Details of Virus RNA
| Strain Information | Strain Name |
Sindbis virus
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Togaviridae
|
||||||||
| RNA Binding Site |
5'UTR - 3'UTR
|
||||||||
| Virus Information | Virus Name |
Sindbis virus (SINV)
|
|||||||
| Taxonomy ID | 11034 | ||||||||
Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 10 kDa heat shock protein | P61604 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.19749069938727 | FC = 0.00048978823268584 |
| 14 kDa phosphohistidine phosphatase | Q9NRX4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 14-3-3 protein epsilon | P62258 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 3 | O43242 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.531953587 | FC = -0.250940171 |
| 26S proteasome non-ATPase regulatory subunit 4 | P55036 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 9 | O00233 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome regulatory subunit 7 | P35998 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 26S proteasome regulatory subunit 7 | P35998 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.816032952196625 | FC = 0.00307737069919718 |
| 26S proteasome regulatory subunit 7 | P35998 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.003077371 | FC = -0.816032952 |
| 28S ribosomal protein S27 | Q92552 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.726644807 | FC = -0.074044972 |
| 28S ribosomal protein S9 | P82933 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.860700295522647 | FC = 0.0123558853579264 |
| 3'-5' RNA helicase YTHDC2 | Q9H6S0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.31515936863254 | FC = 0.000132881601563303 |
| 3-mercaptopyruvate sulfurtransferase | P25325 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 39S ribosomal protein L43 | Q8N983 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.837644256173591 | FC = 0.00520205097865213 |
| 4-trimethylaminobutyraldehyde dehydrogenase | P49189 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S10 | P46783 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.77757700039442 | FC = 0.0223551011092531 |
| 40S ribosomal protein S10 | P46783 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.022355101 | FC = -0.777577 |
| 40S ribosomal protein S11 | P62280 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.875265256 | FC = 0.030823224 |
| 40S ribosomal protein S12 | P25398 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.577412008802269 | FC = 0.0238066251969473 |
| 40S ribosomal protein S12 | P25398 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.023806625 | FC = 0.577412009 |
| 40S ribosomal protein S13 | P62277 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.580715638 | FC = 0.113438815 |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.320551322 | FC = -0.533599246 |
| 40S ribosomal protein S15 | P62841 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.148550545 | FC = 0.833435223 |
| 40S ribosomal protein S15a | P62244 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.588318679173364 | FC = 0.0266258585868975 |
| 40S ribosomal protein S15a | P62244 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.026625859 | FC = 0.588318679 |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.804341633 | FC = -0.051253735 |
| 40S ribosomal protein S17 | P08708 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| 40S ribosomal protein S18 | P62269 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.617839103 | FC = 0.101790775 |
| 40S ribosomal protein S19 | P39019 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.580733299 | FC = 0.541079441 |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.807580504 | FC = 0.059125 |
| 40S ribosomal protein S20 | P60866 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.397904607 | FC = 0.171041186 |
| 40S ribosomal protein S21 | P63220 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S23 | P62266 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.985409251 | FC = 0.004992869 |
| 40S ribosomal protein S24 | P62847 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.931356066 | FC = 0.01809225 |
| 40S ribosomal protein S25 | P62851 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.992892211065817 | FC = 0.00209401716447135 |
| 40S ribosomal protein S25 | P62851 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.002094017 | FC = 0.992892211 |
| 40S ribosomal protein S26 | P62854 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.251071497 | FC = -0.250659095 |
| 40S ribosomal protein S27 | P42677 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 3.85884017857068 | FC = 4.76103640529603E-05 |
| 40S ribosomal protein S27 | P42677 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 4.76104E-05 | FC = 3.858840179 |
| 40S ribosomal protein S28 | P62857 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.47834167033816 | FC = 0.000946902696278388 |
| 40S ribosomal protein S28 | P62857 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000946903 | FC = -1.47834167 |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.02423406992961 | FC = 0.00080273684171679 |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000802737 | FC = -1.02423407 |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.11091421 | FC = 0.354905915 |
| 40S ribosomal protein S4 | P62701 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.061904874 | FC = -0.420924802 |
| 40S ribosomal protein S5 | P46782 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.086077228 | FC = -0.520495052 |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.284567648 | FC = 0.252701832 |
| 40S ribosomal protein S7 | P62081 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.922901727 | FC = 0.022322865 |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.117119635 | FC = 0.346716258 |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.275036102 | FC = 0.244997567 |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.225242212 | FC = -0.253778666 |
| 5'-3' exoribonuclease 1 | Q8IZH2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.901556816217827 | FC = 0.00901275616563595 |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.582820855032842 | FC = 0.0203444352818966 |
| 6-phosphogluconolactonase | O95336 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.715288062785942 | FC = 0.00999111815102106 |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.009991118 | FC = 0.715288063 |
| 60S ribosomal protein L10a | P62906 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.244707445 | FC = -0.322280524 |
| 60S ribosomal protein L11 | P62913 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.126351932 | FC = 0.327979979 |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.083887833 | FC = 0.732350757 |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.161147297 | FC = -0.302433686 |
| 60S ribosomal protein L13a | P40429 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.411624777 | FC = 0.200703257 |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.517731412301139 | FC = 0.0259656772487163 |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.025965677 | FC = 0.517731412 |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.27471918 | FC = 0.226321473 |
| 60S ribosomal protein L17 | P18621 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.479106247 | FC = 0.386315265 |
| 60S ribosomal protein L18 | Q07020 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.294717535 | FC = -0.248747949 |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.097801091 | FC = 0.368484623 |
| 60S ribosomal protein L19 | P84098 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.803654519 | FC = 0.084657488 |
| 60S ribosomal protein L21 | P46778 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.157676645 | FC = 0.327664097 |
| 60S ribosomal protein L22 | P35268 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.066814806 | FC = 0.455005465 |
| 60S ribosomal protein L22-like 1 | Q6P5R6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.204360105 | FC = -0.538430677 |
| 60S ribosomal protein L23 | P62829 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.673262378 | FC = 0.180634448 |
| 60S ribosomal protein L23a | P62750 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.378464689 | FC = -0.188532563 |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.613858798 | FC = 0.107412381 |
| 60S ribosomal protein L27 | P61353 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.552461023 | FC = 0.127703666 |
| 60S ribosomal protein L27a | P46776 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.904071935 | FC = 0.025784541 |
| 60S ribosomal protein L28 | P46779 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.792123970445896 | FC = 0.00596511125465837 |
| 60S ribosomal protein L28 | P46779 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.005965111 | FC = 0.79212397 |
| 60S ribosomal protein L29 | P47914 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.601475403627747 | FC = 0.0156430290292345 |
| 60S ribosomal protein L29 | P47914 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.015643029 | FC = 0.601475404 |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.929606778 | FC = -0.017651138 |
| 60S ribosomal protein L30 | P62888 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.154616646 | FC = 0.309389633 |
| 60S ribosomal protein L31 | P62899 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.171801316 | FC = 0.285460795 |
| 60S ribosomal protein L32 | P62910 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.146507175 | FC = 0.364675792 |
| 60S ribosomal protein L34 | P49207 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.049775465 | FC = 0.474318117 |
| 60S ribosomal protein L35 | P42766 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.316992562 | FC = 0.681723733 |
| 60S ribosomal protein L36 | Q9Y3U8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 2.50863974061786 | FC = 0.000538553811028387 |
| 60S ribosomal protein L36 | Q9Y3U8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000538554 | FC = 2.508639741 |
| 60S ribosomal protein L38 | P63173 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.71650031 | FC = 0.109795144 |
| 60S ribosomal protein L39 | P62891 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.599388064723575 | FC = 0.0271543518647433 |
| 60S ribosomal protein L39 | P62891 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.027154352 | FC = 0.599388065 |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.587628981457546 | FC = 0.01715340157943 |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.017153402 | FC = 0.587628981 |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.09150844 | FC = 0.368906209 |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.072829757 | FC = 0.409509706 |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.10173787 | FC = 0.374232459 |
