Home
Search 
BLAST
Manual
DownloadDetails of Virus RNA
| Strain Information | Strain Name |
Dengue virus 2 (strain NGC)
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Flaviviridae
|
||||||||
| RNA Binding Site |
5'UTR - 3'UTR
|
||||||||
| Virus Information | Virus Name |
Dengue virus 2 (DENV2)
|
|||||||
| Taxonomy ID | 11060 | ||||||||
Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 130 kDa leucine-rich protein | P42704 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 2-hydroxyacyl-CoA lyase 1 | Q9UJ83 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 14 | O00487 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 26S proteasome regulatory subunit 10B | P62333 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 26S proteasome regulatory subunit 7 | P35998 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 28S ribosomal protein S21 | P82921 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 3 beta-hydroxysteroid dehydrogenase type 7 | Q9H2F3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 3-hydroxyacyl-CoA dehydratase 2 | Q6Y1H2 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 3-hydroxyacyl-CoA dehydrogenase type-2 | Q99714 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 3-keto acyl-CoA synthase ELOVL1 | Q9BW60 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 3-oxoacyl-[acyl-carrier-protein] reductase | Q8N4T8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 39S ribosomal protein L21 | Q7Z2W9 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 39S ribosomal protein L24 | Q96A35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 39S ribosomal protein L24 | Q96A35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 39S ribosomal protein L37 | Q9BZE1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S10 | P46783 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S11 | P62280 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S12 | P25398 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S12 | P25398 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S17 | P08708 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S19 | P39019 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S20 | P60866 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S23 | P62266 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S25 | P62851 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S27 | P42677 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 45 kDa Sin3-associated polypeptide | Q9H7L9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 4F2 light chain | Q01650 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 4F2 light chain | Q01650 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 5'-3' exonuclease PLD3 | Q8IV08 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 5'-3' exonuclease PLD3 | Q8IV08 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 5-hydroxytryptamine receptor 1E | P28566 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 5-hydroxytryptamine receptor 3C | Q8WXA8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S acidic ribosomal protein P1 | P05386 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S acidic ribosomal protein P1 | P05386 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S acidic ribosomal protein P2 | P05387 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S acidic ribosomal protein P2 | P05387 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L10a | P62906 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L10a | P62906 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L11 | P62913 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L17 | P18621 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L18 | Q07020 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L19 | P84098 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L19 | P84098 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L21 | P46778 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L21 | P46778 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L23 | P62829 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L23 | P62829 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L27a | P46776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L27a | P46776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L28 | P46779 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L29 | P47914 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L35 | P42766 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L35a | P18077 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L36 | Q9Y3U8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L36 | Q9Y3U8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L38 | P63173 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L38 | P63173 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L38 | P63173 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L39 | P62891 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 60S ribosomal protein L9 | P32969 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 7-dehydrocholesterol reductase | Q9UBM7 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| 72 kDa inositol polyphosphate 5-phosphatase | Q9NRR6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| 7SK snRNA methylphosphate capping enzyme | Q7L2J0 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| A-kinase anchor protein 1 | Q92667 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Acrosin-binding protein | Q8NEB7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Actin | P68133 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Actin-binding protein WASF1 | Q92558 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Activated CDC42 kinase 1 | Q07912 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Activating signal cointegrator 1 complex subunit 3-like 1 | Q5ZF01 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Acyl-CoA (8-3)-desaturase | O60427 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ADAM 9 | Q13443 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ADAM-TS 16 | Q8TE57 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ADAM-TS 17 | Q8TE56 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ADAM-TS 20 | P59510 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Adenomatous polyposis coli protein | P25054 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Adhesion molecule in glia | P14415 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ADP-ribosylation factor-like protein 13B | Q3SXY8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ADP/ATP translocase 2 | P05141 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Afadin | P55196 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Agouti-related protein | O00253 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Albumin | P02768 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Aldehyde dehydrogenase 1A1 | P00352 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Aldehyde dehydrogenase family 3 member B2 | P48448 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Alpha-adducin | P35611 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Angiopoietin-1 receptor | Q02763 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Angiopoietin-4 | Q9Y264 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Anion exchange protein 2 | P04920 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ankyrin repeat domain-containing protein 7 | Q92527 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Antigen NY-CO-16 | Q9BVJ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| AP2-associated protein kinase 1 | Q2M2I8 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Apo-1 antigen | P25445 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Apoptosis-inducing factor 1 | O95831 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Apoptosis-related protein 3 | Q6UW56 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Arginine-rich protein | P55145 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Armadillo repeat-containing protein 6 | Q6NXE6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP synthase subunit alpha | P25705 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP synthase subunit ATP5MJ | P56378 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP-binding cassette sub-family B member 5 | Q2M3G0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ATP-binding cassette sub-family D member 1 | P33897 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP-binding cassette sub-family D member 3 | P28288 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| ATP-dependent RNA helicase DDX18 | Q9NVP1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ATP-sensitive inward rectifier potassium channel 12 | Q14500 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Band 4.1-like protein 2 | O43491 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Beta-2 adrenergic receptor | P07550 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Beta-adrenergic receptor kinase 1 | P25098 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Beta-crystallin B3 | P26998 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Beta-defensin 123 | Q8N688 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Beta-hexosaminidase