette sub-family D member 3 | P28288 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP-binding cassette sub-family E member 1 | P61221 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.31796968497383 |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.81024565808389 |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.02670409583906 |
| ATP-dependent DNA/RNA helicase DHX36 | Q9H2U1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.46285330272259 |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.42719713456138 |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.236466596061 |
| ATP-dependent RNA helicase DDX19A | Q9NUU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.0044942012137 |
| ATP-dependent RNA helicase DDX3X | O00571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.15078534652088 |
| ATP-dependent RNA helicase DDX42 | Q86XP3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.76842995909378 |
| ATP-dependent RNA helicase DHX15 | O43143 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.65343612385702 |
| ATP-dependent RNA helicase DHX29 | Q7Z478 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.83529351511271 |
| Band 4.1-like protein 2 | O43491 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Bcl-2-associated transcription factor 1 | Q9NYF8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.74452495335731 |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.31853323630724 |
| Bifunctional purine biosynthesis protein ATIC | P31939 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.74706079582689 |
| BRR2 homolog | O75643 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.44186455358396 |
| Butyrate-induced protein 1 | Q9P035 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.2056990374798 |
| Calcium load-activated calcium channel | Q9UM00 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.81926351822474 |
| Caprin-1 | Q14444 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.45519700195247 |
| CCR4-NOT transcription complex subunit 1 | A5YKK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.12806569329265 |
| Cell cycle and apoptosis regulator protein 2 | Q8N163 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.81106508699796 |
| Cell cycle control protein TS11 | P08243 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Cell division cycle 5-like protein | Q99459 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.83282116812715 |
| Chloride intracellular channel protein 1 | O00299 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.05343708596043 |
| Chromatin assembly factor 1 subunit B | Q13112 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Chromatin target of PRMT1 protein | Q9Y3Y2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.36523899948876 |
| Chromodomain-helicase-DNA-binding protein 4 | Q14839 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.64336674460226 |
| CLE7 homolog | Q9Y224 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.60562707654977 |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.53800170912118 |
| Cleavage stimulation factor subunit 3 | Q12996 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.22085616396088 |
| Coatomer subunit alpha | P53621 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Coatomer subunit alpha | P53621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.91967950016876 |
| Coatomer subunit beta | P53618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.39454706729438 |
| Coatomer subunit beta' | P35606 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Coatomer subunit beta' | P35606 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.47716957533793 |
| Coatomer subunit gamma-1 | Q9Y678 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.49998106366671 |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.11490835050441 |
| Copine-1 | Q99829 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.56752679475819 |
| CPSF 100 kDa subunit | Q9P2I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.24257811785105 |
| CPSF 25 kDa subunit | O43809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.64508830213418 |
| CPSF 59 kDa subunit | Q8N684 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.47250856691706 |
| CPSF 68 kDa subunit | Q16630 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.74866731757562 |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.88107724262462 |
| CUGBP Elav-like family member 1 | Q92879 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.89723655256278 |
| Cullin-associated NEDD8-dissociated protein 1 | Q86VP6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.9978379449332 |
| Cyclin-dependent kinase 1 | P06493 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.03548315212869 |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.93259225453771 |
| Cytoskeleton-associated protein 4 | Q07065 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.03149577204725 |
| Cytoskeleton-associated protein 5 | Q14008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.14932440889545 |
| DAZ-associated protein 1 | Q96EP5 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| DAZ-associated protein 1 | Q96EP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.64894856142283 |
| DBIRD complex subunit ZNF326 | Q5BKZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.81832090300076 |
| DDOST 48 kDa subunit | P39656 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.84646122228725 |
| Death inducer with SAP domain | Q8IX12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25259126182814 |
| Death-inducer obliterator 1 | Q9BTC0 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Delta(14)-sterol reductase LBR | Q14739 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Delta(24)-sterol reductase | Q15392 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.43707856036904 |
| Density-regulated protein | O43583 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.53495304798796 |
| Deubiquitinating enzyme FAF-X | Q93008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26991884492441 |
| Developmentally-regulated GTP-binding protein 1 | Q9Y295 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.27847845122079 |
| Disks large-associated protein 1 | O14490 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| DNA ligase 3 | P49916 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.18227277453104 |
| DNA mismatch repair protein Msh6 | P52701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.07934738791576 |
| DNA replication licensing factor MCM2 | P49736 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.23301985107462 |
| DNA replication licensing factor MCM3 | P25205 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.47116664588097 |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.88583984268481 |
| DNA replication licensing factor MCM5 | P33992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.95912840262075 |
| DNA replication licensing factor MCM6 | Q14566 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.19274335819442 |
| DNA replication licensing factor MCM7 | P33993 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.40358683394066 |
| DNA topoisomerase 1 | P11387 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.09240704672536 |
| DNA topoisomerase 2-alpha | P11388 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.79166198121328 |
| DNA topoisomerase 2-beta | Q02880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.24926935493216 |
| DNA topoisomerase 3-beta-1 | O95985 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.579064264353371 |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 5.72833632632013 |
| DNA-directed RNA polymerase II subunit RPB1 | P24928 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.9415082559108 |
| DNA-directed RNA polymerase II subunit RPB2 | P30876 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25273051781411 |
| Double-stranded RNA-binding protein Staufen homolog 1 | O95793 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.31614284531245 |
| E1A-binding protein p400 | Q96L91 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.21293969197874 |
| E3 ubiquitin-protein ligase HUWE1 | Q7Z6Z7 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| E3 ubiquitin-protein ligase TRIM56 | Q9BRZ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.86957928513293 |
| E3 ubiquitin-protein ligase TRIM71 | Q2Q1W2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.08940238606561 |
| E3 ubiquitin-protein ligase UBR4 | Q5T4S7 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| E3 ubiquitin-protein ligase UBR4 | Q5T4S7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.30465705618596 |
| E3 ubiquitin/ISG15 ligase TRIM25 | Q14258 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.560059479709686 |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.03337718698276 |