| 60S ribosomal protein L7-like 1 | Q6DKI1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.992003718205469 | FC = 0.00245552308845642 |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.665197497 | FC = 0.113051057 |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.590020384002385 | FC = 0.0360326303138835 |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.03603263 | FC = 0.590020384 |
| 60S ribosomal protein L9 | P32969 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.520620957167376 | FC = 0.0319310962580511 |
| 60S ribosomal protein L9 | P32969 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.031931096 | FC = 0.520620957 |
| 78 kDa gastrin-binding protein | P40939 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| A-kinase anchor protein 12 | Q02952 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| A6NL28 | A6NL28 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acetyl-CoA acetyltransferase | P24752 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acireductone dioxygenase | Q9BV57 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aconitate hydratase | Q99798 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Activator of basal transcription 1 | Q9ULW3 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Acyl carrier protein | O14561 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acyl-CoA-binding protein | P07108 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Acylamino-acid-releasing enzyme | P13798 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenosine kinase | P55263 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Adenylate kinase 2 | P54819 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ADP-sugar pyrophosphatase | Q9UKK9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ADP/ATP translocase 2 | P05141 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.059055247 | FC = 0.446980521 |
| ADP/ATP translocase 3 | P12236 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ADP/ATP translocase 3 | P12236 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.570141465043514 | FC = 0.0205462903804313 |
| Adrenodoxin | P10109 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aldehyde dehydrogenase | P05091 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aldo-keto reductase family 1 member B1 | P15121 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-2-macroglobulin | P01023 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-actinin-4 | O43707 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-aminoadipic semialdehyde dehydrogenase | P49419 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-enolase | P06733 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.573534923800157 | FC = 0.0243872038842602 |
| Alpha-ETF | P13804 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Alpha-NAC | E9PAV3 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.602025817 | FC = 0.154417887 |
| Alpha-SGT | O43765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Antigen NY-CO-16 | Q9BVJ6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.689629208608349 | FC = 0.0159911097304199 |
| AP-3 complex subunit delta-1 | O14617 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Apoptosis inhibitor 5 | Q9BZZ5 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.933740873618621 | FC = 0.0093535278555541 |
| Apoptosis-inducing factor 1 | O95831 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ASF/SF2-associated protein p32 | Q07021 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Aspartate aminotransferase | P00505 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Astrocytic phosphoprotein PEA-15 | Q15121 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.16042420709048 | FC = 0.00139882672665566 |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.987612176537872 | FC = 0.0214395607663309 |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.021439561 | FC = 0.987612177 |
| ATP synthase subunit alpha | P25705 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.482847881778959 | FC = 0.0367648119902935 |
| ATP synthase subunit alpha | P25705 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.036764812 | FC = 0.482847882 |
| ATP synthase subunit beta | P06576 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit beta | P06576 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.190328297 | FC = -0.558224811 |
| ATP synthase subunit d | O75947 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit delta | P30049 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP synthase subunit O | P48047 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.959050623011398 | FC = 0.000996604924415041 |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.050535372 | FC = -0.464911321 |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.9716952923773 | FC = 7.32745797390762E-06 |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 7.32746E-06 | FC = 1.971695292 |
| ATP-dependent RNA helicase DDX18 | Q9NVP1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.576241122049344 | FC = 0.0167090685952305 |
| ATP-dependent RNA helicase DDX18 | Q9NVP1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.016709069 | FC = -0.576241122 |
| ATP-dependent RNA helicase DDX24 | Q9GZR7 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.19706161422967 | FC = 0.000300330069049143 |
| ATP-dependent RNA helicase DDX24 | Q9GZR7 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.00030033 | FC = -1.197061614 |
| ATP-dependent RNA helicase DDX3X | O00571 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.170283756 | FC = 0.293017079 |
| ATP-dependent RNA helicase DDX50 | Q9BQ39 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.934316731673106 | FC = 0.00248102970288708 |
| ATP-dependent RNA helicase DDX50 | Q9BQ39 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.00248103 | FC = -0.934316732 |
| ATP-dependent RNA helicase DDX54 | Q8TDD1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.94938494961449 | FC = 0.00201553747760373 |
| ATP-dependent RNA helicase DHX15 | O43143 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.161104152 | FC = -0.441782178 |
| ATP-dependent RNA helicase DHX29 | Q7Z478 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| ATP-dependent RNA helicase DHX30 | Q7L2E3 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.279564899 | FC = 0.226119052 |
| ATP-dependent RNA helicase DHX8 | Q14562 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.30760872147343 | FC = 0.0132965384181043 |
| Barrier-to-autointegration factor | O75531 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Bcl-2-associated transcription factor 1 | Q9NYF8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.753277957455602 | FC = 0.011687910354229 |
| Binder of ARF2 protein 1 | Q9Y2Y0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Butyrate-induced protein 1 | Q9P035 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.550096428899137 | FC = 0.0256300276252896 |
| Bystin | Q13895 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.968890239097438 | FC = 0.0014245028164926 |
| Bystin | Q13895 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.001424503 | FC = -0.968890239 |
| C-1-tetrahydrofolate synthase | P11586 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calcyclin-binding protein | Q9HB71 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Calreticulin | P27797 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cathepsin B | P07858 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CCAAT/enhancer-binding protein zeta | Q03701 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.26560514564673 | FC = 0.000160376299043847 |
| CD276 antigen | Q5ZPR3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cell growth-regulating nucleolar protein | Q9NX58 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.041446278 | FC = -0.975909772 |
| CF-1 64 kDa subunit tau variant | Q9H0L4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -2.95560125314436 | FC = 0.000217825902737311 |
| Chromatin target of PRMT1 protein | Q9Y3Y2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.16845158800169 | FC = 0.00170286784607699 |
| Chromodomain-helicase-DNA-binding protein 1 | O14646 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Citrate synthase | O75390 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cleavage stimulation factor subunit 2 | P33240 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -2.06381505532814 | FC = 1.64849199691705E-05 |
| Coatomer subunit delta | P48444 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coiled-coil domain-containing protein 137 | Q6PK04 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.25488962957275 | FC = 0.0105285488371015 |
| Coiled-coil-helix-coiled-coil-helix domain-containing protein 4 | Q8N4Q1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Coiled-coil-helix-coiled-coil-helix domain-containing protein 8 | Q9NYJ1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.063163074 | FC = 0.417010691 |
| Complex I-30kD | O75489 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex III subunit 1 | P31930 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Complex III subunit 6 | P07919 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cooperator of PRMT5 | Q9NQ92 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Costars family protein ABRACL | Q9P1F3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Creatine kinase B-type | P12277 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CTD phosphatase SSU72 | Q9NP77 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cyclin-dependent kinase 18 | Q07002 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Cyclin-dependent kinase inhibitor 2A | P42771 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c | P99999 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase assembly factor 7 | Q96BR5 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase polypeptide IV | P13073 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytochrome c oxidase subunit 5A | P20674 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Cytoskeleton-associated protein 5 | Q14008 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Cytosol aminopeptidase | P28838 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-3-phosphoglycerate dehydrogenase | O43175 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-aspartate | P22061 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| D-dopachrome decarboxylase | P30046 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| dCTP pyrophosphatase 1 | Q9H773 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DDB1- and CUL4-associated factor 13 | Q9NV06 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.541437721946193 | FC = 0.0370203135894077 |