subunit beta | P07686 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Beta-sarcoglycan | Q16585 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| BFA-resistant GEF 1 | Q92538 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| BFA-resistant GEF 1 | Q92538 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| BLOC-3 complex member HPS1 | Q92902 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Brain calcium channel II | Q15878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Bromodomain and PHD finger-containing protein 3 | Q9ULD4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Bromodomain testis-specific protein | Q58F21 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| BTB/POZ domain-containing protein 8 | Q5XKL5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| BTB/POZ domain-containing protein 9 | Q96Q07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| C-C chemokine receptor type 6 | P51684 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| C-reactive protein | P02741 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| CA-VB-like protein | Q8WTZ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| CAAX prenyl protease 2 | Q9Y256 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| CADPS protein | A2RRN7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Calcium load-activated calcium channel | Q9UM00 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Calcium-binding protein 7 | Q86V35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Calmegin | O14967 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Calmodulin-like protein 6 | Q8TD86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Calmodulin-like protein 6 | Q8TD86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Calpain-9 | O14815 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Calponin homology domain-containing protein 1 | Q9Y2L9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| cAMP and cGMP phosphodiesterase 11A | Q9HCR9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| cAMP-dependent protein kinase inhibitor gamma | Q9Y2B9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Carnitine palmitoyltransferase 1B | Q92523 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Caspase-2 | P42575 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cathepsin K | P43235 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cationic amino acid transporter 2 | P52569 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| CD151 antigen | P48509 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cell adhesion protein SQM1 | P17568 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cell cycle checkpoint control protein RAD9A | Q99638 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cell cycle control protein TS11 | P08243 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Cell surface hyaluronidase | Q9UHN6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cerebellin-2 | Q8IUK8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Chloride intracellular channel protein 5 | Q9NZA1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Chordin-like protein 2 | Q6WN34 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Chromatin assembly factor 1 subunit B | Q13112 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Chronic myelogenous leukemia-associated protein | O94819 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Class A basic helix-loop-helix protein 26 | P61296 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Claudin-2 | P57739 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Claudin-20 | P56880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Claudin-9 | O95484 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Coagulation factor V | P12259 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Coatomer subunit alpha | P53621 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Coatomer subunit beta' | P35606 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Coiled-coil alpha-helical rod protein 1 | Q8TD31 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Collagen alpha-1(III) chain | P02461 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Collectin-11 | Q9BWP8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Collectin-12 | Q5KU26 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Complex I intermediate-associated protein 30 | Q9Y375 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Contactin-1 | Q12860 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Creatine kinase M-type | P06732 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Crk-like protein | P46109 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Crooked neck-like protein 1 | Q9BZJ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| CSC1-like protein 2 | Q5T3F8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| CTD small phosphatase-like protein | O15194 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| CTD small phosphatase-like protein 2 | Q05D32 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| CUGBP Elav-like family member 4 | Q9BZC1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| CXXC-type zinc finger protein 5 | Q7LFL8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cyclic AMP-responsive element-binding protein 1 | P16220 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cyclin-dependent kinase 2 | P24941 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cyclin-dependent kinase inhibitor 1C | P49918 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cysteine-rich protein 3 | Q6Q6R5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cytochrome c oxidase assembly factor 8 | Q96IL0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Cytoskeleton-associated protein 4 | Q07065 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Cytosolic 5'-nucleotidase 1A | Q9BXI3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| DAZ-associated protein 1 | Q96EP5 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| DDB1- and CUL4-associated factor 1 | Q9Y4B6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Death-associated protein kinase 1 | P53355 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Death-inducer obliterator 1 | Q9BTC0 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Dedicator of cytokinesis protein 7 | Q96N67 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Defensin-6 | Q01524 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| DelGEF | Q9UGK8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Delphilin | A4D2P6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Delta(14)-sterol reductase LBR | Q14739 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Density-regulated protein | O43583 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Deoxyguanosine kinase | Q16854 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Developmental pluripotency-associated protein 3 | Q6W0C5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Diencephalon/mesencephalon homeobox protein 1 | Q8NFW5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Dihydropteridine reductase | P09417 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Diphthamide biosynthesis protein 1 | Q9BZG8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Disks large-associated protein 1 | O14490 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| DNA damage-inducible transcript 4 protein | Q9NX09 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| DNA-binding protein R kappa-B | Q6P4R8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| DNA-directed RNA polymerase I subunit RPA34 | O15446 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| DNA-directed RNA polymerase I subunit RPA34 | O15446 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| DnaJ homolog subfamily B member 11 | Q9UBS4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| DOT1-like protein | Q8TEK3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Dual oxidase 2 | Q9NRD8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Dystrobrevin beta | O60941 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| E-NPP 3 | O14638 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| E1A-binding protein p400 | Q96L91 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| E3 ubiquitin-protein ligase HUWE1 | Q7Z6Z7 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| E3 ubiquitin-protein ligase Mdm2 | Q00987 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| E3 ubiquitin-protein ligase UBR4 | Q5T4S7 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| E3 ubiquitin-protein ligase UHRF1 | Q96T88 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| eIF3b | P55884 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| eIF3c | Q99613 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| eIF3c | Q99613 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| eIF3i | Q13347 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| eIF3j | O75822 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Electrogenic sodium bicarbonate cotransporter 4 | Q9BY07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Elongation factor 1-alpha 1 | P68104 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Elongator