| eIF-2-alpha kinase activator GCN1 | Q92616 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.2340551994712 |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.02816422139884 |
| eIF-4-gamma 2 | P78344 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.63318473374328 |
| eIF3a | Q14152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.48912671357653 |
| eIF3b | P55884 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| eIF3b | P55884 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.0490376236543 |
| eIF3c | Q99613 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.06355471273041 |
| eIF3d | O15371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.28296163113026 |
| eIF3f | O00303 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.20361463830768 |
| eIF3g | O75821 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.09038600282226 |
| eIF3i | Q13347 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| eIF3j | O75822 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| eIF3l | Q9Y262 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.86500422415222 |
| ELAV-like protein 1 | Q15717 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.80421763921674 |
| Elongation factor 1-alpha 1 | P68104 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Elongation factor 1-alpha 1 | P68104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.42202304097817 |
| Elongation factor 1-delta | P29692 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.60675438747289 |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.51529279840396 |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.47485503028765 |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.34661812599815 |
| Endoplasmic reticulum P5A-ATPase | Q9HD20 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Endoplasmin | P14625 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Endothelial differentiation-related factor 1 | O60869 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Enhancer of mRNA-decapping protein 4 | Q6P2E9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.19377174339668 |
| Ephrin type-A receptor 2 | P29317 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| eRF3a | P15170 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.08810088053602 |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.75408823406631 |
| Eukaryotic initiation factor 4A-III | P38919 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.22443040688106 |
| Eukaryotic release factor 1 | P62495 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.0922615719798 |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Eukaryotic translation initiation factor 2A | Q9BY44 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Eukaryotic translation initiation factor 3 subunit C-like protein | B5ME19 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0 |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.59112645338926 |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.69338659261418 |
| Eukaryotic translation initiation factor 5A-1 | P63241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26791269088043 |
| Eukaryotic translation initiation factor 5B | O60841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.34659386589051 |
| Exosome complex exonuclease RRP44 | Q9Y2L1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.02568795906147 |
| Exosome RNA helicase MTR4 | P42285 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.0437294521924 |
| Exportin-1 | O14980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.44289839019522 |
| Exportin-2 | P55060 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.6220143235447 |
| Extended synaptotagmin-1 | Q9BSJ8 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Extended synaptotagmin-1 | Q9BSJ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.44283736265457 |
| Ezrin | P15311 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.02850711897871 |
| FACT complex subunit SPT16 | Q9Y5B9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.07924497251389 |
| Factor for adipocyte differentiation 104 | Q53EP0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.39438243308752 |
| Far upstream element-binding protein 1 | Q96AE4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.80450413637148 |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.29777196818228 |
| Far upstream element-binding protein 3 | Q96I24 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Far upstream element-binding protein 3 | Q96I24 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.58742260156817 |
| Fascin | Q16658 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.2573099118329 |
| Fatty acid CoA ligase Acsl3 | O95573 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Fatty acid CoA ligase Acsl3 | O95573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.90114686887069 |
| FAU ubiquitin-like and ribosomal protein S30 | P62861 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Felix-ina | Q7Z2K6 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Fibronectin | P02751 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.3067663250386 |
| Filamin-B | O75369 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Filamin-C | Q14315 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Flap endonuclease 1 | P39748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25945328344214 |
| FMR1-interacting protein NUFIP2 | Q7Z417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.35105017421221 |
| Fragile X mental retardation 1 | G3V0J0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.33788374856196 |
| G-rich sequence factor 1 | Q12849 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Gamma-adducin | Q9UEY8 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| GAP-associated tyrosine phosphoprotein p62 | Q07666 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| GAP-associated tyrosine phosphoprotein p62 | Q07666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.42701073709977 |
| Gem-associated protein 5 | Q8TEQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.06463456530018 |
| General transcription factor II-I | P78347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.02201619649978 |
| Glucose-6-phosphate isomerase | P06744 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.28360522845302 |
| Glutamate dehydrogenase 1 | P00367 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Glutamine--tRNA ligase | P47897 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.85582628889242 |
| Glutathione S-transferase P | P09211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.01537597146074 |
| Glycogen debranching enzyme | P35573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.32302412667909 |
| GRB10-interacting GYF protein 2 | Q6Y7W6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.33132400117833 |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.37908796050025 |
| Heat shock 70 kDa protein 1B | P0DMV9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.69686837626371 |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.94437871679561 |
| Heat shock protein 105 kDa | Q92598 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.23441547979951 |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.80888954528568 |
| Helicase with zinc finger | J3QS41 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.875213880905899 |
| Helix-destabilizing protein | F8W6I7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.10221166882329 |
| Hematopoietic PBX-interacting protein | Q96AQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0 |
| Hemoglobin subunit alpha | P69905 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Hepatoma-derived growth factor | P51858 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26292619964794 |
| Heterogeneous nuclear ribonucleoprotein A/B | Q99729 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.85161456403835 |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.11785554358503 |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.15193076112075 |
| Heterogeneous nuclear ribonucleoprotein D-like | O14979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.80340684538483 |
| Heterogeneous nuclear ribonucleoprotein D0 | Q14103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.18979356054911 |
| Heterogeneous nuclear ribonucleoprotein F | P52597 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.19455752260713 |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.70019111742857 |
| Heterogeneous nuclear ribonucleoprotein H2 | P55795 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.58642849559154 |
| Heterogeneous nuclear ribonucleoprotein H3 | P31942 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.77850829932584 |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.87514387963878 |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.70691499549112 |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.23939124035054 |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.88802780998194 |