| DDP-like protein | Q9Y5J9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Deafness dystonia protein 1 | O60220 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase | Q13011 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.534106627743805 | FC = 0.0229724314767267 |
| Developmentally-regulated GTP-binding protein 1 | Q9Y295 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.660498682550549 | FC = 0.0342127357840507 |
| Dihydrolipoyl dehydrogenase | P09622 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Dipeptidyl peptidase 1 | P53634 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DNA damage-binding protein 1 | Q16531 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DNA dC->dU-editing enzyme APOBEC-3F | Q8IUX4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.981331198 | FC = 0.005432316 |
| DNA polymerase epsilon subunit 3 | Q9NRF9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| DNA topoisomerase 2-alpha | P11388 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.740624187 | FC = -0.090616483 |
| DNA topoisomerase 3-beta-1 | O95985 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.786645962037082 | FC = 0.00686994905169306 |
| DNA-directed RNA polymerase II subunit RPB2 | P30876 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.2439016294337 | FC = 0.0164017273008312 |
| DNA-directed RNA polymerase II subunit RPB2 | P30876 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.016401727 | FC = -1.243901629 |
| Double-stranded RNA-binding protein Staufen homolog 1 | O95793 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.838508381353852 | FC = 0.00238870444414124 |
| Double-stranded RNA-binding protein Staufen homolog 1 | O95793 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.002388704 | FC = 0.838508381 |
| dUTPase | P33316 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.826420259500329 | FC = 0.0171511468127911 |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.017151147 | FC = 0.82642026 |
| E3 ubiquitin-protein ligase HUWE1 | Q7Z6Z7 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| E3 ubiquitin-protein ligase makorin-2 | Q9H000 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.05641220422599 | FC = 0.00421193440240681 |
| E3 ubiquitin-protein ligase TRIM56 | Q9BRZ2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.871155550021411 | FC = 0.00450368503274197 |
| E3 ubiquitin/ISG15 ligase TRIM25 | Q14258 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.26802750069616 | FC = 0.000177714666740455 |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| eIF-2-beta | P20042 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.27969104745216 | FC = 0.00110099314290166 |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.64433932232841 | FC = 3.81422982704743E-05 |
| eIF-4-gamma 2 | P78344 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.614016860527827 | FC = 0.0265856437085684 |
| eIF-4-gamma 3 | O43432 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.852553694983458 | FC = 0.022429393657919 |
| eIF3a | Q14152 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.071019232 | FC = 0.395212617 |
| eIF3c | Q99613 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.1123292605862 | FC = 0.000706614353635511 |
| eIF3d | O15371 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.659641337449662 | FC = 0.0107046184143913 |
| eIF3d | O15371 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.010704618 | FC = 0.659641337 |
| eIF3e | P60228 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| eIF3g | O75821 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.03158185120755 | FC = 0.000673878669572148 |
| eIF3j | O75822 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| EKC/KEOPS complex subunit GON7 | Q9BXV9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor 1-alpha 1 | P68104 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.693561768507634 | FC = 0.00827638592766946 |
| Elongation factor 1-alpha 1 | P68104 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.008276386 | FC = 0.693561769 |
| Elongation factor 1-beta | P24534 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.940264882800393 | FC = 0.00270411352676303 |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.002704114 | FC = 0.940264883 |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.736864198201484 | FC = 0.00526614298309699 |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.005266143 | FC = 0.736864198 |
| Elongation factor Tu | P49411 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Elongation factor Tu | P49411 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.02853008940801 | FC = 0.0343717950441437 |
| Emerin | P50402 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endopeptidase Clp | Q16740 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.095479752 | FC = -0.746793609 |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Endoribonuclease MBLAC1 | A4D2B0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Enoyl-CoA delta isomerase 1 | P42126 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| eRF3a | P15170 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.3546737909463 | FC = 0.01141827905877 |
| ESF1 homolog | Q9H501 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.354975613 | FC = 0.213077718 |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.565750894 | FC = 0.115581893 |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Eukaryotic translation initiation factor 5B | O60841 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.620233036760397 | FC = 0.0153750792636254 |
| Eukaryotic translation initiation factor 6 | P56537 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Exportin-2 | P55060 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | P = 6.91185113685338E-05 | FC = -4.32523492229273 |
| Exportin-2 | P55060 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -2.25016240196851 | FC = 0.000965455885832943 |
| Far upstream element-binding protein 1 | Q96AE4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.779956316610069 | FC = 0.00434912214194038 |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.507073927532559 | FC = 0.0341916118418248 |
| Fascin | Q16658 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.809932682699011 | FC = 0.00327515082363551 |
| Filamin-A | P21333 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.003275151 | FC = 0.809932683 |
| Flavoprotein subunit of complex II | P31040 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| FMR1-interacting protein NUFIP2 | Q7Z417 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.684525971281869 | FC = 0.0108480872920305 |
| FMR1-interacting protein NUFIP2 | Q7Z417 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.010848087 | FC = 0.684525971 |
| Fragile X messenger ribonucleoprotein 1 | Q06787 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.575864855 | FC = 0.115356827 |
| Fructose-bisphosphate aldolase A | P04075 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.951831361882067 | FC = 0.00152870117942074 |
| Fructose-bisphosphate aldolase A | P04075 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.001528701 | FC = 0.951831362 |
| Fumarylacetoacetase | P16930 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Galectin-1 | P09382 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Gamma-glutamyl hydrolase | Q92820 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Gamma-interferon-inducible protein 16 | Q16666 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| GAP-associated tyrosine phosphoprotein p62 | Q07666 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.89182049885886 | FC = 0.006542067626723 |
| Gem-associated protein 5 | Q8TEQ6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 2.98090962593617 | FC = 9.55681915553893E-05 |
| Glucose-induced degradation protein 8 homolog | Q9NWU2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glucosidase 2 subunit beta | P14314 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutamate dehydrogenase 1 | P00367 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutamate-rich WD repeat-containing protein 1 | Q9BQ67 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Glutamate-rich WD repeat-containing protein 1 | Q9BQ67 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Glutathione peroxidase 1 | P07203 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glutathione S-transferase omega-1 | P78417 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.047292096 | FC = 0.577068899 |
| Glycinamide ribonucleotide synthetase | P22102 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glycine--tRNA ligase | P41250 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Glyoxalase domain-containing protein 4 | Q9HC38 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| GTP-binding protein 1 | O00178 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.917336701004343 | FC = 0.00817147491013054 |
| GTP-binding protein 4 | Q9BZE4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.10914152906725 | FC = 0.000674199224615564 |
| Guanine nucleotide-binding protein-like 3 | Q9BVP2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.723141841751023 | FC = 0.0103156992371891 |
| Guanine nucleotide-binding protein-like 3 | Q9BVP2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.010315699 | FC = -0.723141842 |
| Guanine nucleotide-binding protein-like 3-like protein | Q9NVN8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.529976169137247 | FC = 0.0294174379221269 |
| Guanine nucleotide-binding protein-like 3-like protein | Q9NVN8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.029417438 | FC = 0.529976169 |
| H/ACA ribonucleoprotein complex subunit 1 | Q9NY12 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.006332892 | FC = -0.694504761 |
| H/ACA ribonucleoprotein complex subunit 1 | Q9NY12 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.694504761464545 | FC = 0.00633289204968307 |
| H/ACA ribonucleoprotein complex subunit DKC1 | O60832 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.902932857895268 | FC = 0.0364516852667136 |
| H/ACA ribonucleoprotein complex subunit DKC1 | O60832 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.036451685 | FC = -0.902932858 |
| HEAT repeat-containing protein 1 | Q9H583 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.580627976384036 | FC = 0.0216616881799817 |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.641133204827461 | FC = 0.0280430091909743 |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.028043009 | FC = 0.641133205 |
| Heat shock protein HSP 90-beta | P08238 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.884780796344505 | FC = 0.0075588542540891 |
| Heat shock protein HSP 90-beta | P08238 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.007558854 | FC = 0.884780796 |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.285140432 | FC = -0.223700527 |