complex protein 2 | Q6IA86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| EMR3 protein | Q0IJ53 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Endoplasmic reticulum P5A-ATPase | Q9HD20 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Endoplasmin | P14625 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Endothelial differentiation-related factor 1 | O60869 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Enhancer of polycomb homolog 2 | Q52LR7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Envoplakin | Q92817 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ephrin type-A receptor 1 | P21709 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ephrin type-A receptor 2 | P29317 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ephrin type-B receptor 2 | P29323 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ephrin-B3 | Q15768 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Epididymal secretory protein E3-alpha | Q14507 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Epididymal secretory protein E3-alpha | Q14507 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| EPS8-like protein 3 | Q8TE67 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ER membrane protein complex subunit 2 | Q15006 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ER membrane protein complex subunit 2 | Q15006 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ER membrane protein complex subunit 5 | Q8N4V1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ERI1 exoribonuclease 3 | O43414 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ERIC-1 | Q9Y6A5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ERIC-1 | Q9Y6A5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ethanolaminephosphotransferase 1 | Q9C0D9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Eukaryotic translation initiation factor 2A | Q9BY44 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Exosome complex component RRP41 | Q9NPD3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Exostosin-1 | Q16394 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Exportin-T | O43592 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Extended synaptotagmin-1 | Q9BSJ8 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Extracellular matrix organizing protein FRAS1 | Q86XX4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| F-BAR domain only protein 1 | O14526 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| F-box/LRR-repeat protein 14 | Q8N1E6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Factor for adipocyte differentiation 104 | Q53EP0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| FAD synthase | Q8NFF5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Far upstream element-binding protein 3 | Q96I24 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Fatty acid CoA ligase Acsl3 | O95573 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| FAU ubiquitin-like and ribosomal protein S30 | P62861 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| FAU ubiquitin-like and ribosomal protein S30 | P62861 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Felix-ina | Q7Z2K6 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Fermitin family homolog 3 | Q86UX7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Fibromodulin | Q06828 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Fibronectin | P02751 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Filamin-B | O75369 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Filamin-C | Q14315 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Forkhead box protein D2 | O60548 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Forkhead box protein D4-like 4 | Q8WXT5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Forkhead box protein N4 | Q96NZ1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Formin-binding protein 1-like | Q5T0N5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Frizzled-2 | Q14332 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| FUN14 domain-containing protein 2 | Q9BWH2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| G protein-coupled receptor kinase 4 | P32298 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| G-protein coupled receptor 52 | Q9Y2T5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| G-rich sequence factor 1 | Q12849 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| G1/S-specific cyclin-D3 | P30281 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Gamma-adducin | Q9UEY8 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Gamma-butyrobetaine dioxygenase | O75936 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Gamma-secretase subunit APH-1A | Q96BI3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Gamma-secretase subunit APH-1B | Q8WW43 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Gamma-soluble NSF attachment protein | Q99747 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Gamma-tubulin complex component 6 | Q96RT7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| GAP-associated tyrosine phosphoprotein p62 | Q07666 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| GDP-fucose transporter 1 | Q96A29 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| GDP-L-fucose synthase | Q13630 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Glucose-6-phosphate 1-dehydrogenase | P11413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Glutamate dehydrogenase 1 | P00367 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Glutamate receptor ionotropic | Q8TCU5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Glutathione S-transferase kappa 1 | Q9Y2Q3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Glutathione S-transferase LANCL1 | O43813 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Glycogen phosphorylase | P06737 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| GMP-PDE gamma | Q13956 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Golgi membrane protein 1 | Q8NBJ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| GPR31/12-HETER | O00270 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| GRB2-associated-binding protein 2 | Q9UQC2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Guanine insertion enzyme | Q9BXR0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| H/ACA ribonucleoprotein complex subunit 1 | Q9NY12 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| HAUS augmin-like complex subunit 4 | Q9H6D7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| HAUS augmin-like complex subunit 4 | Q9H6D7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| HCG15403 | Q9UI82 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Heat shock factor protein 2 | Q03933 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Hemoglobin subunit alpha | P69905 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A/B | Q99729 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| hFLVCR | Q9Y5Y0 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| HIP1-related protein | O75146 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Hippocalcin-like protein 1 | P37235 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Histone H1.0 | P07305 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Histone H2B type 1-C/E/F/G/I | P62807 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Histone RNA hairpin-binding protein | Q14493 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Histone-lysine N-methyltransferase 2D | O14686 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Histone-lysine N-methyltransferase NSD2 | O96028 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| hLAT1 3-transmembrane protein IMAA | Q9GIP4 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| HNRPA3 protein | Q66K53 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Homeobox protein Hox-D11 | P31277 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Homeobox protein Nkx-6.2 | Q9C056 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Hypoxia up-regulated protein 1 | Q9JKR6 | Mus musculus | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ICBP90-binding protein 1 | Q6BDS2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| IgG Fc receptor II-a | P12318 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Immunoglobulin superfamily member 10 | Q6WRI0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Immunoglobulin superfamily member 6 | O95976 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Inactive rhomboid protein 1 | Q96CC6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Inositol 1,4,5-trisphosphate receptor type 2 | Q14571 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Integral membrane protein GPR180 | Q86V85 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Integrin beta-8 | P26012 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Interferon-stimulated gene 12b protein | Q9H2X8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Interleukin-1 receptor accessory protein-like 1 | Q9NZN1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Interleukin-10 receptor subunit beta | Q08334 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Interleukin-34 | A0A024QZ87 