| Heterogeneous nuclear ribonucleoprotein R | O43390 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.40720697829095 |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.9228533842755 |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.76520392798514 |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.55193538722674 |
| hFLVCR | Q9Y5Y0 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| High mobility group protein B1 | P09429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.74772252145151 |
| Histone H1.0 | P07305 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Histone-lysine N-methyltransferase 2D | O14686 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Histone-lysine N-methyltransferase NSD2 | O96028 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| hLAT1 3-transmembrane protein IMAA | Q9GIP4 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| HTH La-type RNA-binding protein | A0A087WTL9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.82948427435321 |
| Human gene expressed in odontoblasts | Q9Y2H6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.01588288364734 |
| IGF2 mRNA-binding protein 1 | Q9NZI8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.68978853125775 |
| IGF2 mRNA-binding protein 2 | Q9Y6M1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.62180925053857 |
| IGF2 mRNA-binding protein 3 | O00425 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.602887970924 |
| Importin subunit alpha-1 | P52292 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.98590979732222 |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.10086972673817 |
| Importin-5 | O00410 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.17876562452782 |
| Interferon-inducible protein 4 | P55265 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.71456644726456 |
| Interleukin enhancer-binding factor 2 | Q12905 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.81401508121283 |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.00782718300481 |
| Isocitrate dehydrogenase [NADP] cytoplasmic | O75874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.50454355367816 |
| Isoleucine--tRNA ligase | Q9NSE4 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Keratin | P35908 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Keratin | P35527 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Keratin | P05787 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Keratin | P04264 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Keratin | P02538 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.09462118760672 |
| Keratin-10 | P13645 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| KH domain-containing RNA-binding protein QKI | Q96PU8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.91176443373597 |
| Kinectin | Q86UP2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.11382716276219 |
| Kinesin-1 heavy chain | P33176 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26419135583342 |
| Kinesin-like protein KIF1C | O43896 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.05707590273948 |
| L-lactate dehydrogenase A chain | P00338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.07289745889482 |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.03344414622584 |
| La-related protein 4B | Q92615 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.03618680284785 |
| Lamina-associated polypeptide 2 | P42166 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.03179745730011 |
| Leucine-rich repeat-containing protein 47 | Q8N1G4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.28774414157383 |
| Leucine-rich repeat-containing protein 59 | Q96AG4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.63625106641462 |
| LINE-1 retrotransposable element ORF1 protein | Q9UN81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.30015008829842 |
| Long-chain fatty acid transport protein 4 | Q6P1M0 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Long-chain-fatty-acid--CoA ligase 4 | O60488 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Long-chain-fatty-acid--CoA ligase 4 | O60488 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.796356869482335 |
| Luc7-like protein 3 | O95232 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.43775506796701 |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.56090430845172 |
| Lysine-specific demethylase 3B | Q7LBC6 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Lysophosphatidylserine lipase ABHD12 | Q8N2K0 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Lysophospholipid acyltransferase 7 | Q96N66 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Lysyl hydroxylase 1 | Q02809 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Magnesium transporter protein 1 | Q9H0U3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.06776948960177 |
| Mannosyl-oligosaccharide glucosidase | Q13724 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| MAP activator with WD repeats | Q9Y3F4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.45865497739126 |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.56149039010511 |
| Metallothionein-1E | P04732 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Methionine--tRNA ligase | P56192 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.47238898896105 |
| Microsomal triglyceride transfer protein large subunit | P55157 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Microsomal triglyceride transfer protein large subunit | P55157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.795991312628343 |
| Microtubule-associated protein | E7EVA0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.13868998030811 |
| Microtubule-associated protein 2 | P11137 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Midasin | Q9NU22 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.50733797873222 |
| Minor histocompatibility antigen H13 | Q8TCT9 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Mitotic checkpoint protein BUB3 | O43684 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Monocarboxylate transporter 1 | P53985 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Monocarboxylate transporter 2 | O60669 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Monocarboxylate transporter 4 | O15427 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| mRNA cap guanine-N7 methyltransferase | O43148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.16930290547436 |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Myb-binding protein 1A | Q9BQG0 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Myosin-10 | P35580 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.80367341741225 |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.77629110283154 |
| NAD(P) transhydrogenase | Q13423 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| NAD(P)H dehydrogenase [quinone] 1 | P15559 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| NADPH--cytochrome P450 reductase | P16435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.33805923764553 |
| Neutral alpha-glucosidase AB | Q14697 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Neutral alpha-glucosidase AB | Q14697 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.00426406960675 |
| Neutral cholesterol ester hydrolase 1 | Q6PIU2 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| NF-X1-type zinc finger protein NFXL1 | Q6ZNB6 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.38429862418719 |
| Nuclear mitotic apparatus protein 1 | Q14980 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nuclear pore complex protein Nup214 | P35658 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nuclear receptor coactivator 5 | Q9HCD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.67045514288562 |
| Nuclear RNA export factor 1 | Q9UBU9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.91696956064696 |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.12258658520574 |
| Nucleolin | P19338 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.90911594422563 |
| Nucleolysin TIA-1 isoform p40 | P31483 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.19022924724471 |
| Nucleolysin TIAR | Q01085 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleolysin TIAR | Q01085 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.99996032534085 |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.64947290685349 |
| Nucleoporin NDC1 | Q9BTX1 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleoprotein TPR | P12270 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.15098202545821 |
| Nucleoside diphosphate kinase | Q32Q12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.44056955413007 |
| Nucleosome assembly protein 1-like 1 | P55209 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.11610814284959 |
| Obg-like ATPase 1 | Q9NTK5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.02277259866035 |
| Oligosaccharyl transferase subunit STT3A | P46977 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.51372822750143 |