| HESB-like domain-containing protein 1 | Q86U28 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.2391665685955 | FC = 0.00333476378332984 |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.936201871 | FC = 0.017542102 |
| Heterogeneous nuclear ribonucleoprotein D0 | Q14103 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.113262453 | FC = -0.342359119 |
| Heterogeneous nuclear ribonucleoprotein F | P52597 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.482974512 | FC = -0.153381436 |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.819130466 | FC = -0.046579365 |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.53774291747459 | FC = 0.0327732179391454 |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.032773218 | FC = -0.537742917 |
| Heterogeneous nuclear ribonucleoprotein L-like | Q8WVV9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.19106525601141 | FC = 0.000453588449394819 |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.70639474154292 | FC = 5.00919267974157E-05 |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.874518566475116 | FC = 0.00304712141621647 |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.003047121 | FC = -0.874518566 |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.07738307 | FC = -0.48603443 |
| HIRA-interacting protein 5 | Q9UMS0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Histone H1.10 | Q92522 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.216122918 | FC = 0.573498512 |
| Histone H1.2 | P16403 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Histone H1.4 | P10412 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -4.27341727147931 | FC = 2.62963218297004E-05 |
| Histone H1.4 | P10412 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 2.62963E-05 | FC = -4.273417271 |
| Histone H4 | P62805 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.758687541714845 | FC = 0.00411460121859356 |
| Histone-lysine N-methyltransferase SETD7 | Q8WTS6 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Hsc70-interacting protein | P50502 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| IFIT-5 | Q13325 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| IGF2 mRNA-binding protein 1 | Q9NZI8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.048546082 | FC = -0.453294331 |
| IGF2 mRNA-binding protein 3 | O00425 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.045610398 | FC = -0.453224035 |
| Importin subunit alpha-1 | P52292 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inactive tyrosine-protein kinase 7 | Q13308 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inorganic pyrophosphatase | Q15181 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inosine-5'-monophosphate dehydrogenase 2 | P12268 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Inositol-3-phosphate synthase 1 | Q9NPH2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Interferon-inducible RNA-dependent protein kinase | P19525 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.905226748283257 | FC = 0.00166474339709657 |
| Interleukin enhancer-binding factor 2 | Q12905 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.521968985224781 | FC = 0.0327329852342788 |
| Interleukin enhancer-binding factor 2 | Q12905 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.032732985 | FC = -0.521968985 |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.390168736 | FC = -0.176521061 |
| Intracellular hyaluronan-binding protein 4 | Q5JVS0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.703282239515405 | FC = 0.0125816073534676 |
| Isoaspartyl peptidase/L-asparaginase | Q7L266 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isocitric dehydrogenase subunit alpha | P50213 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Isopentenyl-diphosphate Delta-isomerase 1 | Q13907 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| JNK-interacting protein 4 | O60271 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Jupiter microtubule associated homolog 2 | Q9H910 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Kinectin | Q86UP2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.38967287259263 | FC = 0.00124162990208282 |
| KRR1 small subunit processome component homolog | Q13601 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.475804531332081 | FC = 0.0364688005855282 |
| KRR1 small subunit processome component homolog | Q13601 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.036468801 | FC = -0.475804531 |
| L-lactate dehydrogenase A chain | P00338 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.04945063 | FC = 0.453933624 |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| La-related protein 4B | Q92615 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.535843930972182 | FC = 0.0276688335396813 |
| La-related protein 7 | Q4G0J3 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.742286792316691 | FC = 0.0132898804299615 |
| La-related protein 7 | Q4G0J3 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.01328988 | FC = 0.742286792 |
| LANP-like protein | Q9BTT0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Leucine-rich repeat-containing protein 47 | Q8N1G4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.706314968084539 | FC = 0.00648665195356112 |
| Leucine-rich repeat-containing protein 59 | Q96AG4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.517938275910873 | FC = 0.0291509876345372 |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.844999581 | FC = 0.039970927 |
| M2 antigen complex 70 kDa subunit | P10515 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Malate dehydrogenase | P40926 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mammalian ependymin-related protein 1 | Q9UM22 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mapmodulin | P39687 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| MARCKS-related protein | P49006 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.97159665672369 | FC = 0.0053543217576747 |
| MCCase subunit beta | Q9HCC0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Medium tumor antigen-associated 61 kDa protein | P30153 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Methionine adenosyltransferase 2 subunit beta | Q9NZL9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Methylosome subunit pICln | P54105 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| MHC class I region proline-rich protein CAT53 | Q96QC0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.25314047653636 | FC = 0.00148187124160397 |
| Microtubule-associated protein 1S | Q66K74 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Mitochondrial import inner membrane translocase subunit Tim13 | Q9Y5L4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mitochondrial proton/calcium exchanger protein | O95202 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Moesin | P26038 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.18637538139219 | FC = 0.0156321343186303 |
| mPR | O00264 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Muscleblind-like protein 1 | Q9NR56 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.881921034905076 | FC = 0.00924649808482684 |
| Myb-binding protein 1A | Q9BQG0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.10356843999449 | FC = 0.000703400580934662 |
| Myb-binding protein 1A | Q9BQG0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000703401 | FC = -1.10356844 |
| Myelin expression factor 2 | Q9P2K5 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.27146500745194 | FC = 0.000285583689624043 |
| Myelin expression factor 2 | Q9P2K5 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000285584 | FC = -1.271465007 |
| Myosin regulatory light chain 12B | O14950 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Myristoylated alanine-rich C-kinase substrate | P29966 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| N-sulphoglucosamine sulphohydrolase | P51688 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| NAC-alpha | Q13765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| NADH-cytochrome b5 reductase 3 | P00387 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.09196639603915 | FC = 0.0275147405623509 |
| NADH-ubiquinone oxidoreductase 24 kDa subunit | P19404 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Nesprin-1 | Q8NF91 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.15111783372162 | FC = 0.000523988334566041 |
| Nesprin-2 | Q8WXH0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Nesprin-2 | Q8WXH0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Neuroguidin | Q8NEJ9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 2.27455070194003 | FC = 0.000911785623156543 |
| Neuronal calcium sensor 1 | P62166 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.04050408171152 | FC = 0.00309234808343897 |
| NonO protein | Q15233 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.003092348 | FC = -1.040504082 |
| Novel SH2-containing protein 2 | O75815 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Nucleolar and coiled-body phosphoprotein 1 | Q14978 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.838190389112448 | FC = 0.0102523520735674 |
| Nucleolar complex protein 3 homolog | Q8WTT2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.154180214 | FC = -0.448288609 |
| Nucleolar GTP-binding protein 2 | Q13823 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.03891860901226 | FC = 0.00112197231940826 |
| Nucleolar pre-ribosomal-associated protein 1 | O60287 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.09846801036957 | FC = 0.000518253803743954 |
| Nucleolar protein 1 | P46087 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.984710910714905 | FC = 0.000943467078235894 |
| Nucleolar protein 1 | P46087 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000943467 | FC = -0.984710911 |
| Nucleolar protein 10 | Q9BSC4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.501042159956073 | FC = 0.0365744797735825 |
| Nucleolar protein 14 | P78316 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.484124640453371 | FC = 0.0359070285689334 |
| Nucleolar protein 16 | Q9Y3C1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.603238068591248 | FC = 0.0159880094292227 |
| Nucleolar protein 16 | Q9Y3C1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.015988009 | FC = -0.603238069 |
| Nucleolar protein 56 | O00567 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.09051778 | FC = -0.383002589 |
| Nucleolar protein 58 | Q9Y2X3 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.100172216 | FC = -0.376702162 |
| Nucleolar protein 8 | Q76FK4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Nucleolar protein 9 | Q86U38 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.908167004352712 | FC = 0.00301974404887123 |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.552403526792343 | FC = 0.0256768173438853 |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.025676817 | FC = -0.552403527 |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.815495836519395 | FC = 0.0028437436947374 |