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Interphotoreceptor matrix proteoglycan 1 | Q17R60 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Intracellular hyaluronan-binding protein 4 | Q5JVS0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Iron-sulfur cluster assembly enzyme ISCU | Q9H1K1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Isoleucine--tRNA ligase | Q9NSE4 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Kallikrein-10 | O43240 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Keratin | P35908 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Keratin | P35527 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Keratin | P05787 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Keratin | P04264 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Keratin-10 | P13645 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Keratin-associated protein 4-7 | Q9BYR0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Keratin-associated protein 5-11 | Q6L8G4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| KIAA1012 protein | Q6PCC9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Kinetochore protein Spc24 | Q8NBT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Krueppel-like factor 17 | Q5JT82 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| L-fucose kinase | Q8N0W3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| L-lactate dehydrogenase A-like 6A | Q6ZMR3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| L-type amino acid transporter 3 | O75387 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Lamin-B1 | P20700 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| LanC-like protein 2 | Q9NS86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Late cornified envelope protein 1B | Q5T7P3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Leucine-rich repeat and fibronectin type-III domain-containing protein 4 | Q6PJG9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Leucine-rich repeat neuronal protein 6D | Q6UY18 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Leucine-rich repeat protein 1 | Q96L50 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Leucine-rich repeat transmembrane neuronal protein 4 | Q86VH4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Leucine-rich repeat-containing protein 2 | Q9BYS8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Leukotriene C4 synthase | Q16873 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| LIG-3 | Q6UXM1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| LIM domain-containing protein 1 | Q9UGP4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Limbic system-associated membrane protein | Q13449 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| LIR-2 | Q8N423 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Long-chain fatty acid transport protein 4 | Q6P1M0 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Long-chain fatty acid transport protein 4 | Q6P1M0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Long-chain-fatty-acid--CoA ligase 4 | O60488 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Long-chain-fatty-acid--CoA ligase 4 | O60488 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Lymphocyte antigen 86 | O95711 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Lysine-specific demethylase 3B | Q7LBC6 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Lysine-specific demethylase 5D | Q9BY66 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Lysophosphatidylserine lipase ABHD12 | Q8N2K0 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Lysophospholipid acyltransferase 7 | Q96N66 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Lysosomal acid phosphatase | P11117 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Lysyl hydroxylase 1 | Q02809 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Macaca fascicularis brain cDNA clone: QmoA-10587 | I7GJ18 | Macaca fascicularis | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Mannan-binding lectin serine protease 1 | P48740 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Mannosyl-oligosaccharide glucosidase | Q13724 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| MAP kinase kinase 1 | Q02750 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| MAP kinase kinase 6 | P52564 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| MAPK/ERK kinase kinase 3 | Q99759 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Melanoma inhibitory activity protein 2 | Q96PC5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Melatonin-related receptor | Q13585 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Metallothionein-1E | P04732 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| MHC class II antigen DQB1 | P01920 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Microsomal triglyceride transfer protein large subunit | P55157 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Microtubule-associated protein 2 | P11137 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Minor histocompatibility antigen H13 | Q8TCT9 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Mitochondrial basic amino acids transporter | Q8N8R3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Mitogen-activated protein kinase 6 | Q16659 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Mitogen-activated protein kinase 9 | P45984 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Mitotic arrest deficient 2-like protein 2 | Q9UI95 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Mitotic checkpoint protein BUB3 | O43684 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Mixed lineage kinase 4 | Q5TCX8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Monocarboxylate transporter 1 | P53985 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Monocarboxylate transporter 2 | O60669 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Monocarboxylate transporter 4 | O15427 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Mpv17-like protein 2 | Q567V2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Muscarinic acetylcholine receptor M3 | P20309 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Myb-binding protein 1A | Q9BQG0 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Myelin proteolipid protein | P60201 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Myelin proteolipid protein | P60201 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Myotubularin-related protein 5 | O95248 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| N-acetylgalactosamine kinase | Q01415 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| NAD(P) transhydrogenase | Q13423 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| NAD(P)H dehydrogenase [quinone] 1 | P15559 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| NADP-dependent malic enzyme | P48163 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| NEDD8-conjugating enzyme Ubc12 | P61081 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Neuromedin-U receptor 1 | Q9HB89 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Neuronal membrane glycoprotein M6-a | P51674 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Neuronal pentraxin receptor | O95502 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Neuropilin-1 | O14786 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Neuropilin-2 | O60462 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Neutral alpha-glucosidase AB | Q14697 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Neutral cholesterol ester hydrolase 1 | Q6PIU2 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| NF-kappa-B-activating protein 1 | Q8N5C8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| NF-X1-type zinc finger protein NFXL1 | Q6ZNB6 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nuclear mitotic apparatus protein 1 | Q14980 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nuclear pore complex protein Nup214 | P35658 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nuclear pore membrane glycoprotein 210 | Q8TEM1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Nuclear-localized factor 3 | Q8TF44 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Nucleolar protein 56 | O00567 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Nucleolar protein 7 | Q9UMY1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleolysin TIAR | Q01085 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleoporin NDC1 | Q9BTX1 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Nucleosome-remodeling factor subunit BPTF | Q12830 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| OCIA domain-containing protein 2 | Q56VL3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 10A5 | Q9H207 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 10A6 | Q8NH74 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 10AD1 | Q8NGE0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 10G4 | Q8NGN3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 10Z1 | Q8NGY1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 1S2 | Q8NGQ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 4K14 | Q8NGD5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 51V1 | Q9H2C8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 52B2 | Q96RD2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 52E8 | Q6IFG1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Olfactory receptor 6C4 | Q8NGE1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Oligodendrocyte transcription factor 2 | Q13516 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Oligosaccharyl transferase subunit DAD1 | P61803 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Oligosaccharyl transferase subunit STT3B | Q8TCJ2 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| OR5AR1 | A0A126GVM6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| ORM1-like protein 2 | Q53FV1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ornithine decarboxylase | P11926 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Osteoclast-associated receptor | Q8IYS5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Otoferlin | Q9HC10 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ovostatin homolog 2 | Q6IE36 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Oxysterol-binding protein-related protein 10 | Q9BXB5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Oxysterol-binding protein-related protein 8 | Q9BZF1 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| P2X purinoceptor 2 | Q9UBL9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| P2Y purinoceptor 1 | P47900 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| P2Y purinoceptor 11 | Q96G91 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Paired amphipathic helix protein Sin3a | Q96ST3 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| PAPS transporter 1 | Q8TB61 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| PAX3- and PAX7-binding protein 1 | Q9Y5B6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| PDGFR-like protein | Q15198 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| PDHE1-A type I | P08559 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Peptidoglycan recognition protein 1 | O75594 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Perforin-1 | P14222 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Pericentriolar material 1 protein | Q15154 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Perilipin-2 | Q99541 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Perlecan (PLC) | P98160 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Peroxisomal membrane protein PEX16 | Q9Y5Y5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| PHD finger protein 3 | Q92576 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| PHD finger-like domain-containing protein 5A | Q7RTV0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Phosphate carrier protein | Q00325 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Phosphatidylserine synthase 2 | Q9BVG9 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Phosphofurin acidic cluster sorting protein 1 | Q6VY07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Phospholipase A2 | P04054 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Phospholipase D1 | Q13393 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Phospholipid-transporting ATPase ABCA7 | Q8IZY2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Phosphorylase b kinase regulatory subunit alpha | P46019 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Pinin | Q9H307 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Plakophilin-4 | Q99569 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Podocalyxin | O00592 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Poliovirus receptor | P15151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Polycomb protein SUZ12 | Q15022 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Polymerase delta-interacting protein 2 | Q9Y2S7 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Polymerase delta-interacting protein 2 | Q9Y2S7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Polypeptide GalNAc transferase 12 | Q8IXK2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Polypyrimidine tract-binding protein 2 | Q9UKA9 | Homo sapiens | Pro Info | . | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Cervix | . | . | . |
| POU domain | P78424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| PP2A subunit A isoform PR65-beta | P30154 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| PR domain zinc finger protein 15 | P57071 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Pre-mRNA-processing factor 40 homolog B | Q6NWY9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Pre-mRNA-splicing factor 18 | Q99633 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| PRKCA-binding protein | Q9NRD5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| PRKR-like endoplasmic reticulum kinase | Q9NIV1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Probable ATP-dependent RNA helicase DDX23 | Q9BUQ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Probable helicase senataxin | Q7Z333 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Probable UDP-sugar transporter protein SLC35A4 | Q96G79 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Procollagen galactosyltransferase 1 | Q8NBJ5 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Prolactin regulatory element-binding protein | Q9HCU5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Prolactin-releasing peptide receptor | P49683 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Proline-rich AKT1 substrate 1 | Q96B36 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Prolyl 3-hydroxylase 1 | Q32P28 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Prominin-1 | O43490 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Prostate cancer antigen 1 | Q96Q83 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Prostate tumor-overexpressed gene 1 protein homolog | Q91VU8 | Mus musculus | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Proteasome subunit alpha type-5 | P28066 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Proteasome subunit beta type-6 | P28072 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein AAR2 homolog | Q9Y312 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein AHNAK2 | Q8IVF2 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein C18orf25 | Q96B23 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein disulfide-isomerase | P07237 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein disulfide-isomerase A3 | P30101 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein DPCD | Q9BVM2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein FAM3D | Q96BQ1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein FOAP-11 | Q9C002 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein HEXIM1 | O94992 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein jagunal homolog 1 | Q8N5M9 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein kinase C delta type | Q05655 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein kinase C iota type | P41743 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein lin-28 homolog B | Q6ZN17 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein NDRG1 | Q92597 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein PARX | Q8WZ64 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein PBDC1 | Q9BVG4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein phosphatase 2C | Q9P0J1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein RCC2 | Q9P258 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein RCC2 | Q9P258 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein Tob1 | P50616 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein Tob2 | Q14106 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein TRAM1 | Q15629 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein transport protein Sec16A | O15027 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protein transport protein Sec24B | O95487 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein transport protein Sec24B | O95487 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein transport protein Sec61 subunit gamma | P60059 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein tweety homolog 2 | Q9BSA4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein Wiz | O95785 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein-tyrosine phosphatase delta | P23468 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protein-tyrosine sulfotransferase 2 | O60704 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Prothymosin alpha | P06454 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Proto-oncogene tyrosine-protein kinase Src | P12931 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Protocadherin beta-3 | Q9Y5E6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Protocadherin-8 | O95206 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Proton channel OTOP2 | Q7RTS6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Proton-coupled zinc antiporter SLC30A1 | Q9Y6M5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Proton-coupled zinc antiporter SLC30A5 | Q8TAD4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Pseudouridylate synthase 1 homolog | Q9Y606 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Putative P2Y purinoceptor 10 | O00398 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Pyridoxine-5'-phosphate