| Oligosaccharyl transferase subunit STT3B | Q8TCJ2 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Oligosaccharyl transferase subunit STT3B | Q8TCJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.2053768722388 |
| Oxidative stress-associated Src activator | Q9NZB2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.01585434537976 |
| Oxysterol-binding protein-related protein 8 | Q9BZF1 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| P0DN76 | P0DN76 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26283000955792 |
| p59scr | Q86XZ4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.25031585332725 |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.32271847522533 |
| Paired amphipathic helix protein Sin3a | Q96ST3 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| PAPS transporter 1 | Q8TB61 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Paraspeckle component 1 | Q8WXF1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.12306025648165 |
| PDHE1-A type I | P08559 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| PDZ and LIM domain protein 5 | Q96HC4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.953734574092043 |
| Peptidyl-prolyl cis-trans isomerase A | P62937 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.19311528043151 |
| Peptidyl-prolyl cis-trans isomerase B | P23284 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.10806941336915 |
| Peptidyl-prolyl cis-trans isomerase FKBP11 | Q9NYL4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.649367133207797 |
| Peptidyl-prolyl cis-trans isomerase-like 4 | Q8WUA2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.01319066811885 |
| Pericentriolar material 1 protein | Q15154 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Perlecan (PLC) | P98160 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.23812982298904 |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Phosphate carrier protein | Q00325 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Phosphatidylserine synthase 2 | Q9BVG9 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Phosphoglycerate mutase 1 | P18669 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26282399746435 |
| Phospholipase A2 | P04054 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Phospholipase D1 | Q13393 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Pinin | Q9H307 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.75692080298581 |
| Plakophilin-4 | Q99569 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.88583789081666 |
| Poly(rC)-binding protein 2 | Q15366 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.49713733164127 |
| Poly(U)-binding-splicing factor | Q9UHX1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.84731032962884 |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.39200289972486 |
| Polyadenylate-binding protein 2 | Q86U42 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.1044842768712 |
| Polyadenylate-binding protein 4 | Q13310 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.17962410472463 |
| Polycomb protein SUZ12 | Q15022 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Polymerase delta-interacting protein 2 | Q9Y2S7 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Polymerase delta-interacting protein 3 | Q9BY77 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.62250403713137 |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.65086978036651 |
| Polypyrimidine tract-binding protein 3 | O95758 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.24165716624313 |
| PP-1A | P62136 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.2309530689741 |
| pre-mRNA 3' end processing protein WDR33 | Q9C0J8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.11081756395649 |
| Pre-mRNA 3'-end-processing factor FIP1 | Q6UN15 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.13887343343466 |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.14968209516425 |
| Pre-mRNA-processing factor 40 homolog A | O75400 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.0880228376857 |
| Pre-mRNA-processing factor 6 | O94906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.21934202073465 |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.95376796323811 |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.7568008784133 |
| Probable ATP-dependent RNA helicase DDX20 | Q9UHI6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0 |
| Probable ATP-dependent RNA helicase DDX23 | Q9BUQ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.5503096787551 |
| Probable ATP-dependent RNA helicase DDX46 | Q7L014 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.77087343596621 |
| Probable ATP-dependent RNA helicase DDX5 | J3KTA4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.4187936874623 |
| Probable ATP-dependent RNA helicase DDX6 | P26196 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.34471063422208 |
| Probable global transcription activator SNF2L1 | P28370 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.31418025295621 |
| Procollagen galactosyltransferase 1 | Q8NBJ5 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.00287554817703 |
| Programmed cell death 6-interacting protein | Q8WUM4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.63853869710802 |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.05941065832086 |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.68872644232931 |
| Prolyl 3-hydroxylase 1 | Q32P28 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein AHNAK2 | Q8IVF2 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein arginine N-methyltransferase 1 | Q99873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.38052444270781 |
| Protein argonaute-2 | Q9UKV8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.846521397346562 |
| Protein disulfide-isomerase | P07237 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein disulfide-isomerase | P07237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.32746284645175 |
| Protein disulfide-isomerase A3 | P30101 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein disulfide-isomerase A3 | P30101 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.68337858440321 |
| Protein disulfide-isomerase A4 | P13667 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25702365836923 |
| Protein disulfide-isomerase A6 | Q15084 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.32379085379689 |
| Protein FAM98A | Q8NCA5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.6020387297388 |
| Protein jagunal homolog 1 | Q8N5M9 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein kinase C iota type | P41743 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein lin-28 homolog B | Q6ZN17 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein lin-28 homolog B | Q6ZN17 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.76080429484712 |
| Protein LSM12 | Q3MHD2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.946176878653137 |
| Protein LSM14 homolog A | Q8ND56 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.18651323504961 |
| Protein LSM14 homolog B | Q9BX40 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.13219514423391 |
| Protein NDRG1 | Q92597 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein PRRC2A | P48634 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.3898558724576 |
| Protein PRRC2C | Q9Y520 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.73974335232551 |
| Protein RCC2 | Q9P258 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein SON | P18583 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.57872621683621 |
| Protein TRAM1 | Q15629 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein TRAM1 | Q15629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.494773999429494 |
| Protein transport protein Sec16A | O15027 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein transport protein Sec24C | P53992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.686092593014363 |
| Protein transport protein Sec61 subunit beta | P60468 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.990620914973486 |
| Proto-oncogene tyrosine-protein kinase Src | P12931 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Pumilio homolog 1 | Q14671 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.76974635436264 |
| Pumilio homolog 2 | Q8TB72 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.734308590096907 |
| Putative ATP-dependent RNA helicase DHX57 | Q6P158 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.39231192678718 |
| Putative RNA-binding protein Luc7-like 2 | Q9Y383 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.30733817176445 |
| Pyruvate carboxylase | P11498 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Rab GDP dissociation inhibitor beta | P50395 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.71402014913415 |