| Nucleolysin TIAR | Q01085 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.710031965121634 | FC = 0.00852271534475037 |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.071154761 | FC = -0.426279988 |
| Nucleoside diphosphate kinase | Q32Q12 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.693546363085844 | FC = 0.0221931898916963 |
| OGDC-E2 | P36957 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PABP-interacting protein 2 | Q9BPZ3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PAF acetylhydrolase 29 kDa subunit | Q15102 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.949273256 | FC = 0.012537511 |
| Paraspeckle component 1 | Q8WXF1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.38743430009746 | FC = 0.000771804700741382 |
| Paraspeckle component 1 | Q8WXF1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000771805 | FC = -1.3874343 |
| PDHE1-A type I | P08559 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PDHE1-B | P11177 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase A | P62937 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.57530942138671 | FC = 0.0172361911796141 |
| Peptidyl-prolyl cis-trans isomerase A | P62937 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.017236191 | FC = 0.575309421 |
| Peptidyl-prolyl cis-trans isomerase F | P30405 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase FKBP10 | Q96AY3 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase FKBP4 | Q02790 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-1 | Q06830 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.046692341 | FC = 0.703142065 |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-5 | P30044 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxisomal biogenesis factor 19 | P40855 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Pescadillo homolog | O00541 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.04935054040997 | FC = 0.000730972027279807 |
| Pescadillo homolog | O00541 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000730972 | FC = -1.04935054 |
| Phenylalanine--tRNA ligase beta subunit | Q9NSD9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.586380032667563 | FC = 0.0157302011737094 |
| Phosphatidylethanolamine-binding protein 1 | P30086 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.03590839177428 | FC = 0.00123105105297411 |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Phosphoribosylformylglycinamidine synthase | O15067 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Poly(rC)-binding protein 1 | Q15365 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.285221863 | FC = 0.220005813 |
| Poly(rC)-binding protein 2 | Q15366 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.671261317 | FC = 0.087119627 |
| Poly(U)-binding-splicing factor | Q9UHX1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.706573613737764 | FC = 0.0118667842861435 |
| Poly(U)-binding-splicing factor | Q9UHX1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.011866784 | FC = -0.706573614 |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.0635394113223 | FC = 0.000980943768146977 |
| Polyadenylate-binding protein 2 | Q86U42 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.64926913063245 | FC = 0.0181982892566256 |
| Polyadenylate-binding protein 4 | Q13310 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.27897882978506 | FC = 0.000341726555321468 |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.14019230353617 | FC = 0.000561093900506348 |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000561094 | FC = -1.140192304 |
| Positive cofactor 4 | P53999 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| PP2A-beta | P62714 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| pre-mRNA 3' end processing protein WDR33 | Q9C0J8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.67924409422662 | FC = 0.00425996354076173 |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.674533118623161 | FC = 0.0288967528682227 |
| Pre-rRNA-processing protein TSR1 homolog | Q2NL82 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.04306724 | FC = -0.965197808 |
| Prefoldin subunit 2 | Q9UHV9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 4 | Q9NQP4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prefoldin subunit 5 | Q99471 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Probable ATP-dependent RNA helicase DDX10 | Q13206 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.52723572680186 | FC = 0.000151515595355443 |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.45221356 | FC = -0.151843229 |
| Probable ATP-dependent RNA helicase DDX27 | Q96GQ7 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.29438788432795 | FC = 0.000147040272711342 |
| Probable ATP-dependent RNA helicase DDX27 | Q96GQ7 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.00014704 | FC = -1.294387884 |
| Probable ATP-dependent RNA helicase DDX31 | Q9H8H2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.16850731003299 | FC = 0.000331236757636976 |
| Probable ATP-dependent RNA helicase DDX31 | Q9H8H2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000331237 | FC = -1.16850731 |
| Probable ATP-dependent RNA helicase DDX5 | P17844 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.393914258 | FC = -0.193593893 |
| Probable ATP-dependent RNA helicase DDX52 | Q9Y2R4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.765574112163684 | FC = 0.00931606553493461 |
| Probable ATP-dependent RNA helicase DDX56 | Q9NY93 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.52237232824421 | FC = 0.000434792708113641 |
| Probable RNA-binding protein 19 | Q9Y4C8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.872227080493375 | FC = 0.00259433109528835 |
| Probable rRNA-processing protein EBP2 | Q99848 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.81685249419184 | FC = 1.26685357845767E-05 |
| Probable rRNA-processing protein EBP2 | Q99848 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 1.26685E-05 | FC = -1.816852494 |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prohibitin 1 | P35232 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Prohibitin-2 | Q99623 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proliferating cell nuclear antigen | P12004 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.988661117181991 | FC = 0.00166083998985596 |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.00166084 | FC = -0.988661117 |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.917778010508433 | FC = 0.00133648681061512 |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.001336487 | FC = 0.917778011 |
| Prolyl endopeptidase | P48147 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-1 | P25786 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-2 | P25787 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-3 | P25788 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-4 | P25789 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-5 | P28066 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-6 | P60900 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit alpha type-7 | O14818 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-1 | P20618 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-2 | P49721 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-3 | P49720 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-4 | P28070 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-5 | P28074 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Proteasome subunit beta type-6 | P28072 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein C2f | Q92979 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.297517565 | FC = -0.431483651 |
| Protein CutA | O60888 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A3 | P30101 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A4 | P13667 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein disulfide-isomerase A6 | Q15084 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein FAM136A | Q96C01 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein FAM98A | Q8NCA5 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.08020303 | FC = 0.403308452 |
| Protein FAM98B | Q52LJ0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.331008613 | FC = -0.285156228 |
| Protein ftsJ homolog 3 | Q8IY81 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.806629376562418 | FC = 0.00354312250575333 |
| Protein ftsJ homolog 3 | Q8IY81 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.003543123 | FC = -0.806629377 |
| Protein KRI1 homolog | Q8N9T8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Protein LZIC | Q8WZA0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein NipSnap homolog 3A | Q9UFN0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein PAT1 homolog 1 | Q86TB9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.889077016761978 | FC = 0.00451819653618386 |
| Protein phosphatase 1 regulatory subunit 14B | Q96C90 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase 1G | O15355 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein phosphatase inhibitor 2 | P41236 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein PRRC2C | Q9Y520 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.628847351483287 | FC = 0.010781204029622 |
| Protein PRRC2C | Q9Y520 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.010781204 | FC = 0.628847351 |
| Protein RRP5 homolog | Q14690 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.2532977082524 | FC = 0.000315930528396872 |
| Protein RRP5 homolog | Q14690 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000315931 | FC = -1.253297708 |
| Protein SET | Q01105 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Protein-glutamine methyltransferase | A6NHQ2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.683748153902091 | FC = 0.00950583180698874 |
| Pseudouridylate synthase TRUB2 | O95900 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Pterin-4-alpha-carbinolamine dehydratase | P61457 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Pumilio homolog 1 | Q14671 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.679495095690222 | FC = 0.00818925948149431 |
| Pumilio homolog 3 | Q15397 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.17170850382208 | FC = 0.00025991020747936 |
| Puromycin-sensitive aminopeptidase | P55786 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Putative ATP-dependent RNA helicase DHX57 | Q6P158 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.831063987293251 | FC = 0.00363738710310034 |
| Putative ATP-dependent RNA helicase DHX57 | Q6P158 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.003637387 | FC = 0.831063987 |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.160484703 | FC = 0.311073515 |