oxidase | Q9NVS9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Pyruvate carboxylase | P11498 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Rab11 family-interacting protein 1 | Q6WKZ4 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| RAC-beta serine/threonine-protein kinase | P31751 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Radial spoke head 1 homolog | Q8WYR4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ras and Rab interactor 2 | Q8WYP3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ras GTPase-activating protein-binding protein 2 | Q9UN86 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ras-GEF domain-containing family member 1B | Q0VAM2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ras-GEF domain-containing family member 1C | Q8N431 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ras-related protein Rab-1A | P62820 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| RBM16 protein | Q05BU5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RecQ protein-like 2 | Q14191 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RecQ-mediated genome instability protein 1 | Q9H9A7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Relaxin receptor 2 | Q8WXD0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Replication factor C subunit 2 | P35250 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Retinoic acid receptor responder protein 1 | P49788 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Retinol dehydrogenase 8 | Q9NYR8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Retinol-binding protein 2 | P50120 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Retinol-binding protein 4 | P02753 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RIB43A-like with coiled-coils protein 2 | Q9H4K1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RIBIIR | P04844 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ribose-phosphate pyrophosphokinase 1 | P60891 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ribosomal L1 domain-containing protein 1 | O76021 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ribosome production factor 2 homolog | Q9H7B2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ribosome-binding protein 1 | Q9P2E9 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| RNA cytosine C(5)-methyltransferase NSUN2 | Q08J23 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RNA helicase aquarius | O60306 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RNA polymerases I | P53803 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RNA-binding E3 ubiquitin-protein ligase MEX3C | Q5U5Q3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| rRNA 2'-O-methyltransferase fibrillarin | P22087 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| RuvB-like 1 | Q9Y265 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RuvB-like 2 | Q9Y230 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| RWD domain-containing protein 1 | Q9H446 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| S-adenosylmethionine decarboxylase proenzyme | P17707 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| S-phase kinase-associated protein 1 | P63208 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SamCystin | Q68DC2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| SCGB2A2 protein | Q6NX70 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SCOT | P55809 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Sec61 alpha-1 | P61619 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Sec61 alpha-1 | P61619 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Secreted frizzled-related protein 5 | Q5T4F7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Semaphorin-5A | Q13591 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SERCA2 | P16615 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serine protease inhibitor Kazal-type 6 | Q6UWN8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serine/arginine-rich splicing factor 3 | P84103 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serine/threonine-protein kinase MRCK alpha | Q5VT25 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Serine/threonine-protein kinase TAO3 | Q9H2K8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Serotransferrin | P02787 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Serum paraoxonase/arylesterase 1 | P27169 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SH2 domain-containing protein 4B | Q5SQS7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Short transient receptor potential channel 6 | Q9Y210 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SHP2-interacting transmembrane adapter protein | Q9Y3P8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Signal peptidase complex subunit 2 | Q15005 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Signal recognition particle subunit SRP54 | P61011 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Signal recognition particle subunit SRP54 | P61011 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SLCO2A1 | Q92959 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Slit homolog 3 protein | O75094 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Small nuclear ribonucleoprotein E | Q6GPZ6 | Xenopus laevis | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Sodium/calcium exchanger 3 | P57103 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Sodium/potassium-dependent ATPase subunit beta-1 | P05026 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Solute carrier family 41 member 2 | Q96JW4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Sperm flagellar protein 1 | Q9Y4P9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Splicing factor 3A subunit 3 | Q12874 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Splicing factor 3B subunit 4 | Q15427 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Splicing factor 3B subunit 5 | Q9BWJ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Splicing factor ESS-2 homolog | Q96DF8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SR-beta | Q9Y5M8 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| SRSF protein kinase 2 | P78362 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| StAR-related lipid transfer protein 5 | Q9NSY2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Steroid 17-alpha-hydroxylase/17,20 lyase | P05093 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Sterol regulatory element-binding protein 2 | Q12772 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Stress-70 protein | P38646 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Sulfhydryl oxidase 1 | O00391 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Sulfotransferase 1C3 | Q6IMI6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SUMO-activating enzyme subunit 1 | Q9UBE0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SUMO-specific isopeptidase USPL1 | Q5W0Q7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SUN domain-containing ossification factor | Q9UBS9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Suppressor APC domain-containing protein 2 | Q86UD0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Surfeit locus protein 4 | O15260 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| SURP and G-patch domain-containing protein 1 | Q8IWZ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Synapsin-1 | P17600 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Synaptic adhesion-like molecule 1 | Q9ULH4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| T-box transcription factor TBX10 | O75333 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| T-box transcription factor TBX18 | O95935 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| T-complex protein 1 subunit epsilon | P48643 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| T-complex protein 1 subunit theta | Q94K05 | Arabidopsis thaliana | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Taste receptor type 2 member 1 | Q9NYW7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| TBC1 domain family member 10A | Q9BXI6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| TBC1 domain family member 30 | Q9Y2I9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| TBC1 domain family member 9 | Q6ZT07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Teashirt homolog 2 | Q9NRE2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Testicular haploid expressed gene protein | Q9P2T0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Testis cDNA | Q4R777 | Macaca fascicularis | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Testis-expressed protein 13B | Q9BXU2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Testis-expressed protein 4 | Q9Y584 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Testis-expressed protein 9 | Q8N6V9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Testisin | Q9Y6M0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Tetratricopeptide repeat protein 39A | Q5SRH9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Thioredoxin reductase 2 | Q9NNW7 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Thrombospondin-1 | P07996 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Thymocyte