| Rab11 family-interacting protein 1 | Q6WKZ4 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Radixin | P35241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.6776796190696 |
| Ran-specific GTPase-activating protein | P43487 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.06739964135513 |
| Ras GTPase-activating protein-binding protein 1 | Q13283 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.97397672421779 |
| Ras GTPase-activating protein-binding protein 2 | Q9UN86 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ras GTPase-activating protein-binding protein 2 | Q9UN86 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.54081091407912 |
| Ras-related protein Rab-1A | P62820 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ras-related protein Rab-1A | P62820 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.964465173937624 |
| Ras-related protein Rab-1B | Q9H0U4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.162893188549 |
| Ras-related protein Rab-7a | P51149 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.01697404883689 |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.68790052248075 |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.13492239879604 |
| Retinol-binding protein 2 | P50120 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Retrotransposon-derived protein PEG10 | Q86TG7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.14275977381771 |
| Rho GTPase-activating protein 5 | Q13017 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.53336898242241 |
| RIBIIR | P04844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.28407208870905 |
| Ribonucleoprotein | E9PAU2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.57260837608406 |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.62163345047195 |
| Ribosomal L1 domain-containing protein 1 | O76021 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ribosomal protein S6 kinase alpha-3 | P51812 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.87775125210066 |
| Ribosome-binding protein 1 | Q9P2E9 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| RNA helicase aquarius | O60306 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.26603089525087 |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.56443881925061 |
| RNA-binding protein 10 | A0A0A0MR66 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.17011734795828 |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.31200000984772 |
| RNA-binding protein 12B | Q8IXT5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.20876070575765 |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.922551695717 |
| RNA-binding protein 15 | Q96T37 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.91892046701712 |
| RNA-binding protein 25 | P49756 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.83737008554809 |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.76881289650496 |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.25004899251383 |
| RNA-binding protein 4 | Q9BWF3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.19196369449474 |
| RNA-binding protein 47 | A0AV96 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.78593131439272 |
| RNA-binding protein 6 | P78332 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.14465334887574 |
| RNA-binding protein EWS | Q01844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.83340210658614 |
| RNA-binding protein FUS | P35637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.42481865105936 |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.01074582941222 |
| RNA-binding protein FXR2 | P51116 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.69818068756661 |
| RNA-binding protein Raly | Q9UKM9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.12206636135439 |
| RNA-splicing ligase RtcB homolog | Q9Y3I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.0071829405718 |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.42709121574348 |
| rRNA 2'-O-methyltransferase fibrillarin | P22087 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| RuvB-like 2 | Q9Y230 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.02242549444794 |
| SAFB-like transcription modulator | Q9NWH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.46947446304784 |
| SART-3 | Q15020 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.16342788391181 |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.5542450195501 |
| Scaffold attachment factor B2 | Q14151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.77343938796025 |
| Scaffold-attachment factor A2 | Q1KMD3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.61833851295261 |
| Sec1 family domain-containing protein 1 | Q8WVM8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.71034910608697 |
| Sec61 alpha-1 | P61619 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.94887739982734 |
| SERCA2 | P16615 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.72803586555009 |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.43386753590545 |
| Serine/arginine-rich splicing factor 10 | O75494 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.29455899654663 |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.18927741680253 |
| Serine/arginine-rich splicing factor 3 | P84103 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serine/arginine-rich splicing factor 3 | P84103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.77480195983807 |
| Serine/arginine-rich splicing factor 6 | Q13247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.31128221857584 |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.22925566472991 |
| Serine/arginine-rich splicing factor 9 | Q13242 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.40834066126236 |
| Serotransferrin | P02787 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serrate RNA effector molecule homolog | Q9BXP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.02048975588782 |
| Signal recognition particle subunit SRP68 | Q9UHB9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.04362097743397 |
| Signal recognition particle subunit SRP72 | O76094 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.53336399833981 |
| Single-stranded DNA-binding protein MSSP-1 | P29558 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.08408468013989 |
| Small nuclear ribonucleoprotein Sm D1 | P62314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.01821397964867 |
| SMC protein 1A | Q14683 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.19302103134813 |
| snRNP-N | P63162 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.12497654025234 |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.31414979289644 |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.31422086536886 |
| SPATS2-like protein | Q9NUQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.99516428644634 |
| Spermatid perinuclear RNA-binding protein | Q96SI9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.0833563539459 |
| Spliceosome RNA helicase DDX39B | Q13838 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.65829200059914 |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.54855419606751 |
| Splicing factor 1 | Q15637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.13098686375282 |
| Splicing factor 3A subunit 1 | Q15459 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.73050736316103 |
| Splicing factor 3A subunit 3 | Q12874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.82213459471669 |
| Splicing factor 3B subunit 1 | O75533 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.68066304657607 |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.71686581884291 |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.53373401965651 |
| Splicing factor U2AF 65 kDa subunit | P26368 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.50744962043986 |
| SR-beta | Q9Y5M8 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Src substrate cortactin | Q14247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.35397249900263 |
| Sterol regulatory element-binding protein 2 | Q12772 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Stress-70 protein | P38646 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Structural maintenance of chromosomes protein 3 | Q9UQE7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.32466661469429 |
| Sucrose nonfermenting protein 2 homolog | O60264 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.24787891658162 |
| Surfeit locus protein 4 | O15260 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.45887541807418 |
| SURP and G-patch domain-containing protein 2 | Q8IX01 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.41445557007093 |
| Symplekin | Q92797 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.71361224167345 |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.17453780813534 |
| Talin-1 | Q9Y490 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.99576617612387 |
| TAR DNA-binding protein 43 | Q13148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.27353155032983 |