| Rab GDP dissociation inhibitor beta | P50395 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.00854126138748 | FC = 0.00411045754984502 |
| Ragulator complex protein LAMTOR5 | O43504 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ras GTPase-activating protein-binding protein 1 | Q13283 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.1643803 | FC = 0.335258912 |
| Ras-related protein Rab-11A | P62491 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.104387925 | FC = 0.392656813 |
| Regulator of G-protein signaling 10 | O43665 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.993833778876986 | FC = 0.000938884813032526 |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000938885 | FC = -0.993833779 |
| Reticulocalbin-1 | Q15293 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Reticulocalbin-2 | Q14257 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Rho GDP-dissociation inhibitor 1 | P52565 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | P = 8.4341186219482E-05 | FC = -4.14877252947736 |
| Rho guanine nucleotide exchange factor 1 | Q92888 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Ribonucleoprotein PTB-binding 1 | Q8IY67 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.955979016824441 | FC = 0.00225679428355748 |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ribosomal L1 domain-containing protein 1 | O76021 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.868028766126897 | FC = 0.0023110571410468 |
| Ribosomal L1 domain-containing protein 1 | O76021 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.002311057 | FC = -0.868028766 |
| Ribosomal RNA processing protein 1 homolog A | P56182 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.02639463918253 | FC = 0.00682526660013895 |
| Ribosomal RNA processing protein 1 homolog B | Q14684 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.102256816 | FC = -0.363805727 |
| Ribosomal RNA processing protein 36 homolog | Q96EU6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.24417666444863 | FC = 0.0027920627232782 |
| Ribosomal RNA-processing protein 7 homolog A | Q9Y3A4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.64499259818934 | FC = 0.0149915515794909 |
| Ribosomal RNA-processing protein 8 | O43159 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.05760686047596 | FC = 0.00163183252545877 |
| Ribosome biogenesis inhibitor MINAS-60 | P0DW28 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.21092752729605 | FC = 0.000358038185830654 |
| Ribosome biogenesis protein BMS1 homolog | Q14692 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.523715560807946 | FC = 0.0333071536933798 |
| Ribosome biogenesis protein BMS1 homolog | Q14692 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.033307154 | FC = -0.523715561 |
| Ribosome biogenesis protein BRX1 homolog | Q8TDN6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.11849180549973 | FC = 0.00328661222198654 |
| Ribosome biogenesis protein BRX1 homolog | Q8TDN6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.003286612 | FC = -1.118491805 |
| Ribosome biogenesis protein NOP53 | Q9NZM5 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.915334492625589 | FC = 0.00981927783301145 |
| Ribosome biogenesis protein NOP53 | Q9NZM5 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.009819278 | FC = -0.915334493 |
| Ribosome biogenesis protein NSA2 homolog | O95478 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.40778853075118 | FC = 7.80565451821716E-05 |
| Ribosome biogenesis regulatory protein homolog | Q15050 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.900460794969923 | FC = 0.00166316393475885 |
| Ribosome biogenesis regulatory protein homolog | Q15050 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.001663164 | FC = -0.900460795 |
| Ribosome production factor 1 | Q9H9Y2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.046437407 | FC = -0.598331594 |
| Ribosome production factor 2 homolog | Q9H7B2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.17874896583526 | FC = 0.000729769952043893 |
| Ribosome production factor 2 homolog | Q9H7B2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.00072977 | FC = -1.178748966 |
| Ribosome quality control complex subunit NEMF | O60524 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Ribosome-binding protein 1 | Q9P2E9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.06339396195357 | FC = 0.000873116990959091 |
| RNA cytidine acetyltransferase | Q9H0A0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.353340738 | FC = -0.283778986 |
| RNA cytosine C(5)-methyltransferase NSUN2 | Q08J23 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.082352312 | FC = -0.38274315 |
| RNA exonuclease 4 | Q9GZR2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.06716515678316 | FC = 0.000491034373534316 |
| RNA exonuclease 4 | Q9GZR2 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000491034 | FC = -1.067165157 |
| RNA helicase aquarius | O60306 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.20374380945265 | FC = 0.000400283661090545 |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.780237930806771 | FC = 0.00760520684959605 |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.007605207 | FC = 0.780237931 |
| RNA-binding protein 15 | Q96T37 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.509712316465038 | FC = 0.0298941453185544 |
| RNA-binding protein 20 | Q5T481 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| RNA-binding protein 28 | Q9NW13 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.25141702328623 | FC = 0.00018257572310037 |
| RNA-binding protein 28 | Q9NW13 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000182576 | FC = -1.251417023 |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| RNA-binding protein 34 | P42696 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.885903033355005 | FC = 0.00186599975544445 |
| RNA-binding protein 34 | P42696 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.001866 | FC = -0.885903033 |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.18575263456586 | FC = 0.00046552113250379 |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000465521 | FC = -1.185752635 |
| RNA-binding protein FUS | P35637 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.037668368 | FC = -0.54019056 |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.66906131 | FC = 0.098152543 |
| RNA-binding protein Raly | Q9UKM9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.549252486071463 | FC = 0.0335258003064395 |
| RNA-binding protein with serine-rich domain 1 | Q15287 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.11784282732681 | FC = 0.0251538192751742 |
| RNA-splicing ligase RtcB homolog | Q9Y3I0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.708079945710355 | FC = 0.024286793297967 |
| RNA-splicing ligase RtcB homolog | Q9Y3I0 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.024286793 | FC = 0.708079946 |
| rRNA 2'-O-methyltransferase fibrillarin | P22087 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.521451094280218 | FC = 0.0251089947452661 |
| rRNA 2'-O-methyltransferase fibrillarin | P22087 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.025108995 | FC = -0.521451094 |
| RRP12-like protein | Q5JTH9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.811071781801764 | FC = 0.00697691337054076 |
| RRP12-like protein | Q5JTH9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.006976913 | FC = -0.811071782 |
| RuvB-like 1 | Q9Y265 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| S-phase kinase-associated protein 1 | P63208 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SAP domain-containing ribonucleoprotein | P82979 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Secernin-1 | Q12765 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine hydroxymethyltransferase | P34897 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.797223798 | FC = -0.056718577 |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serine/arginine-rich splicing factor 3 | P84103 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.140177081 | FC = -0.367073713 |
| Serine/arginine-rich splicing factor 4 | Q08170 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.59753275969091 | FC = 0.0257976844254083 |
| Serine/arginine-rich splicing factor 5 | Q13243 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.558035562 | FC = -0.124593865 |
| Serine/threonine-protein phosphatase CPPED1 | Q9BRF8 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Serpin B6 | P35237 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SH2 domain-containing protein 3C | Q8N5H7 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Sideroflexin-1 | Q9H9B4 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Signal recognition particle subunit SRP54 | P61011 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.10059430419461 | FC = 0.0267020252077412 |
| Small nuclear ribonucleoprotein E | P62304 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.997006931052118 | FC = 0.00608549324359479 |
| Small nuclear ribonucleoprotein E | P62304 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.006085493 | FC = 0.997006931 |
| Small nuclear ribonucleoprotein F | P62306 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Small nuclear ribonucleoprotein Sm D2 | P62316 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.052018325 | FC = 0.438682303 |
| Small subunit processome component 20 homolog | O75691 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.782219034438848 | FC = 0.00493976936021235 |
| Small subunit processome component 20 homolog | O75691 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.004939769 | FC = -0.782219034 |
| Small ubiquitin-related modifier 1 | P63165 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| snRNP-B | P14678 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.881073616799388 | FC = 0.00922177670633939 |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Sorcin | P30626 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SPATS2-like protein | Q9NUQ6 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.19090002813749 | FC = 0.00222343829354194 |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.05981632667052 | FC = 0.00288923472221537 |
| Splicing factor | P23246 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.002889235 | FC = -1.059816327 |
| Splicing factor 1 | Q15637 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.3562956655072 | FC = 0.00138324021040474 |
| Splicing factor 3A subunit 3 | Q12874 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.673944571624185 | FC = 0.010788212089939 |
| Splicing factor 3B subunit 1 | O75533 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.309318845 | FC = -0.225524181 |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.981952419 | FC = 0.008926989 |