nuclear protein 1 | Q9P016 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| TIR domain-containing adapter molecule 1 | Q8IUC6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| TNFAIP3-interacting protein 1 | Q15025 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| TNFR1-associated DEATH domain protein | Q15628 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Toll-like receptor 3 | O15455 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| TP-beta | P55084 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| TP53-binding protein 1 | Q12888 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Trafficking protein particle complex subunit 1 | Q9Y5R8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Trafficking protein particle complex subunit 1 | Q9Y5R8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transcription factor 15 | Q12870 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transcription factor HES-2 | Q9Y543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transcription factor IIIB 150 | A6H8Y1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transcription factor SPT20 homolog | Q8NEM7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transcriptional adapter 1 | Q96BN2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Translation machinery-associated protein 7 | Q9Y2S6 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Translocon-associated protein subunit gamma | Q9UNL2 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Transmembrane 7 superfamily member 3 | Q9NS93 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transmembrane emp24 domain-containing protein 2 | Q15363 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transmembrane glycoprotein NMB | Q14956 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transmembrane protein 180 | Q14CX5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transmembrane protein 258 | P61165 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transmembrane protein 268 | Q5VZI3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transmembrane protein 87B | Q96K49 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Transmembrane protein 94 | Q12767 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| tRNA-uridine aminocarboxypropyltransferase 1 | Q8N5C7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Tudor domain-containing protein 3 | Q9H7E2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Tudor domain-containing protein 3 | Q9H7E2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Tumor susceptibility gene 101 protein | Q99816 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Tyrosinase | P14679 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| U4/U6.U5 tri-snRNP-associated protein 2 | Q53GS9 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 45 | Q70EL2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| UBX domain-containing protein 4 | Q92575 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| UDP-glucuronosyltransferase 2B11 | O75310 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Uncharacterized protein C14orf132 | Q9NPU4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Uncharacterized protein MGC21675 | Q4W5N5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Uncharacterized protein MGC4677 | Q53S70 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Unconventional myosin-Ib | O43795 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| V-ATPase 16 kDa proteolipid subunit c | P27449 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| V-ATPase 16 kDa proteolipid subunit c | P27449 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| V-ATPase 21 kDa proteolipid subunit c'' | Q99437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| V-type proton ATPase subunit d 1 | P61421 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| V-type proton ATPase subunit d 1 | P61421 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| V-type proton ATPase subunit F | Q16864 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Vacuolar protein sorting-associated protein 26A | O75436 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Vacuole membrane protein 1 | Q96GC9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Vasopressin V1a receptor | P37288 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Very-long-chain enoyl-CoA reductase | Q9NZ01 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Villin-1 | P09327 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Voltage-dependent calcium channel beta subunit-associated regulatory protein | Q8N350 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Voltage-gated potassium channel subunit Kv4.2 | Q9NZV8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| WAP four-disulfide core domain protein 6 | Q9BQY6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| WAS/WASL-interacting protein family member 1 | O43516 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| WD repeat-containing protein 7 | Q9Y4E6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| WD repeat-containing protein 87 | Q6ZQQ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| WD repeat-containing protein 90 | Q96KV7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| WD repeat-containing protein 90 | Q96KV7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Wolframin | O76024 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Wolframin | O76024 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| X antigen family member 3 | Q8WTP9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Zinc finger CCCH domain-containing protein 11A | O75152 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Zinc finger MYM-type protein 2 | Q9UBW7 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Zinc finger protein 239 | Q16600 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger protein 277 | Q9NRM2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger protein 311 | Q5JNZ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger protein 341 | Q9BYN7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger protein 534 | Q76KX8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger protein 555 | Q8NEP9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger protein 582 | Q96NG8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger protein 585B | Q52M93 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger protein 664 | Q8N3J9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger protein 9 | P62633 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Zinc finger protein SNAI3 | Q3KNW1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger protein ZIC 2 | O95409 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | UV cross-linking followed by antisense-mediated affinity purification and mass spectrometry | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | 30 h | . | . |
| Zinc finger TRAF-type-containing protein 1 | P0DTL6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
| Zinc finger TRAF-type-containing protein 1 | P0DTL6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | HuH-7 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | . | . |
Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| GO Term | GO Category | GO ID | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|---|
| RNA Binding | Molecular Function |
GO:0003723
|
2.21E-48 | 4.656130067 | 540.8500854 |
| mRNA Binding | Molecular Function |
GO:0003729
|
4.07E-14 | 5.15095975 | 188.3542268 |
| Cadherin Binding | Molecular Function |
GO:0045296
|
2.43E-10 | 4.087186167 | 112.2642259 |
| mRNA 3'-UTR Binding | Molecular Function |
GO:0003730
|
4.83E-05 | 5.458672834 | 81.76975923 |
| mRNA 5'-UTR Binding | Molecular Function |
GO:0048027
|
0.000193209 | 13.03387534 | 174.2681878 |
| rRNA Binding | Molecular Function |
GO:0019843
|
0.000610564 | 7.25317029 | 87.3098474 |
| pre-mRNA Binding | Molecular Function |
GO:0036002
|
0.000900398 | 9.476225671 | 108.9279683 |
| Single-Stranded RNA Binding | Molecular Function |
GO:0003727
|
0.001792924 | 6.903184612 | 73.42359705 |
| Poly-Pyrimidine Tract Binding | Molecular Function |
GO:0008187
|
0.001792924 | 10.12268832 | 106.8428302 |
| Ubiquitin Ligase Inhibitor Activity | Molecular Function |
GO:1990948
|
0.003801825 | 34.59299191 | 335.4757183 |
| Ribosome Binding | Molecular Function |
GO:0043022
|
0.004045186 | 4.295696316 | 40.98282306 |
| Adenyl Ribonucleotide Binding | Molecular Function |
GO:0032559
|
0.00527058 | 2.420720455 | 22.22881016 |
| 5S rRNA Binding | Molecular Function |
GO:0008097
|
0.00527058 | 25.94339623 | 234.3898383 |
| Ubiquitin-Protein Transferase Inhibitor Activity | Molecular Function |
GO:0055105
|
0.00527058 | 25.94339623 | 234.3898383 |
| ATP Binding | Molecular Function |
GO:0005524
|
0.005527952 | 2.476649829 | 22.08674573 |
| NADP Binding | Molecular Function |
GO:0050661
|
0.010195348 | 6.50405954 | 53.60216796 |
| NAD Binding | Molecular Function |
GO:0051287
|
0.011668018 | 7.797567568 | 62.73763515 |
| 3-hydroxyacyl-CoA Dehydrogenase Activity | Molecular Function |
GO:0003857
|
0.015916325 | 38.86675639 | 296.3231149 |
| Oligosaccharyl Transferase Activity | Molecular Function |
GO:0004576
|