| TATA-binding protein-associated factor 2N | Q92804 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25757189243717 |
| Thioredoxin reductase 2 | Q9NNW7 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Thioredoxin-related transmembrane protein 2 | Q9Y320 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.21151066288354 |
| THO complex subunit 4 | Q86V81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.57106028710404 |
| Thyroid hormone receptor-associated protein 3 | Q9Y2W1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.69014439928152 |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.11247328656265 |
| TP-beta | P55084 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| TP53-binding protein 1 | Q12888 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Transcription elongation factor SPT5 | O00267 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.98546399815193 |
| Transcription elongation factor SPT6 | Q7KZ85 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.49470744819779 |
| Transcription elongation regulator 1 | O14776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.69926732962713 |
| Transcription intermediary factor 1-beta | Q13263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.28041145701927 |
| Transcriptional activator protein Pur-alpha | Q00577 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.39050260803321 |
| Transcriptional activator protein Pur-beta | Q96QR8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.02957303174885 |
| Transformer-2 protein homolog alpha | Q13595 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.37053816078505 |
| Transformer-2 protein homolog beta | P62995 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.49465881266387 |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.18000871653448 |
| Transketolase | P29401 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.37137764315802 |
| Translation machinery-associated protein 7 | Q9Y2S6 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Translocation protein SEC63 homolog | Q9UGP8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.41306326361892 |
| Translocon-associated protein subunit delta | P51571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.942563298102506 |
| Translocon-associated protein subunit gamma | Q9UNL2 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Transmembrane protein 214 | Q6NUQ4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.05098222553615 |
| Transportin-1 | Q92973 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.56165606709526 |
| Transportin-2 | O14787 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.333767191658224 |
| Transportin-3 | Q9Y5L0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.01088723140921 |
| Trinucleotide repeat-containing gene 6B protein | Q9UPQ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.527821022395033 |
| Trip4 complex subunit p200 | Q8N3C0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.7546010720495 |
| Tubulin alpha-1B chain | P68363 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0 |
| Tubulin beta-2A chain | Q13885 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.985944828507132 |
| Tubulin beta-4B chain | P68371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.41885589044417 |
| U1 small nuclear ribonucleoprotein 70 kDa | P08621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.70874566174228 |
| U1 small nuclear ribonucleoprotein A | P09012 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.64313119765291 |
| U4/U6.U5 tri-snRNP-associated protein 1 | O43290 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.17009811446065 |
| U4/U6.U5 tri-snRNP-associated protein 2 | Q53GS9 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| U4/U6.U5 tri-snRNP-associated protein 2 | Q53GS9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.42125831403575 |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.09773888068715 |
| Ubiquitin carboxyl-terminal hydrolase 5 | P45974 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.51876006952924 |
| Ubiquitin carboxyl-terminal hydrolase 7 | Q93009 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.07422454246435 |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.76033593159957 |
| Ubiquitin-associated protein 2 | Q5T6F2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.73181319673034 |
| Ubiquitin-associated protein 2-like | Q14157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.08509657919857 |
| Ubiquitin-like modifier-activating enzyme 1 | P22314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.71186489396194 |
| UBX domain-containing protein 4 | Q92575 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| UDP-glucose:glycoprotein glucosyltransferase 1 | Q9NYU2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.536609971449174 |
| Unconventional myosin-Ib | O43795 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Valine--tRNA ligase | P26640 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.37616394747261 |
| Very-long-chain enoyl-CoA reductase | Q9NZ01 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Vesicle-trafficking protein SEC22b | O75396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.15804613190633 |
| Vigilin | Q00341 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.79205698875798 |
| Villin-1 | P09327 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Villin-1 | P09327 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.31157646516119 |
| Vinculin | P18206 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.00573878888138 |
| WD repeat-containing protein 1 | O75083 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.50995927755414 |
| WD40 repeat-containing protein SMU1 | Q2TAY7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.03307406942903 |
| Wolframin | O76024 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| WW domain-binding protein 11 | Q9Y2W2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.03475803291716 |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.08722609484274 |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 4.24695982398612 |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.89959428629373 |
| Y-box-binding protein 3 | P16989 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.66592936107334 |
| YLP motif-containing protein 1 | P49750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.29494564031061 |
| YTH domain-containing family protein 2 | Q9Y5A9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.24057689120397 |
| YTH domain-containing family protein 3 | Q7Z739 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.90777133248919 |
| YTH domain-containing protein 1 | Q96MU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.10361848867651 |
| Zinc finger CCCH domain-containing protein 11A | O75152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.22052188866222 |
| Zinc finger CCCH domain-containing protein 14 | Q6PJT7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.13932541480362 |
| Zinc finger CCCH domain-containing protein 4 | Q9UPT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.25024004561576 |
| Zinc finger CCCH domain-containing protein 7B | Q9UGR2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 1.09008107710496 |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.49033137289934 |
| Zinc finger CCHC domain-containing protein 3 | Q9NUD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.999963932173128 |
| Zinc finger MYM-type protein 2 | Q9UBW7 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Zinc finger protein 638 | Q14966 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 3.42276852872669 |
| Zinc finger protein 9 | P62633 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | UV cross-linking (UVX) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 2.70949136372918 |
| Zinc transporter SLC39A7 | Q92504 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5.1 Cells (Human hepatocellular carcinoma cell) | . | Liver | 48 h | . | FC = 0.911967632650899 |
Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| GO Term | GO Category | GO ID | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|---|
| RNA Binding | Molecular Function |
GO:0003723
|
8.14E-279 | 27.98202252 | 18089.55077 |
| mRNA Binding | Molecular Function |
GO:0003729
|
3.16E-91 | 24.83591731 | 5310.856852 |
| Cadherin Binding | Molecular Function |
GO:0045296
|
6.26E-36 | 9.658142106 | 831.6232083 |
| mRNA 3'-UTR Binding | Molecular Function |
GO:0003730
|
4.12E-34 | 25.83670062 | 2109.105748 |
| mRNA 5'-UTR Binding | Molecular Function |
GO:0048027
|
3.16E-19 | 80.07677357 | 3774.36243 |
| Ribosome Binding | Molecular Function |
GO:0043022
|
2.72E-15 | 13.09263283 | 496.105322 |
| DNA Binding | Molecular Function |
GO:0003677
|
1.18E-13 | 3.249880012 | 110.3948238 |
| Poly-Purine Tract Binding | Molecular Function |
GO:0070717
|
1.54E-13 | 30.79290254 | 1033.775984 |
| miRNA Binding | Molecular Function |