| Splicing factor 3B subunit 4 | Q15427 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.27048674341941 | FC = 0.000194843542528159 |
| Splicing factor U2AF 35 kDa subunit | Q01081 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.039775719 | FC = -0.902839544 |
| Splicing factor U2AF 65 kDa subunit | P26368 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.14285682908377 | FC = 0.000590801860234671 |
| Splicing factor U2AF 65 kDa subunit | P26368 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000590802 | FC = -1.142856829 |
| SR-alpha | P08240 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| SRSF protein kinase 1 | Q96SB4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 2.0579569656705 | FC = 0.00154082800559486 |
| Stress-70 protein | P38646 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Stress-induced-phosphoprotein 1 | P31948 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SUMO-activating enzyme subunit 1 | Q9UBE0 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| SUMO-activating enzyme subunit 2 | Q9UBT2 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Superoxide dismutase [Cu-Zn] | P00441 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Superoxide dismutase [Mn] | P04179 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Surfeit locus protein 6 | O75683 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| SURP and G-patch domain-containing protein 2 | Q8IX01 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.744206085389072 | FC = 0.00696167858910886 |
| Synapse-associated protein 1 | Q96A49 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit beta | P78371 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit epsilon | P48643 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| T-complex protein 1 subunit gamma | P49368 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Terminal uridylyltransferase 7 | Q5VYS8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.783814781784232 | FC = 0.0263050148277364 |
| Thioredoxin domain-containing protein 5 | Q8NBS9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Threonine--tRNA ligase 1 | P26639 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thymosin beta-15A | P0CG34 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Thyroid hormone receptor-associated protein 3 | Q9Y2W1 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.551488394807986 | FC = 0.0354351768260619 |
| Torsin-1A-interacting protein 1 | Q5JTV8 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| TP-beta | P55084 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transcription factor A | Q00059 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transcription factor BTF3 homolog 4 | Q96K17 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Transcriptional coactivator YAP1 | P46937 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transcriptional repressor NF-X1 | Q12986 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | . | . |
| Transforming protein RhoA | P61586 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.082180063 | FC = 0.787570797 |
| Transketolase | P29401 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.10686132818399 | FC = 0.0261279303977336 |
| Translocation protein SEC63 homolog | Q9UGP8 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.959384537670181 | FC = 0.0199231509679876 |
| Transportin-1 | Q92973 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.16094702261087 | FC = 0.00470927240936682 |
| Triosephosphate isomerase | P60174 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tripeptidyl-peptidase 2 | P29144 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| TRMT1-like protein | Q7Z2T5 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.84892586446617 | FC = 0.000142288342067885 |
| TRMT1-like protein | Q7Z2T5 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.000142288 | FC = -1.848925864 |
| TTF-1-associated protein 26 | Q9P031 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 4 h | . | . |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.14295304 | FC = 0.334104174 |
| Tubulin beta-4B chain | P68371 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.415371253 | FC = 0.331000692 |
| Tubulin-specific chaperone A | O75347 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Tumor protein D54 | O43399 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| U1 small nuclear ribonucleoprotein 70 kDa | P08621 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.345234792 | FC = 0.26752923 |
| U6 snRNA-associated Sm-like protein LSm5 | Q9Y4Y9 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| U6 snRNA-associated Sm-like protein LSm8 | O95777 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.759420401944529 | FC = 0.0252303214784106 |
| Ubiquitin thioesterase OTUB1 | Q96FW1 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.809767955 | FC = 0.050007059 |
| UBX domain-containing protein 7 | O94888 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UCH-L3 | P15374 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UMP-CMP kinase | P30085 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| UV excision repair protein RAD23 homolog B | P54727 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Valine--tRNA ligase | P26640 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 2.29495084871942 | FC = 1.4157226156798E-05 |
| VDAC-2 | P45880 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Vimentin | P08670 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| WD repeat-containing protein 1 | O75083 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.24309114463128 | FC = 0.0164460326410827 |
| WD repeat-containing protein 3 | Q9UNX4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.861135819146215 | FC = 0.00678391145754046 |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -1.24006194948587 | FC = 0.000202784289090551 |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.529926882335317 | FC = 0.0234829378308001 |
| Xaa-Pro dipeptidase | P12955 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.9357361 | FC = 0.016982338 |
| Y-box-binding protein 3 | P16989 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.42053831 | FC = -0.163672173 |
| YLP motif-containing protein 1 | P49750 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.15571740471275 | FC = 0.0275945384042701 |
| YTH domain-containing family protein 1 | Q9BYJ9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.425516543 | FC = -0.241492073 |
| YTH domain-containing family protein 2 | Q9Y5A9 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.48962062200311 | FC = 0.0329219725132609 |
| YTH domain-containing family protein 3 | Q7Z739 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.534911068 | FC = -0.170623195 |
| Zinc finger CCCH domain-containing protein 15 | Q8WU90 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.952846625618929 | FC = 0.0111657479048997 |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 1.07928569942799 | FC = 0.000638107959756204 |
| Zinc finger CCHC domain-containing protein 3 | Q9NUD5 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | MIST = 0.398147815 | FC = -0.182994225 |
| Zinc finger protein 385B | Q569K4 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.809852117493908 | FC = 0.0253802233267339 |
| Zinc finger protein 428 | Q96B54 | Homo sapiens | Pro Info | Cross-link-assisted mRNP purification (CLAMP) | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 2 h | . | . |
| Zinc finger protein 622 | Q969S3 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = 0.7682829189846 | FC = 0.0181652374761332 |
| Zinc finger protein 9 | P62633 | Homo sapiens | Pro Info | comparative RIC | HEK293 Cells (Human embryonic kidney cell); Mesc cells (Embryonic stem cell) | . | Kidney | 18 h | P = -0.813947365760358 | FC = 0.0037843361216236 |
Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| Ribosome | KEGG Pathway | 2.62E-58 | 26.75221203 | 3691.152953 |
| Coronavirus disease | KEGG Pathway | 1.75E-45 | 14.62479302 | 1575.889493 |
| Spliceosome | KEGG Pathway | 2.04E-17 | 9.370910698 | 400.327837 |
| Prion disease | KEGG Pathway | 4.34E-17 | 6.2833791 | 261.8908768 |
| Parkinson disease | KEGG Pathway | 4.38E-17 | 6.609223709 | 273.923803 |
| Amyotrophic lateral sclerosis | KEGG Pathway | 4.59E-16 | 5.127187185 | 199.5193955 |
| Huntington disease | KEGG Pathway | 1.94E-15 | 5.485504636 | 204.7097819 |
| Proteasome | KEGG Pathway | 1.55E-14 | 20.91608643 | 734.376388 |
| Spinocerebellar ataxia | KEGG Pathway | 7.03E-13 | 7.654422149 | 238.6319638 |
| Alzheimer disease | KEGG Pathway | 2.33E-11 | 4.164991259 | 114.8305973 |
| Ribosome biogenesis in eukaryotes | KEGG Pathway | 2.85E-11 | 8.354424901 | 227.8367889 |
| Pathways of neurodegeneration | KEGG Pathway | 2.86E-11 | 3.678350286 | 99.99021495 |
| RNA transport | KEGG Pathway | 5.56E-11 | 5.825078438 | 153.9954808 |
| Citrate cycle | KEGG Pathway | 1.03E-08 | 18.62633328 | 393.7449528 |
| Glycolysis / Gluconeogenesis | KEGG Pathway | 1.93E-08 | 9.326762285 | 190.6802135 |
| Pyruvate metabolism | KEGG Pathway | 1.66E-07 | 11.0398859 | 201.2603509 |
| Diabetic cardiomyopathy | KEGG Pathway | 1.58E-05 | 3.743178274 | 50.93891155 |
| Protein processing in endoplasmic reticulum | KEGG Pathway | 1.64E-05 | 4.04776936 | 54.7235166 |
| Cysteine and methionine metabolism | KEGG Pathway | 2.66E-05 | 8.021144279 | 104.0978235 |
| mRNA surveillance pathway | KEGG Pathway | 0.000100197 | 4.920117647 | 57.08177661 |
Full list of Host ncRNAs interacting with the Virus RNA
| HncRNA | Host Species | HncRNA Detail | PMID | Source | Target Gene | Target Gene ID | Target Gene Source | PMID | Source |
|---|---|---|---|---|---|---|---|---|---|
| hsa-miR-124-3p | Homo sapiens | HncRNA Info | 32102877 | ViRBase | ZNRD2 | . | miRTarBase | 25639871 | miRTarBase |
Virus RNA Sequence Information
|
>NC_001547.1 Sindbis virus, complete genome
ATTGACGGCGTAGTACACACTATTGAATCAAACAGCCGACCAATTGCACTACCATCACAATGGAGAAGCC
AGTAGTAAACGTAGACGTAGACCCCCAGAGTCCGTTTGTCGTGCAACTGCAAAAAAGCTTCCCGCAATTT
GAGGTAGTAGCACAGCAGGTCACTCCAAATGACCATGCTAATGCCAGAGCATTTTCGCATCTGGCCAGTA
AACTAATCGAGCTGGAGGTTCCTACCACAGCGACGATCTTGGACATAGGCAGCGCACCGGCTCGTAGAAT
GTTTTCCGAGCACCAGTATCATTGTGTCTGCCCCATGCGTAGTCCAGAAGACCCGGACCGCATGATGAAA
TACGCCAGTAAACTGGCGGAAAAAGCGTGCAAGATTACAAACAAGAACTTGCATGAGAAGATTAAGGATC
TCCGGACCGTACTTGATACGCCGGATGCTGAAACACCATCGCTCTGCTTTCACAACGATGTTACCTGCAA
CATGCGTGCCGAATATTCCGTCATGCAGGACGTGTATATCAACGCTCCCGGAACTATCTATCATCAGGCT
ATGAAAGGCGTGCGGACCCTGTACTGGATTGGCTTCGACACCACCCAGTTCATGTTCTCGGCTATGGCAG
GTTCGTACCCTGCGTACAACACCAACTGGGCCGACGAGAAAGTCCTTGAAGCGCGTAACATCGGACTTTG
CAGCACAAAGCTGAGTGAAGGTAGGACAGGAAAATTGTCGATAATGAGGAAGAAGGAGTTGAAGCCCGGG
TCGCGGGTTTATTTCTCCGTAGGATCGACACTTTATCCAGAACACAGAGCCAGCTTGCAGAGCTGGCATC
TTCCATCGGTGTTCCACTTGAATGGAAAGCAGTCGTACACTTGCCGCTGTGATACAGTGGTGAGTTGCGA
AGGCTACGTAGTGAAGAAAATCACCATCAGTCCCGGGATCACGGGAGAAACCGTGGGATACGCGGTTACA