GO:0035198
|
1.23E-12 | 30.60575296 | 960.2896177 |
| Single-Stranded RNA Binding | Molecular Function |
GO:0003727
|
2.35E-12 | 19.48613469 | 596.704264 |
| N6-methyladenosine-containing RNA Binding | Molecular Function |
GO:1990247
|
8.27E-12 | 292.8624161 | 8571.303604 |
| Regulatory RNA Binding | Molecular Function |
GO:0061980
|
2.47E-11 | 18.23728814 | 512.2132464 |
| Single-Stranded DNA Binding | Molecular Function |
GO:0003697
|
2.98E-11 | 9.263013699 | 257.6666461 |
| poly Binding | Molecular Function |
GO:0008143
|
5.96E-11 | 30.17045012 | 814.0720389 |
| Poly-Pyrimidine Tract Binding | Molecular Function |
GO:0008187
|
5.96E-11 | 30.17045012 | 814.0720389 |
| Translation Initiation Factor Activity | Molecular Function |
GO:0003743
|
2.24E-10 | 16.99266779 | 434.8816773 |
| snRNA Binding | Molecular Function |
GO:0017069
|
6.82E-09 | 14.17483108 | 313.4940211 |
| pre-mRNA Binding | Molecular Function |
GO:0036002
|
1.49E-08 | 18.88499025 | 401.8294698 |
| Double-Stranded RNA Binding | Molecular Function |
GO:0003725
|
1.72E-08 | 9.836440678 | 207.3439434 |
| poly RNA Binding | Molecular Function |
GO:0008266
|
1.63E-07 | 22.51393908 | 422.7750544 |
| Nucleus | Cellular Component |
GO:0005634
|
1.14E-65 | 4.398749098 | 681.8711364 |
| Intracellular Membrane-Bounded Organelle | Cellular Component |
GO:0043231
|
3.78E-60 | 4.058005466 | 574.6436823 |
| Cytoplasmic Stress Granule | Cellular Component |
GO:0010494
|
5.25E-42 | 42.48051405 | 4223.728463 |
| Intracellular Non-Membrane-Bounded Organelle | Cellular Component |
GO:0043232
|
4.15E-28 | 4.02678387 | 270.3526735 |
| Focal Adhesion | Cellular Component |
GO:0005925
|
1.31E-26 | 6.841789668 | 434.1830182 |
| Ribosome | Cellular Component |
GO:0005840
|
1.58E-26 | 30.4647895 | 1922.145509 |
| Cell-Substrate Junction | Cellular Component |
GO:0030055
|
3.07E-26 | 6.674126395 | 415.6429597 |
| Nuclear Lumen | Cellular Component |
GO:0031981
|
8.48E-22 | 4.199800577 | 218.0363889 |
| Cytosolic Small Ribosomal Subunit | Cellular Component |
GO:0022627
|
9.81E-22 | 38.48262165 | 1987.725971 |
| Nucleolus | Cellular Component |
GO:0005730
|
1.35E-21 | 4.190466313 | 214.6650662 |
| Small Ribosomal Subunit | Cellular Component |
GO:0015935
|
1.64E-21 | 36.55660377 | 1862.15301 |
| Cytosolic Large Ribosomal Subunit | Cellular Component |
GO:0022625
|
1.30E-17 | 22.46155546 | 938.7466656 |
| Large Ribosomal Subunit | Cellular Component |
GO:0015934
|
1.30E-17 | 22.46155546 | 938.7466656 |
| Spliceosomal snRNP Complex | Cellular Component |
GO:0097525
|
3.83E-14 | 16.5162116 | 557.0910491 |
| U2-type Spliceosomal Complex | Cellular Component |
GO:0005684
|
3.21E-13 | 10.72530522 | 338.2387636 |
| Ficolin-1-Rich Granule Lumen | Cellular Component |
GO:1904813
|
3.35E-11 | 7.625171821 | 204.5346492 |
| Small-Subunit Processome | Cellular Component |
GO:0032040
|
5.76E-11 | 10.78271643 | 282.7399579 |
| Polysomal Ribosome | Cellular Component |
GO:0042788
|
1.37E-10 | 24.50969646 | 620.0732821 |
| Cytoplasmic Vesicle Lumen | Cellular Component |
GO:0060205
|
3.02E-09 | 6.945569051 | 153.8339642 |
| Ficolin-1-Rich Granule | Cellular Component |
GO:0101002
|
4.13E-09 | 5.214703969 | 113.6027648 |
| Gene Expression | Biological Process |
GO:0010467
|
2.16E-53 | 14.31930279 | 1847.85397 |
| mRNA Processing | Biological Process |
GO:0006397
|
3.58E-51 | 17.90015977 | 2206.123112 |
| mRNA Splicing, Via Spliceosome | Biological Process |
GO:0000398
|
4.27E-48 | 17.04803948 | 1973.391642 |
| RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile | Biological Process |
GO:0000377
|
1.66E-44 | 18.1635566 | 1947.145257 |
| Regulation Of Translation | Biological Process |
GO:0006417
|
1.37E-43 | 16.10247153 | 1688.654629 |
| Cytoplasmic Translation | Biological Process |
GO:0002181
|
2.06E-42 | 33.87538538 | 3454.394654 |
| RNA Processing | Biological Process |
GO:0006396
|
8.96E-42 | 16.79352771 | 1685.263127 |
| Translation | Biological Process |
GO:0006412
|
1.47E-40 | 13.37827552 | 1303.280385 |
| protein-RNA Complex Assembly | Biological Process |
GO:0022618
|
7.82E-40 | 19.10193486 | 1826.737911 |
| Macromolecule Biosynthetic Process | Biological Process |
GO:0009059
|
4.11E-37 | 15.05234375 | 1343.600637 |
| Peptide Biosynthetic Process | Biological Process |
GO:0043043
|
1.15E-33 | 15.59326117 | 1266.620288 |
| Regulation Of mRNA Splicing, Via Spliceosome | Biological Process |
GO:0048024
|
7.07E-31 | 23.14443185 | 1729.373053 |
| Positive Regulation Of Translation | Biological Process |
GO:0045727
|
3.18E-28 | 18.5021416 | 1267.963245 |
| Regulation Of RNA Splicing | Biological Process |
GO:0043484
|
2.92E-24 | 16.92381786 | 1004.167746 |
| Negative Regulation Of Translation | Biological Process |
GO:0017148
|
1.67E-23 | 15.76057386 | 906.5270654 |
| mRNA Metabolic Process | Biological Process |
GO:0016071
|
3.43E-22 | 18.34624506 | 998.6329473 |
| Regulation Of Alternative mRNA Splicing, Via Spliceosome | Biological Process |
GO:0000381
|
2.84E-19 | 25.50945017 | 1215.655608 |
| RNA Metabolic Process | Biological Process |
GO:0016070
|
2.00E-18 | 12.44057971 | 567.8148661 |
| RNA Splicing | Biological Process |
GO:0008380
|
6.99E-18 | 13.39688042 | 594.0002413 |
| Spliceosomal Complex Assembly | Biological Process |
GO:0000245
|
1.79E-17 | 19.61353423 | 850.2115834 |
Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| Spliceosome | KEGG Pathway | 2.33E-37 | 17.94289465 | 1610.961298 |
| Ribosome | KEGG Pathway | 5.12E-27 | 12.8274795 | 837.3509075 |
| RNA transport | KEGG Pathway | 4.97E-22 | 9.650892639 | 515.2461209 |
| Coronavirus disease | KEGG Pathway | 4.14E-20 | 7.775122861 | 378.4824556 |
| mRNA surveillance pathway | KEGG Pathway | 3.36E-17 | 12.71377747 | 530.8694945 |
| Protein processing in endoplasmic reticulum | KEGG Pathway | 2.26E-13 | 7.124514339 | 233.393597 |
| DNA replication | KEGG Pathway | 2.96E-05 | 10.83221477 | 150.7204272 |
| Protein export | KEGG Pathway | 0.000102998 | 14.1777801 | 177.7196463 |
| Biosynthesis of unsaturated fatty acids | KEGG Pathway | 0.000298484 | 11.33988294 | 128.7449992 |
| Amyotrophic lateral sclerosis | KEGG Pathway | 0.001152013 | 2.531818786 | 25.05837555 |
| RNA degradation | KEGG Pathway | 0.002732987 | 4.707343807 | 42.07511805 |
| Non-homologous end-joining | KEGG Pathway | 0.009097397 | 14.33610649 | 109.6508898 |
| N-Glycan biosynthesis | KEGG Pathway | 0.012731085 | 5.268102979 | 38.1014563 |
| Fatty acid elongation | KEGG Pathway | 0.018934919 | 7.338257576 | 49.61698405 |
| Cell cycle | KEGG Pathway | 0.020892772 | 3.159947558 | 20.83676941 |
| Legionellosis | KEGG Pathway | 0.022826125 | 4.528929766 | 29.17075892 |
| Tight junction | KEGG Pathway | 0.026093535 | 2.708192568 | 16.91693166 |
| Pathogenic Escherichia coli infection | KEGG Pathway | 0.035163915 | 2.486921306 | 14.65066507 |
| Proteoglycans in cancer | KEGG Pathway | 0.047645603 | 2.381764867 | 13.17889556 |
| Central carbon metabolism in cancer | KEGG Pathway | 0.059165846 | 3.591973244 | 18.91317792 |
Virus RNA Sequence Information
|
>NC_001477.1 Dengue virus 1, complete genome
AGTTGTTAGTCTACGTGGACCGACAAGAACAGTTTCGAATCGGAAGCTTGCTTAACGTAGTTCTAACAGT
TTTTTATTAGAGAGCAGATCTCTGATGAACAACCAACGGAAAAAGACGGGTCGACCGTCTTTCAATATGC
TGAAACGCGCGAGAAACCGCGTGTCAACTGTTTCACAGTTGGCGAAGAGATTCTCAAAAGGATTGCTTTC
AGGCCAAGGACCCATGAAATTGGTGATGGCTTTTATAGCATTCCTAAGATTTCTAGCCATACCTCCAACA
GCAGGAATTTTGGCTAGATGGGGCTCATTCAAGAAGAATGGAGCGATCAAAGTGTTACGGGGTTTCAAGA
AAGAAATCTCAAACATGTTGAACATAATGAACAGGAGGAAAAGATCTGTGACCATGCTCCTCATGCTGCT
GCCCACAGCCCTGGCGTTCCATCTGACCACCCGAGGGGGAGAGCCGCACATGATAGTTAGCAAGCAGGAA
AGAGGAAAATCACTTTTGTTTAAGACCTCTGCAGGTGTCAACATGTGCACCCTTATTGCAATGGATTTGG
GAGAGTTATGTGAGGACACAATGACCTACAAATGCCCCCGGATCACTGAGACGGAACCAGATGACGTTGA
CTGTTGGTGCAATGCCACGGAGACATGGGTGACCTATGGAACATGTTCTCAAACTGGTGAACACCGACGA
GACAAACGTTCCGTCGCACTGGCACCACACGTAGGGCTTGGTCTAGAAACAAGAACCGAAACGTGGATGT
CCTCTGAAGGCGCTTGGAAACAAATACAAAAAGTGGAGACCTGGGCTCTGAGACACCCAGGATTCACGGT
GATAGCCCTTTTTCTAGCACATGCCATAGGAACATCCATCACCCAGAAAGGGATCATTTTTATTTTGCTG
ATGCTGGTAACTCCATCCATGGCCATGCGGTGCGTGGGAATAGGCAACAGAGACTTCGTGGAAGGACTGT
CAGGAGCTACGTGGGTGGATGTGGTACTGGAGCATGGAAGTTGCGTCACTACCATGGCAAAAGACAAACC
AACACTGGACATTGAACTCTTGAAGACGGAGGTCACAAACCCTGCCGTCCTGCGCAAACTGTGCATTGAA
GCTAAAATATCAAACACCACCACCGATTCGAGATGTCCAACACAAGGAGAAGCCACGCTGGTGGAAGAAC
AGGACACGAACTTTGTGTGTCGACGAACGTTCGTGGACAGAGGCTGGGGCAATGGTTGTGGGCTATTCGG
AAAAGGTAGCTTAATAACGTGTGCTAAGTTTAAGTGTGTGACAAAACTGGAAGGAAAGATAGTCCAATAT
GAAAACTTAAAATATTCAGTGATAGTCACCGTACACACTGGAGACCAGCACCAAGTTGGAAATGAGACCA
CAGAACATGGAACAACTGCAACCATAACACCTCAAGCTCCCACGTCGGAAATACAGCTGACAGACTACGG
AGCTCTAACATTGGATTGTTCACCTAGAACAGGGCTAGACTTTAATGAGATGGTGTTGTTGACAATGAAA
AAAAAATCATGGCTCGTCCACAAACAATGGTTTCTAGACTTACCACTGCCTTGGACCTCGGGGGCTTCAA
CATCCCAAGAGACTTGGAATAGACAAGACTTGCTGGTCACATTTAAGACAGCTCATGCAAAAAAGCAGGA
AGTAGTCGTACTAGGATCACAAGAAGGAGCAATGCACACTGCGTTGACTGGAGCGACAGAAATCCAAACG
TCTGGAACGACAACAATTTTTGCAGGACACCTGAAATGCAGATTAAAAATGGATAAACTGATTTTAAAAG
GGATGTCATATGTAATGTGCACAGGGTCATTCAAGTTAGAGAAGGAAGTGGCTGAGACCCAGCATGGAAC
TGTTCTAGTGCAGGTTAAATACGAAGGAACAGATGCACCATGCAAGATCCCCTTCTCGTCCCAAGATGAG
AAGGGAGTAACCCAGAATGGGAGATTGATAACAGCCAACCCCATAGTCACTGACAAAGAAAAACCAGTCA
ACATTGAAGCGGAGCCACCTTTTGGTGAGAGCTACATTGTGGTAGGAGCAGGTGAAAAAGCTTTGAAACT
AAGCTGGTTCAAGAAGGGAAGCAGTATAGGGAAAATGTTTGAAGCAACTGCCCGTGGAGCACGAAGGATG
GCCATCCTGGGAGACACTGCATGGGACTTCGGTTCTATAGGAGGGGTGTTCACGTCTGTGGGAAAACTGA
TACACCAGATTTTTGGGACTGCGTATGGAGTTTTGTTCAGCGGTGTTTCTTGGACCATGAAGATAGGAAT
AGGGATTCTGCTGACATGGCTAGGATTAAACTCAAGGAGCACGTCCCTTTCAATGACGTGTATCGCAGTT
GGCATGGTCACACTGTACCTAGGAGTCATGGTTCAGGCGGACTCGGGATGTGTAATCAACTGGAAAGGCA
GAGAACTCAAATGTGGAAGCGGCATTTTTGTCACCAATGAAGTCCACACCTGGACAGAGCAATATAAATT
CCAGGCCGACTCCCCTAAGAGACTATCAGCGGCCATTGGGAAGGCATGGGAGGAGGGTGTGTGTGGAATT
CGATCAGCCACTCGTCTCGAGAACATCATGTGGAAGCAAATATCAAATGAATTAAACCACATCTTACTTG
AAAATGACATGAAATTTACAGTGGTCGTAGGAGACGTTAGTGGAATCTTGGCCCAAGGAAAGAAAATGAT
TAGGCCACAACCCATGGAACACAAATACTCGTGGAAAAGCTGGGGAAAAGCCAAAATCATAGGAGCAGAT
GTACAGAATACCACCTTCATCATCGACGGCCCAAACACCCCAGAATGCCCTGATAACCAAAGAGCATGGA
ACATTTGGGAAGTTGAAGACTATGGATTTGGAATTTTCACGACAAACATATGGTTGAAATTGCGTGACTC
CTACACTCAAGTGTGTGACCACCGGCTAATGTCAGCTGCCATCAAGGATAGCAAAGCAGTCCATGCTGAC
ATGGGGTACTGGATAGAAAGTGAAAAGAACGAGACTTGGAAGTTGGCAAGAGCCTCCTTCATAGAAGTTA
AGACATGCATCTGGCCAAAATCCCACACTCTATGGAGCAATGGAGTCCTGGAAAGTGAGATGATAATCCC
AAAGATATATGGAGGACCAATATCTCAGCACAACTACAGACCAGGATATTTCACACAAACAGCAGGGCCG
TGGCACTTGGGCAAGTTAGAACTAGATTTTGATTTATGTGAAGGTACCACTGTTGTTGTGGATGAACATT
GTGGAAATCGAGGACCATCTCTTAGAACCACAACAGTCACAGGAAAGACAATCCATGAATGGTGCTGTAG
ATCTTGCACGTTACCCCCCCTACGTTTCAAAGGAGAAGACGGGTGCTGGTACGGCATGGAAATCAGACCA
GTCAAGGAGAAGGAAGAGAACCTAGTTAAGTCAATGGTCTCTGCAGGGTCAGGAGAAGTGGACAGTTTTT
CACTAGGACTGCTATGCATATCAATAATGATCGAAGAGGTAATGAGATCCAGATGGAGCAGAAAAATGCT
GATGACTGGAACATTGGCTGTGTTCCTCCTTCTCACAATGGGACAATTGACATGGAATGATCTGATCAGG
CTATGTATCATGGTTGGAGCCAACGCTTCAGACAAGATGGGGATGGGAACAACGTACCTAGCTTTGATGG
CCACTTTCAGAATGAGACCAATGTTCGCAGTCGGGCTACTGTTTCGCAGATTAACATCTAGAGAAGTTCT
TCTTCTTACAGTTGGATTGAGTCTGGTGGCATCTGTAGAACTACCAAATTCCTTAGAGGAGCTAGGGGAT
GGACTTGCAATGGGCATCATGATGTTGAAATTACTGACTGATTTTCAGTCACATCAGCTATGGGCTACCT
TGCTGTCTTTAACATTTGTCAAAACAACTTTTTCATTGCACTATGCATGGAAGACAATGGCTATGATACT
GTCAATTGTATCTCTCTTCCCTTTATGCCTGTCCACGACTTCTCAAAAAACAACATGGCTTCCGGTGTTG
CTGGGATCTCTTGGATGCAAACCACTAACCATGTTTCTTATAACAGAAAACAAAATCTGGGGAAGGAAAA
GCTGGCCTCTCAATGAAGGAATTATGGCTGTTGGAATAGTTAGCATTCTTCTAAGTTCACTTCTCAAGAA
TGATGTGCCACTAGCTGGCCCACTAATAGCTGGAGGCATGCTAATAGCATGTTATGTCATATCTGGAAGC
TCGGCCGATTTATCACTGGAGAAAGCGGCTGAGGTCTCCTGGGAAGAAGAAGCAGAACACTCTGGTGCCT
CACACAACATACTAGTGGAGGTCCAAGATGATGGAACCATGAAGATAAAGGATGAAGAGAGAGATGACAC
ACTCACCATTCTCCTCAAAGCAACTCTGCTAGCAATCTCAGGGGTATACCCAATGTCAATACCGGCGACC
CTCTTTGTGTGGTATTTTTGGCAGAAAAAGAAACAGAGATCAGGAGTGCTATGGGACACACCCAGCCCTC
CAGAAGTGGAAAGAGCAGTCCTTGATGATGGCATTTATAGAATTCTCCAAAGAGGATTGTTGGGCAGGTC
TCAAGTAGGAGTAGGAGTTTTTCAAGAAGGCGTGTTCCACACAATGTGGCACGTCACCAGGGGAGCTGTC
CTCATGTACCAAGGGAAGAGACTGGAACCAAGTTGGGCCAGTGTCAAAAAAGACTTGATCTCATATGGAG
GAGGTTGGAGGTTTCAAGGATCCTGGAACGCGGGAGAAGAAGTGCAGGTGATTGCTGTTGAACCGGGGAA
GAACCCCAAAAATGTACAGACAGCGCCGGGTACCTTCAAGACCCCTGAAGGCGAAGTTGGAGCCATAGCT
CTAGACTTTAAACCCGGCACATCTGGATCTCCTATCGTGAACAGAGAGGGAAAAATAGTAGGTCTTTATG
GAAATGGAGTGGTGACAACAAGTGGTACCTACGTCAGTGCCATAGCTCAAGCTAAAGCATCACAAGAAGG
GCCTCTACCAGAGATTGAGGACGAGGTGTTTAGGAAAAGAAACTTAACAATAATGGACCTACATCCAGGA
TCGGGAAAAACAAGAAGATACCTTCCAGCCATAGTCCGTGAGGCCATAAAAAGAAAGCTGCGCACGCTAG
TCTTAGCTCCCACAAGAGTTGTCGCTTCTGAAATGGCAGAGGCGCTCAAGGGAATGCCAATAAGGTATCA
GACAACAGCAGTGAAGAGTGAACACACGGGAAAGGAGATAGTTGACCTTATGTGTCACGCCACTTTCACT
ATGCGTCTCCTGTCTCCTGTGAGAGTTCCCAATTATAATATGATTATCATGGATGAAGCACATTTTACCG
ATCCAGCCAGCATAGCAGCCAGAGGGTATATCTCAACCCGAGTGGGTATGGGTGAAGCAGCTGCGATTTT
CATGACAGCCACTCCCCCCGGATCGGTGGAGGCCTTTCCACAGAGCAATGCAGTTATCCAAGATGAGGAA
AGAGACATTCCTGAAAGATCATGGAACTCAGGCTATGACTGGATCACTGATTTCCCAGGTAAAACAGTCT
GGTTTGTTCCAAGCATCAAATCAGGAAATGACATTGCCAACTGTTTAAGAAAGAATGGGAAACGGGTGGT
CCAATTGAGCAGAAAAACTTTTGACACTGAGTACCAGAAAACAAAAAATAACGACTGGGACTATGTTGTC
ACAACAGACATATCCGAAATGGGAGCAAACTTCCGAGCCGACAGGGTAATAGACCCGAGGCGGTGCCTGA
AACCGGTAATACTAAAAGATGGCCCAGAGCGTGTCATTCTAGCCGGACCGATGCCAGTGACTGTGGCTAG
CGCCGCCCAGAGGAGAGGAAGAATTGGAAGGAACCAAAATAAGGAAGGCGATCAGTATATTTACATGGGA
CAGCCTCTAAACAATGATGAGGACCACGCCCATTGGACAGAAGCAAAAATGCTCCTTGACAACATAAACA
CACCAGAAGGGATTATCCCAGCCCTCTTTGAGCCGGAGAGAGAAAAGAGTGCAGCAATAGACGGGGAATA
CAGACTACGGGGTGAAGCGAGGAAAACGTTCGTGGAGCTCATGAGAAGAGGAGATCTACCTGTCTGGCTA
TCCTACAAAGTTGCCTCAGAAGGCTTCCAGTACTCCGACAGAAGGTGGTGCTTTGATGGGGAAAGGAACA
ACCAGGTGTTGGAGGAGAACATGGACGTGGAGATCTGGACAAAAGAAGGAGAAAGAAAGAAACTACGACC
CCGCTGGCTGGATGCCAGAACATACTCTGACCCACTGGCTCTGCGCGAATTCAAAGAGTTCGCAGCAGGA
AGAAGAAGCGTCTCAGGTGACCTAATATTAGAAATAGGGAAACTTCCACAACATTTAACGCAAAGGGCCC
AGAACGCCTTGGACAATCTGGTTATGTTGCACAACTCTGAACAAGGAGGAAAAGCCTATAGACACGCCAT
GGAAGAACTACCAGACACCATAGAAACGTTAATGCTCCTAGCTTTGATAGCTGTGCTGACTGGTGGAGTG
ACGTTGTTCTTCCTATCAGGAAGGGGTCTAGGAAAAACATCCATTGGCCTACTCTGCGTGATTGCCTCAA
GTGCACTGTTATGGATGGCCAGTGTGGAACCCCATTGGATAGCGGCCTCTATCATACTGGAGTTCTTTCT
GATGGTGTTGCTTATTCCAGAGCCGGACAGACAGCGCACTCCACAAGACAACCAGCTAGCATACGTGGTG
ATAGGTCTGTTATTCATGATATTGACAGTGGCAGCCAATGAGATGGGATTACTGGAAACCACAAAGAAGG
ACCTGGGGATTGGTCATGCAGCTGCTGAAAACCACCATCATGCTGCAATGCTGGACGTAGACCTACATCC
AGCTTCAGCCTGGACTCTCTATGCAGTGGCCACAACAATTATCACTCCCATGATGAGACACACAATTGAA
AACACAACGGCAAATATTTCCCTGACAGCTATTGCAAACCAGGCAGCTATATTGATGGGACTTGACAAGG
GATGGCCAATATCAAAGATGGACATAGGAGTTCCACTTCTCGCCTTGGGGTGCTATTCTCAGGTGAACCC
GCTGACGCTGACAGCGGCGGTATTGATGCTAGTGGCTCATTATGCCATAATTGGACCCGGACTGCAAGCA
AAAGCTACTAGAGAAGCTCAAAAAAGGACAGCAGCCGGAATAATGAAAAACCCAACTGTCGACGGGATCG
TTGCAATAGATTTGGACCCTGTGGTTTACGATGCAAAATTTGAAAAACAGCTAGGCCAAATAATGTTGTT
GATACTTTGCACATCACAGATCCTCCTGATGCGGACCACATGGGCCTTGTGTGAATCCATCACACTAGCC
ACTGGACCTCTGACTACGCTTTGGGAGGGATCTCCAGGAAAATTCTGGAACACCACGATAGCGGTGTCCA
TGGCAAACATTTTTAGGGGAAGTTATCTAGCAGGAGCAGGTCTGGCCTTTTCATTAATGAAATCTCTAGG
AGGAGGTAGGAGAGGCACGGGAGCCCAAGGGGAAACACTGGGAGAAAAATGGAAAAGACAGCTAAACCAA
TTGAGCAAGTCAGAATTCAACACTTACAAAAGGAGTGGGATTATAGAGGTGGATAGATCTGAAGCCAAAG
AGGGGTTAAAAAGAGGAGAAACGACTAAACACGCAGTGTCGAGAGGAACGGCCAAACTGAGGTGGTTTGT
GGAGAGGAACCTTGTGAAACCAGAAGGGAAAGTCATAGACCTCGGTTGTGGAAGAGGTGGCTGGTCATAT
TATTGCGCTGGGCTGAAGAAAGTCACAGAAGTGAAAGGATACACGAAAGGAGGACCTGGACATGAGGAAC
CAATCCCAATGGCAACCTATGGATGGAACCTAGTAAAGCTATACTCCGGGAAAGATGTATTCTTTACACC
ACCTGAGAAATGTGACACCCTCTTGTGTGATATTGGTGAGTCCTCTCCGAACCCAACTATAGAAGAAGGA
AGAACGTTACGTGTTCTAAAGATGGTGGAACCATGGCTCAGAGGAAACCAATTTTGCATAAAAATTCTAA
ATCCCTATATGCCGAGTGTGGTAGAAACTTTGGAGCAAATGCAAAGAAAACATGGAGGAATGCTAGTGCG
AAATCCACTCTCAAGAAACTCCACTCATGAAATGTACTGGGTTTCATGTGGAACAGGAAACATTGTGTCA
GCAGTAAACATGACATCTAGAATGCTGCTAAATCGATTCACAATGGCTCACAGGAAGCCAACATATGAAA
GAGACGTGGACTTAGGCGCTGGAACAAGACATGTGGCAGTAGAACCAGAGGTGGCCAACCTAGATATCAT
TGGCCAGAGGATAGAGAATATAAAAAATGAACACAAATCAACATGGCATTATGATGAGGACAATCCATAC
AAAACATGGGCCTATCATGGATCATATGAGGTCAAGCCATCAGGATCAGCCTCATCCATGGTCAATGGTG
TGGTGAGACTGCTAACCAAACCATGGGATGTCATTCCCATGGTCACACAAATAGCCATGACTGACACCAC
ACCCTTTGGACAACAGAGGGTGTTTAAAGAGAAAGTTGACACGCGTACACCAAAAGCGAAACGAGGCACA
GCACAAATTATGGAGGTGACAGCCAGGTGGTTATGGGGTTTTCTCTCTAGAAACAAAAAACCCAGAATCT
GCACAAGAGAGGAGTTCACAAGAAAAGTCAGGTCAAACGCAGCTATTGGAGCAGTGTTCGTTGATGAAAA
TCAATGGAACTCAGCAAAAGAGGCAGTGGAAGATGAACGGTTCTGGGACCTTGTGCACAGAGAGAGGGAG
CTTCATAAACAAGGAAAATGTGCCACGTGTGTCTACAACATGATGGGAAAGAGAGAGAAAAAATTAGGAG
AGTTCGGAAAGGCAAAAGGAAGTCGCGCAATATGGTACATGTGGTTGGGAGCGCGCTTTTTAGAGTTTGA
AGCCCTTGGTTTCATGAATGAAGATCACTGGTTCAGCAGAGAGAATTCACTCAGTGGAGTGGAAGGAGAA
GGACTCCACAAACTTGGATACATACTCAGAGACATATCAAAGATTCCAGGGGGAAATATGTATGCAGATG
ACACAGCCGGATGGGACACAAGAATAACAGAGGATGATCTTCAGAATGAGGCCAAAATCACTGACATCAT
GGAACCTGAACATGCCCTATTGGCCACGTCAATCTTTAAGCTAACCTACCAAAACAAGGTAGTAAGGGTG
CAGAGACCAGCGAAAAATGGAACCGTGATGGATGTCATATCCAGACGTGACCAGAGAGGAAGTGGACAGG
TTGGAACCTATGGCTTAAACACCTTCACCAACATGGAGGCCCAACTAATAAGACAAATGGAGTCTGAGGG
AATCTTTTCACCCAGCGAATTGGAAACCCCAAATCTAGCCGAAAGAGTCCTCGACTGGTTGAAAAAACAT
GGCACCGAGAGGCTGAAAAGAATGGCAATCAGTGGAGATGACTGTGTGGTGAAACCAATCGATGACAGAT
TTGCAACAGCCTTAACAGCTTTGAATGACATGGGAAAGGTAAGAAAAGACATACCGCAATGGGAACCTTC
AAAAGGATGGAATGATTGGCAACAAGTGCCTTTCTGTTCACACCATTTCCACCAGCTGATTATGAAGGAT
GGGAGGGAGATAGTGGTGCCATGCCGCAACCAAGATGAACTTGTAGGTAGGGCCAGAGTATCACAAGGCG
CCGGATGGAGCTTGAGAGAAACTGCATGCCTAGGCAAGTCATATGCACAAATGTGGCAGCTGATGTACTT
CCACAGGAGAGACTTGAGATTAGCGGCTAATGCTATCTGTTCAGCCGTTCCAGTTGATTGGGTCCCAACC
AGCCGCACCACCTGGTCGATCCATGCCCACCATCAATGGATGACAACAGAAGACATGTTGTCAGTGTGGA
ATAGGGTTTGGATAGAGGAAAACCCATGGATGGAGGACAAGACTCATGTGTCCAGTTGGGAAGACGTTCC
ATACCTAGGAAAAAGGGAAGATCAATGGTGTGGTTCCCTAATAGGCTTAACAGCACGAGCCACCTGGGCC
ACCAACATACAAGTGGCCATAAACCAAGTGAGAAGGCTCATTGGGAATGAGAATTATCTAGACTTCATGA
CATCAATGAAGAGATTCAAAAACGAGAGTGATCCCGAAGGGGCACTCTGGTAAGCCAACTCATTCACAAA
ATAAAGGAAAATAAAAAATCAAACAAGGCAAGAAGTCAGGCCGGATTAAGCCATAGCACGGTAAGAGCTA
TGCTGCCTGTGAGCCCCGTCCAAGGACGTAAAATGAAGTCAGGCCGAAAGCCACGGTTCGAGCAAGCCGT
GCTGCCTGTAGCTCCATCGTGGGGATGTAAAAACCCGGGAGGCTGCAAACCATGGAAGCTGTACGCATGG
GGTAGCAGACTAGTGGTTAGAGGAGACCCCTCCCAAGACACAACGCAGCAGCGGGGCCCAACACCAGGGG
AAGCTGTACCCTGGTGGTAAGGACTAGAGGTTAGAGGAGACCCCCCGCACAACAACAAACAGCATATTGA
CGCTGGGAGAGACCAGAGATCCTGCTGTCTCTACAGCATCATTCCAGGCACAGAACGCCAAAAAATGGAA
TGGTGCTGTTGAATCAACAGGTTCT
Click to Show/Hide
|