CACAATAGCGAGGGCTTCTTGCTATGCAAAGTTACTGACACAGTAAAAGGAGAACGGGTATCGTTCCCTG
TGTGCACGTACATCCCGGCCACCATATGCGATCAGATGACTGGTATAATGGCCACGGATATATCACCTGA
CGATGCACAAAAACTTCTGGTTGGGCTCAACCAGCGAATTGTCATTAACGGTAGGACTAACAGGAACACC
AACACCATGCAAAATTACCTTCTGCCGATCATAGCACAAGGGTTCAGCAAATGGGCTAAGGAGCGCAAGG
ATGATCTTGATAACGAGAAAATGCTGGGTACTAGAGAACGCAAGCTTACGTATGGCTGCTTGTGGGCGTT
TCGCACTAAGAAAGTACATTCGTTTTATCGCCCACCTGGAACGCAGACCTGCGTAAAAGTCCCAGCCTCT
TTTAGCGCTTTTCCCATGTCGTCCGTATGGACGACCTCTTTGCCCATGTCGCTGAGGCAGAAATTGAAAC
TGGCATTGCAACCAAAGAAGGAGGAAAAACTGCTGCAGGTCTCGGAGGAATTAGTCATGGAGGCCAAGGC
TGCTTTTGAGGATGCTCAGGAGGAAGCCAGAGCGGAGAAGCTCCGAGAAGCACTTCCACCATTAGTGGCA
GACAAAGGCATCGAGGCAGCCGCAGAAGTTGTCTGCGAAGTGGAGGGGCTCCAGGCGGACATCGGAGCAG
CATTAGTTGAAACCCCGCGCGGTCACGTAAGGATAATACCTCAAGCAAATGACCGTATGATCGGACAGTA
TATCGTTGTCTCGCCAAACTCTGTGCTGAAGAATGCCAAACTCGCACCAGCGCACCCGCTAGCAGATCAG
GTTAAGATCATAACACACTCCGGAAGATCAGGAAGGTACGCGGTCGAACCATACGACGCTAAAGTACTGA
TGCCAGCAGGAGGTGCCGTACCATGGCCAGAATTCCTAGCACTGAGTGAGAGCGCCACGTTAGTGTACAA
CGAAAGAGAGTTTGTGAACCGCAAACTATACCACATTGCCATGCATGGCCCCGCCAAGAATACAGAAGAG
GAGCAGTACAAGGTTACAAAGGCAGAGCTTGCAGAAACAGAGTACGTGTTTGACGTGGACAAGAAGCGTT
GCGTTAAGAAGGAAGAAGCCTCAGGTCTGGTCCTCTCGGGAGAACTGACCAACCCTCCCTATCATGAGCT
AGCTCTGGAGGGACTGAAGACCCGACCTGCGGTCCCGTACAAGGTCGAAACAATAGGAGTGATAGGCACA
CCGGGGTCGGGCAAGTCAGCTATTATCAAGTCAACTGTCACGGCACGAGATCTTGTTACCAGCGGAAAGA
AAGAAAATTGTCGCGAAATTGAGGCCGACGTGCTAAGACTGAGGGGTATGCAGATTACGTCGAAGACAGT
AGATTCGGTTATGCTCAACGGATGCCACAAAGCCGTAGAAGTGCTGTACGTTGACGAAGCGTTCGCGTGC
CACGCAGGAGCACTACTTGCCTTGATTGCTATCGTCAGGCCCCGCAAGAAGGTAGTACTATGCGGAGACC
CCATGCAATGCGGATTCTTCAACATGATGCAACTAAAGGTACATTTCAATCACCCTGAAAAAGACATATG
CACCAAGACATTCTACAAGTATATCTCCCGGCGTTGCACACAGCCAGTTACAGCTATTGTATCGACACTG
CATTACGATGGAAAGATGAAAACCACGAACCCGTGCAAGAAGAACATTGAAATCGATATTACAGGGGCCA
CAAAGCCGAAGCCAGGGGATATCATCCTGACATGTTTCCGCGGGTGGGTTAAGCAATTGCAAATCGACTA
TCCCGGACATGAAGTAATGACAGCCGCGGCCTCACAAGGGCTAACCAGAAAAGGAGTGTATGCCGTCCGG
CAAAAAGTCAATGAAAACCCACTGTACGCGATCACATCAGAGCATGTGAACGTGTTGCTCACCCGCACTG
AGGACAGGCTAGTGTGGAAAACCTTGCAGGGCGACCCATGGATTAAGCAGCCCACTAACATACCTAAAGG
AAACTTTCAGGCTACTATAGAGGACTGGGAAGCTGAACACAAGGGAATAATTGCTGCAATAAACAGCCCC
ACTCCCCGTGCCAATCCGTTCAGCTGCAAGACCAACGTTTGCTGGGCGAAAGCATTGGAACCGATACTAG
CCACGGCCGGTATCGTACTTACCGGTTGCCAGTGGAGCGAACTGTTCCCACAGTTTGCGGATGACAAACC
ACATTCGGCCATTTACGCCTTAGACGTAATTTGCATTAAGTTTTTCGGCATGGACTTGACAAGCGGACTG
TTTTCTAAACAGAGCATCCCACTAACGTACCATCCCGCCGATTCAGCGAGGCCGGTAGCTCATTGGGACA
ACAGCCCAGGAACCCGCAAGTATGGGTACGATCACGCCATTGCCGCCGAACTCTCCCGTAGATTTCCGGT
GTTCCAGCTAGCTGGGAAGGGCACACAACTTGATTTGCAGACGGGGAGAACCAGAGTTATCTCTGCACAG
CATAACCTGGTCCCGGTGAACCGCAATCTTCCTCACGCCTTAGTCCCCGAGTACAAGGAGAAGCAACCCG
GCCCGGTCAAAAAATTCTTGAACCAGTTCAAACACCACTCAGTACTTGTGGTATCAGAGGAAAAAATTGA
AGCTCCCCGTAAGAGAATCGAATGGATCGCCCCGATTGGCATAGCCGGTGCAGATAAGAACTACAACCTG
GCTTTCGGGTTTCCGCCGCAGGCACGGTACGACCTGGTGTTCATCAACATTGGAACTAAATACAGAAACC
ACCACTTTCAGCAGTGCGAAGACCATGCGGCGACCTTAAAAACCCTTTCGCGTTCGGCCCTGAATTGCCT
TAACCCAGGAGGCACCCTCGTGGTGAAGTCCTATGGCTACGCCGACCGCAACAGTGAGGACGTAGTCACC
GCTCTTGCCAGAAAGTTTGTCAGGGTGTCTGCAGCGAGACCAGATTGTGTCTCAAGCAATACAGAAATGT
ACCTGATTTTCCGACAACTAGACAACAGCCGTACACGGCAATTCACCCCGCACCATCTGAATTGCGTGAT
TTCGTCCGTGTATGAGGGTACAAGAGATGGAGTTGGAGCCGCGCCGTCATACCGCACCAAAAGGGAGAAT
ATTGCTGACTGTCAAGAGGAAGCAGTTGTCAACGCAGCCAATCCGCTGGGTAGACCAGGCGAAGGAGTCT
GCCGTGCCATCTATAAACGTTGGCCGACCAGTTTTACCGATTCAGCCACGGAGACAGGCACCGCAAGAAT
GACTGTGTGCCTAGGAAAGAAAGTGATCCACGCGGTCGGCCCTGATTTCCGGAAGCACCCAGAAGCAGAA
GCCTTGAAATTGCTACAAAACGCCTACCATGCAGTGGCAGACTTAGTAAATGAACATAACATCAAGTCTG
TCGCCATTCCACTGCTATCTACAGGCATTTACGCAGCCGGAAAAGACCGCCTTGAAGTATCACTTAACTG
CTTGACAACCGCGCTAGACAGAACTGACGCGGACGTAACCATCTATTGCCTGGATAAGAAGTGGAAGGAA
AGAATCGACGCGGCACTCCAACTTAAGGAGTCTGTAACAGAGCTGAAGGATGAAGATATGGAGATCGACG
ATGAGTTAGTATGGATCCATCCAGACAGTTGCTTGAAGGGAAGAAAGGGATTCAGTACTACAAAAGGAAA
ATTGTATTCGTACTTCGAAGGCACCAAATTCCATCAAGCAGCAAAAGACATGGCGGAGATAAAGGTCCTG
TTCCCTAATGACCAGGAAAGTAATGAACAACTGTGTGCCTACATATTGGGTGAGACCATGGAAGCAATCC
GCGAAAAGTGCCCGGTCGACCATAACCCGTCGTCTAGCCCGCCCAAAACGTTGCCGTGCCTTTGCATGTA
TGCCATGACGCCAGAAAGGGTCCACAGACTTAGAAGCAATAACGTCAAAGAAGTTACAGTATGCTCCTCC
ACCCCCCTTCCTAAGCACAAAATTAAGAATGTTCAGAAGGTTCAGTGCACGAAAGTAGTCCTGTTTAATC
CGCACACTCCCGCATTCGTTCCCGCCCGTAAGTACATAGAAGTGCCAGAACAGCCTACCGCTCCTCCTGC
ACAGGCCGAGGAGGCCCCCGAAGTTGTAGCGACACCGTCACCATCTACAGCTGATAACACCTCGCTTGAT
GTCACAGACATCTCACTGGATATGGATGACAGTAGCGAAGGCTCACTTTTTTCGAGCTTTAGCGGATCGG
ACAACTCTATTACTAGTATGGACAGTTGGTCGTCAGGACCTAGTTCACTAGAGATAGTAGACCGAAGGCA
GGTGGTGGTGGCTGACGTTCATGCCGTCCAAGAGCCTGCCCCTATTCCACCGCCAAGGCTAAAGAAGATG
GCCCGCCTGGCAGCGGCAAGAAAAGAGCCCACTCCACCGGCAAGCAATAGCTCTGAGTCCCTCCACCTCT
CTTTTGGTGGGGTATCCATGTCCCTCGGATCAATTTTCGACGGAGAGACGGCCCGCCAGGCAGCGGTACA
ACCCCTGGCAACAGGCCCCACGGATGTGCCTATGTCTTTCGGATCGTTTTCCGACGGAGAGATTGATGAG
CTGAGCCGCAGAGTAACTGAGTCCGAACCCGTCCTGTTTGGATCATTTGAACCGGGCGAAGTGAACTCAA
TTATATCGTCCCGATCAGCCGTATCTTTTCCACTACGCAAGCAGAGACGTAGACGCAGGAGCAGGAGGAC
TGAATACTGACTAACCGGGGTAGGTGGGTACATATTTTCGACGGACACAGGCCCTGGGCACTTGCAAAAG
AAGTCCGTTCTGCAGAACCAGCTTACAGAACCGACCTTGGAGCGCAATGTCCTGGAAAGAATTCATGCCC
CGGTGCTCGACACGTCGAAAGAGGAACAACTCAAACTCAGGTACCAGATGATGCCCACCGAAGCCAACAA
AAGTAGGTACCAGTCTCGTAAAGTAGAAAATCAGAAAGCCATAACCACTGAGCGACTACTGTCAGGACTA
CGACTGTATAACTCTGCCACAGATCAGCCAGAATGCTATAAGATCACCTATCCGAAACCATTGTACTCCA
GTAGCGTACCGGCGAACTACTCCGATCCACAGTTCGCTGTAGCTGTCTGTAACAACTATCTGCATGAGAA
CTATCCGACAGTAGCATCTTATCAGATTACTGACGAGTACGATGCTTACTTGGATATGGTAGACGGGACA
GTCGCCTGCCTGGATACTGCAACCTTCTGCCCCGCTAAGCTTAGAAGTTACCCGAAAAAACATGAGTATA
GAGCCCCGAATATCCGCAGTGCGGTTCCATCAGCGATGCAGAACACGCTACAAAATGTGCTCATTGCCGC
AACTAAAAGAAATTGCAACGTCACGCAGATGCGTGAACTGCCAACACTGGACTCAGCGACATTCAATGTC
GAATGCTTTCGAAAATATGCATGTAATGACGAGTATTGGGAGGAGTTCGCTCGGAAGCCAATTAGGATTA
CCACTGAGTTTGTCACCGCATATGTAGCTAGACTGAAAGGCCCTAAGGCCGCCGCACTATTTGCAAAGAC
GTATAATTTGGTCCCATTGCAAGAAGTGCCTATGGATAGATTCGTCATGGACATGAAAAGAGACGTGAAA
GTTACACCAGGCACGAAACACACAGAAGAAAGACCGAAAGTACAAGTGATACAAGCCGCAGAACCCCTGG
CGACTGCTTACTTATGCGGGATTCACCGGGAATTAGTGCGTAGGCTTACGGCCGTCTTGCTTCCAAACAT
TCACACGCTTTTTGACATGTCGGCGGAGGATTTTGATGCAATCATAGCAGAACACTTCAAGCAAGGCGAC
CCGGTACTGGAGACGGATATCGCATCATTCGACAAAAGCCAAGACGACGCTATGGCGTTAACCGGTCTGA
TGATCTTGGAGGACCTGGGTGTGGATCAACCACTACTCGACTTGATCGAGTGCGCCTTTGGAGAAATATC
ATCCACCCATCTACCTACGGGTACTCGTTTTAAATTCGGGGCGATGATGAAATCCGGAATGTTCCTCACA
CTTTTTGTCAACACAGTTTTGAATGTCGTTATCGCCAGCAGAGTACTAGAAGAGCGGCTTAAAACGTCCA
GATGTGCAGCGTTCATTGGCGACGACAACATCATACATGGAGTAGTATCTGACAAAGAAATGGCTGAGAG
GTGCGCCACCTGGCTCAACATGGAGGTTAAGATCATCGACGCAGTCATCGGTGAGAGACCACCTTACTTC
TGCGGCGGATTTATCTTGCAAGATTCGGTTACTTCCACAGCGTGCCGCGTGGCGGATCCCCTGAAAAGGC
TGTTTAAGTTGGGTAAACCGCTCCCAGCCGACGACGAGCAAGACGAAGACAGAAGACGCGCTCTGCTAGA
TGAAACAAAGGCGTGGTTTAGAGTAGGTATAACAGGCACTTTAGCAGTGGCCGTGACGACCCGGTATGAG
GTAGACAATATTACACCTGTCCTACTGGCATTGAGAACTTTTGCCCAGAGCAAAAGAGCATTCCAAGCCA
TCAGAGGGGAAATAAAGCATCTCTACGGTGGTCCTAAATAGTCAGCATAGTACATTTCATCTGACTAATA
CTACAACACCACCACCATGAATAGAGGATTCTTTAACATGCTCGGCCGCCGCCCCTTCCCGGCCCCCACT
GCCATGTGGAGGCCGCGGAGAAGGAGGCAGGCGGCCCCGATGCCTGCCCGCAACGGGCTGGCTTCTCAAA
TCCAGCAACTGACCACAGCCGTCAGTGCCCTAGTCATTGGACAGGCAACTAGACCTCAACCCCCACGTCC
ACGCCCGCCACCGCGCCAGAAGAAGCAGGCGCCCAAGCAACCACCGAAGCCGAAGAAACCAAAAACGCAG
GAGAAGAAGAAGAAGCAACCTGCAAAACCCAAACCCGGAAAGAGACAGCGCATGGCACTTAAGTTGGAGG
CCGACAGATTGTTCGACGTCAAGAACGAGGACGGAGATGTCATCGGGCACGCACTGGCCATGGAAGGAAA
GGTAATGAAACCTCTGCACGTGAAAGGAACCATCGACCACCCTGTGCTATCAAAGCTCAAATTTACCAAG
TCGTCAGCATACGACATGGAGTTCGCACAGTTGCCAGTCAACATGAGAAGTGAGGCATTCACCTACACCA
GTGAACACCCCGAAGGATTCTATAACTGGCACCACGGAGCGGTGCAGTATAGTGGAGGTAGATTTACCAT
CCCTCGCGGAGTAGGAGGCAGAGGAGACAGCGGTCGTCCGATCATGGATAACTCCGGTCGGGTTGTCGCG
ATAGTCCTCGGTGGCGCTGATGAAGGAACACGAACTGCCCTTTCGGTCGTCACCTGGAATAGTAAAGGGA
AGACAATTAAGACGACCCCGGAAGGGACAGAAGAGTGGTCCGCAGCACCACTGGTCACGGCAATGTGTTT
GCTCGGAAATGTGAGCTTCCCATGCGACCGCCCGCCCACATGCTATACCCGCGAACCTTCCAGAGCCCTC
GACATCCTTGAAGAGAACGTGAACCATGAGGCCTACGATACCCTGCTCAATGCCATATTGCGGTGCGGAT
CGTCTGGCAGAAGCAAAAGAAGCGTCATTGACGACTTTACCCTGACCAGCCCCTACTTGGGCACATGCTC
GTACTGCCACCATACTGTACCGTGCTTCAGCCCTGTTAAGATCGAGCAGGTCTGGGACGAAGCGGACGAT
AACACCATACGCATACAGACTTCCGCCCAGTTTGGATACGACCAAAGCGGAGCAGCAAGCGCAAACAAGT
ACCGCTACATGTCGCTTAAGCAGGATCACACCGTTAAAGAAGGCACCATGGATGACATCAAGATTAGCAC
CTCAGGACCGTGTAGAAGGCTTAGCTACAAAGGATACTTTCTCCTCGCAAAATGCCCTCCAGGGGACAGC
GTAACGGTTAGCATAGTGAGTAGCAACTCAGCAACGTCATGTACACTGGCCCGCAAGATAAAACCAAAAT
TCGTGGGACGGGAAAAATATGATCTACCTCCCGTTCACGGTAAAAAAATTCCTTGCACAGTGTACGACCG
TCTGAAAGAAACAACTGCAGGCTACATCACTATGCACAGGCCGAGACCGCACGCTTATACATCCTACCTG
GAAGAATCATCAGGGAAAGTTTACGCAAAGCCGCCATCTGGGAAGAACATTACGTATGAGTGCAAGTGCG
GCGACTACAAGACCGGAACCGTTTCGACCCGCACCGAAATCACTGGTTGCACCGCCATCAAGCAGTGCGT
CGCCTATAAGAGCGACCAAACGAAGTGGGTCTTCAACTCACCGGACTTGATCAGACATGACGACCACACG
GCCCAAGGGAAATTGCATTTGCCTTTCAAGTTGATCCCGAGTACCTGCATGGTCCCTGTTGCCCACGCGC
CGAATGTAATACATGGCTTTAAACACATCAGCCTCCAATTAGATACAGACCACTTGACATTGCTCACCAC
CAGGAGACTAGGGGCAAACCCGGAACCAACCACTGAATGGATCGTCGGAAAGACGGTCAGAAACTTCACC
GTCGACCGAGATGGCCTGGAATACATATGGGGAAATCATGAGCCAGTGAGGGTCTATGCCCAAGAGTCAG
CACCAGGAGACCCTCACGGATGGCCACACGAAATAGTACAGCATTACTACCATCGCCATCCTGTGTACAC
CATCTTAGCCGTCGCATCAGCTACCGTGGCGATGATGATTGGCGTAACTGTTGCAGTGTTATGTGCCTGT
AAAGCGCGCCGTGAGTGCCTGACGCCATACGCCCTGGCCCCAAACGCCGTAATCCCAACTTCGCTGGCAC
TCTTGTGCTGCGTTAGGTCGGCCAATGCTGAAACGTTCACCGAGACCATGAGTTACTTGTGGTCGAACAG
TCAGCCGTTCTTCTGGGTCCAGTTGTGCATACCTTTGGCCGCTTTCATCGTTCTAATGCGCTGCTGCTCC
TGCTGCCTGCCTTTTTTAGTGGTTGCCGGCGCCTACCTGGCGAAGGTAGACGCCTACGAACATGCGACCA
CTGTTCCAAATGTGCCACAGATACCGTATAAGGCACTTGTTGAAAGGGCAGGGTATGCCCCGCTCAATTT
GGAGATCACTGTCATGTCCTCGGAGGTTTTGCCTTCCACCAACCAAGAGTACATTACCTGCAAATTCACC
ACTGTGGTCCCCTCCCCAAAAATCAAATGCTGCGGCTCCTTGGAATGTCAGCCGGCCGCTCATGCAGACT
ATACCTGCAAGGTCTTCGGAGGGGTCTACCCCTTTATGTGGGGAGGAGCGCAATGTTTTTGCGACAGTGA
GAACAGCCAGATGAGTGAGGCGTACGTCGAATTGTCAGCAGATTGCGCGTCTGACCACGCGCAGGCGATT
AAGGTGCACACTGCCGCGATGAAAGTAGGACTGCGTATTGTGTACGGGAACACTACCAGTTTCCTAGATG
TGTACGTGAACGGAGTCACACCAGGAACGTCTAAAGACTTGAAAGTCATAGCTGGACCAATTTCAGCATC
GTTTACGCCATTCGATCATAAGGTCGTTATCCATCGCGGCCTGGTGTACAACTATGACTTCCCGGAATAT
GGAGCGATGAAACCAGGAGCGTTTGGAGACATTCAAGCTACCTCCTTGACTAGCAAGGATCTCATCGCCA
GCACAGACATTAGGCTACTCAAGCCTTCCGCCAAGAACGTGCATGTCCCGTACACGCAGGCCTCATCAGG
ATTTGAGATGTGGAAAAACAACTCAGGCCGCCCACTGCAGGAAACCGCACCTTTCGGGTGTAAGATTGCA
GTAAATCCGCTCCGAGCGGTGGACTGTTCATACGGGAACATTCCCATTTCTATTGACATCCCGAACGCTG
CCTTTATCAGGACATCAGATGCACCACTGGTCTCAACAGTCAAATGTGAAGTCAGTGAGTGCACTTATTC
AGCAGACTTCGGCGGGATGGCCACCCTGCAGTATGTATCCGACCGCGAAGGTCAATGCCCCGTACATTCG
CATTCGAGCACAGCAACTCTCCAAGAGTCGACAGTACATGTCCTGGAGAAAGGAGCGGTGACAGTACACT
TTAGCACCGCGAGTCCACAGGCGAACTTTATCGTATCGCTGTGTGGGAAGAAGACAACATGCAATGCAGA
ATGTAAACCACCAGCTGACCATATCGTGAGCACCCCGCACAAAAATGACCAAGAATTTCAAGCCGCCATC
TCAAAAACATCATGGAGTTGGCTGTTTGCCCTTTTCGGCGGCGCCTCGTCGCTATTAATTATAGGACTTA
TGATTTTTGCTTGCAGCATGATGCTGACTAGCACACGAAGATGACCGCTACGCCCCAATGATCCGACCAG
CAAAACTCGATGTACTTCCGAGGAACTGATGTGCATAATGCATCAGGCTGGTACATTAGATCCCCGCTTA
CCGCGGGCAATATAGCAACACTAAAAACTCGATGTACTTCCGAGGAAGCGCAGTGCATAATGCTGCGCAG
TGTTGCCACATAACCACTATATTAACCATTTATCTAGCGGACGCCAAAAACTCAATGTATTTCTGAGGAA
GCGTGGTGCATAATGCCACGCAGCGTCTGCATAACTTTTATTATTTCTTTTATTAATCAACAAAATTTTG
TTTTTAACATTTC
Click to Show/Hide
|