0.015916325 | 38.86675639 | 296.3231149 |
| snRNA Binding | Molecular Function |
GO:0017069
|
0.030182468 | 5.056608029 | 35.05679112 |
| Cytosolic Large Ribosomal Subunit | Cellular Component |
GO:0022625
|
5.15E-26 | 33.81838579 | 2138.077975 |
| Large Ribosomal Subunit | Cellular Component |
GO:0015934
|
5.15E-26 | 33.81838579 | 2138.077975 |
| Ribosome | Cellular Component |
GO:0005840
|
3.21E-18 | 18.51017106 | 830.5027949 |
| Cytosolic Small Ribosomal Subunit | Cellular Component |
GO:0022627
|
4.85E-15 | 22.84656746 | 851.2656939 |
| Small Ribosomal Subunit | Cellular Component |
GO:0015935
|
6.84E-15 | 21.85210215 | 801.8204784 |
| Cell-Substrate Junction | Cellular Component |
GO:0030055
|
2.61E-14 | 4.229158755 | 148.7402156 |
| Focal Adhesion | Cellular Component |
GO:0005925
|
4.03E-14 | 4.231528238 | 146.3460868 |
| Polysomal Ribosome | Cellular Component |
GO:0042788
|
2.88E-13 | 30.37093549 | 986.5511965 |
| Nuclear Lumen | Cellular Component |
GO:0031981
|
5.72E-09 | 2.565952736 | 57.65424094 |
| Nucleolus | Cellular Component |
GO:0005730
|
7.78E-09 | 2.553679599 | 56.18780259 |
| Intracellular Non-Membrane-Bounded Organelle | Cellular Component |
GO:0043232
|
7.78E-09 | 2.222789214 | 48.81461858 |
| Endoplasmic Reticulum Membrane | Cellular Component |
GO:0005789
|
1.97E-07 | 2.357755345 | 43.94369813 |
| Small-Subunit Processome | Cellular Component |
GO:0032040
|
1.97E-07 | 7.381687094 | 137.0374054 |
| Asymmetric Synapse | Cellular Component |
GO:0032279
|
0.000188747 | 3.847334563 | 44.51645506 |
| Nucleus | Cellular Component |
GO:0005634
|
0.000188747 | 1.439474418 | 16.63173053 |
| Postsynaptic Density | Cellular Component |
GO:0014069
|
0.000255681 | 3.554676526 | 39.76249004 |
| Intracellular Organelle Lumen | Cellular Component |
GO:0070013
|
0.000576818 | 1.872144928 | 19.30508268 |
| Intracellular Membrane-Bounded Organelle | Cellular Component |
GO:0043231
|
0.000616089 | 1.38506303 | 14.11202347 |
| Spliceosomal snRNP Complex | Cellular Component |
GO:0097525
|
0.000672255 | 5.55243987 | 55.78763662 |
| Microvillus | Cellular Component |
GO:0005902
|
0.004064085 | 4.786226567 | 39.23178866 |
| Cytoplasmic Translation | Biological Process |
GO:0002181
|
9.24E-42 | 30.69290466 | 3143.147826 |
| Macromolecule Biosynthetic Process | Biological Process |
GO:0009059
|
1.28E-32 | 12.22311994 | 985.9517839 |
| Peptide Biosynthetic Process | Biological Process |
GO:0043043
|
4.26E-32 | 13.53509869 | 1070.039653 |
| Translation | Biological Process |
GO:0006412
|
1.37E-30 | 9.590831406 | 722.1856659 |
| Gene Expression | Biological Process |
GO:0010467
|
5.78E-30 | 8.028030691 | 591.1384661 |
| protein-RNA Complex Assembly | Biological Process |
GO:0022618
|
7.26E-10 | 6.11553039 | 166.1703674 |
| Ribonucleoprotein Complex Biogenesis | Biological Process |
GO:0022613
|
2.45E-08 | 6.415622043 | 150.7533543 |
| mRNA Splicing, Via Spliceosome | Biological Process |
GO:0000398
|
1.07E-07 | 4.415182567 | 96.66833563 |
| mRNA Processing | Biological Process |
GO:0006397
|
1.22E-07 | 4.342512752 | 93.55971621 |
| Positive Regulation Of Translation | Biological Process |
GO:0045727
|
1.22E-07 | 6.381403092 | 137.432337 |
| Regulation Of Translation | Biological Process |
GO:0006417
|
1.22E-07 | 4.461016922 | 95.67174244 |
| Ribosome Biogenesis | Biological Process |
GO:0042254
|
1.48E-07 | 5.100821509 | 107.9521463 |
| RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile | Biological Process |
GO:0000377
|
7.12E-07 | 4.478715729 | 87.38711946 |
| RNA Processing | Biological Process |
GO:0006396
|
1.76E-05 | 3.992055611 | 64.79532264 |
| rRNA Processing | Biological Process |
GO:0006364
|
3.42E-05 | 5.321869489 | 82.46938337 |
| Regulation Of RNA Splicing | Biological Process |
GO:0043484
|
3.71E-05 | 5.258984911 | 80.71916427 |
| rRNA Metabolic Process | Biological Process |
GO:0016072
|
3.71E-05 | 5.604821918 | 85.69877206 |
| Positive Regulation Of Cytoplasmic Translation | Biological Process |
GO:2000767
|
3.86E-05 | 26.04465494 | 394.2515894 |
| Positive Regulation Of Telomerase RNA Localization To Cajal Body | Biological Process |
GO:1904874
|
3.86E-05 | 26.04465494 | 394.2515894 |
| Spliceosomal Complex Assembly | Biological Process |
GO:0000245
|
5.15E-05 | 6.951165186 | 102.8676565 |
Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| Ribosome | KEGG Pathway | 1.83E-31 | 13.13113696 | 1004.002054 |
| Coronavirus disease | KEGG Pathway | 8.12E-25 | 8.149935105 | 492.7479134 |
| Protein processing in endoplasmic reticulum | KEGG Pathway | 5.12E-07 | 4.538027473 | 86.53974403 |
| Spliceosome | KEGG Pathway | 5.90E-05 | 4.052553507 | 56.88003752 |
| Protein export | KEGG Pathway | 0.009089588 | 9.175039746 | 80.50884151 |
| Spinocerebellar ataxia | KEGG Pathway | 0.04583564 | 2.835493709 | 19.77618951 |
| Human papillomavirus infection | KEGG Pathway | 0.060536666 | 2.051521741 | 13.26534416 |
| RNA transport | KEGG Pathway | 0.060536666 | 2.460467365 | 15.72710299 |
| Thyroid hormone synthesis | KEGG Pathway | 0.060536666 | 3.550265203 | 22.33422575 |
| Vibrio cholerae infection | KEGG Pathway | 0.067211176 | 4.231897284 | 25.50427978 |
| Riboflavin metabolism | KEGG Pathway | 0.067211176 | 15.54427995 | 93.04184562 |
| Biosynthesis of unsaturated fatty acids | KEGG Pathway | 0.067763408 | 5.898662741 | 34.45609705 |
| Pathogenic Escherichia coli infection | KEGG Pathway | 0.067763408 | 2.309604178 | 13.41963945 |
| Peroxisome | KEGG Pathway | 0.072145534 | 3.208657832 | 18.20461648 |
| Central carbon metabolism in cancer | KEGG Pathway | 0.086859947 | 3.355538072 | 18.18361997 |
| Glucagon signaling pathway | KEGG Pathway | 0.10776307 | 2.683353877 | 13.4443909 |
| Mineral absorption | KEGG Pathway | 0.10776307 | 3.43163888 | 17.1379042 |
| Proteasome | KEGG Pathway | 0.10776307 | 3.89472973 | 19.36086211 |
| Apoptosis | KEGG Pathway | 0.10776307 | 2.405030392 | 11.94569226 |
| GnRH signaling pathway | KEGG Pathway | 0.115658906 | 2.786877302 | 13.50230175 |
Virus RNA Sequence Information
|
>U87411.1 Dengue virus type 2 (strain 16681) polyprotein mRNA, complete cds
AGTTGTTAGTCTACGTGGACCGACAAAGACAGATTCTTTGAGGGAGCTAAGCTCAACGTAGTTCTAACAG
TTTTTTAATTAGAGAGCAGATCTCTGATGAATAACCAACGGAAAAAGGCGAAAAACACGCCTTTCAATAT
GCTGAAACGCGAGAGAAACCGCGTGTCGACTGTGCAACAGCTGACAAAGAGATTCTCACTTGGAATGCTG
CAGGGACGAGGACCATTAAAACTGTTCATGGCCCTGGTGGCGTTCCTTCGTTTCCTAACAATCCCACCAA
CAGCAGGGATATTGAAGAGATGGGGAACAATTAAAAAATCAAAAGCTATTAATGTTTTGAGAGGGTTCAG
GAAAGAGATTGGAAGGATGCTGAACATCTTGAATAGGAGACGCAGATCTGCAGGCATGATCATTATGCTG
ATTCCAACAGTGATGGCGTTCCATTTAACCACACGTAACGGAGAACCACACATGATCGTCAGCAGACAAG
AGAAAGGGAAAAGTCTTCTGTTTAAAACAGAGGATGGCGTGAACATGTGTACCCTCATGGCCATGGACCT
TGGTGAATTGTGTGAAGACACAATCACGTACAAGTGTCCCCTTCTCAGGCAGAATGAGCCAGAAGACATA
GACTGTTGGTGCAACTCTACGTCCACGTGGGTAACTTATGGGACGTGTACCACCATGGGAGAACATAGAA
GAGAAAAAAGATCAGTGGCACTCGTTCCACATGTGGGAATGGGACTGGAGACACGAACTGAAACATGGAT
GTCATCAGAAGGGGCCTGGAAACATGTCCAGAGAATTGAAACTTGGATCTTGAGACATCCAGGCTTCACC
ATGATGGCAGCAATCCTGGCATACACCATAGGAACGACACATTTCCAAAGAGCCCTGATTTTCATCTTAC
TGACAGCTGTCACTCCTTCAATGACAATGCGTTGCATAGGAATGTCAAATAGAGACTTTGTGGAAGGGGT
TTCAGGAGGAAGCTGGGTTGACATAGTCTTAGAACATGGAAGCTGTGTGACGACGATGGCAAAAAACAAA
CCAACATTGGATTTTGAACTGATAAAAACAGAAGCCAAACAGCCTGCCACCCTAAGGAAGTACTGTATAG
AGGCAAAGCTAACCAACACAACAACAGAATCTCGCTGCCCAACACAAGGGGAACCCAGCCTAAATGAAGA
GCAGGACAAAAGGTTCGTCTGCAAACACTCCATGGTAGACAGAGGATGGGGAAATGGATGTGGACTATTT
GGAAAGGGAGGCATTGTGACCTGTGCTATGTTCAGATGCAAAAAGAACATGGAAGGAAAAGTTGTGCAAC
CAGAAAACTTGGAATACACCATTGTGATAACACCTCACTCAGGGGAAGAGCATGCAGTCGGAAATGACAC
AGGAAAACATGGCAAGGAAATCAAAATAACACCACAGAGTTCCATCACAGAAGCAGAATTGACAGGTTAT
GGCACTGTCACAATGGAGTGCTCTCCAAGAACGGGCCTCGACTTCAATGAGATGGTGTTGCTGCAGATGG
AAAATAAAGCTTGGCTGGTGCACAGGCAATGGTTCCTAGACCTGCCGTTACCATGGTTGCCCGGAGCGGA
CACACAAGGGTCAAATTGGATACAGAAAGAGACATTGGTCACTTTCAAAAATCCCCATGCGAAGAAACAG
GATGTTGTTGTTTTAGGATCCCAAGAAGGGGCCATGCACACAGCACTTACAGGGGCCACAGAAATCCAAA
TGTCATCAGGAAACTTACTCTTCACAGGACATCTCAAGTGCAGGCTGAGAATGGACAAGCTACAGCTCAA
AGGAATGTCATACTCTATGTGCACAGGAAAGTTTAAAGTTGTGAAGGAAATAGCAGAAACACAACATGGA
ACAATAGTTATCAGAGTGCAATATGAAGGGGACGGCTCTCCATGCAAGATCCCTTTTGAGATAATGGATT
TGGAAAAAAGACATGTCTTAGGTCGCCTGATTACAGTCAACCCAATTGTGACAGAAAAAGATAGCCCAGT
CAACATAGAAGCAGAACCTCCATTCGGAGACAGCTACATCATCATAGGAGTAGAGCCGGGACAACTGAAG
CTCAACTGGTTTAAGAAAGGAAGTTCTATCGGCCAAATGTTTGAGACAACAATGAGGGGGGCGAAGAGAA
TGGCCATTTTAGGTGACACAGCCTGGGATTTTGGATCCTTGGGAGGAGTGTTTACATCTATAGGAAAGGC
TCTCCACCAAGTCTTTGGAGCAATCTATGGAGCTGCCTTCAGTGGGGTTTCATGGACTATGAAAATCCTC
ATAGGAGTCATTATCACATGGATAGGAATGAATTCACGCAGCACCTCACTGTCTGTGACACTAGTATTGG
TGGGAATTGTGACACTGTATTTGGGAGTCATGGTGCAGGCCGATAGTGGTTGCGTTGTGAGCTGGAAAAA
CAAAGAACTGAAATGTGGCAGTGGGATTTTCATCACAGACAACGTGCACACATGGACAGAACAATACAAG
TTCCAACCAGAATCCCCTTCAAAACTAGCTTCAGCTATCCAGAAAGCCCATGAAGAGGGCATTTGTGGAA
TCCGCTCAGTAACAAGACTGGAGAATCTGATGTGGAAACAAATAACACCAGAATTGAATCACATTCTATC
AGAAAATGAGGTGAAGTTAACTATTATGACAGGAGACATCAAAGGAATCATGCAGGCAGGAAAACGATCT
CTGCGGCCTCAGCCCACTGAGCTGAAGTATTCATGGAAAACATGGGGCAAAGCAAAAATGCTCTCTACAG
AGTCTCATAACCAGACCTTTCTCATTGATGGCCCCGAAACAGCAGAATGCCCCAACACAAATAGAGCTTG
GAATTCGTTGGAAGTTGAAGACTATGGCTTTGGAGTATTCACCACCAATATATGGCTAAAATTGAAAGAA
AAACAGGATGTATTCTGCGACTCAAAACTCATGTCAGCGGCCATAAAAGACAACAGAGCCGTCCATGCCG
ATATGGGTTATTGGATAGAAAGTGCACTCAATGACACATGGAAGATAGAGAAAGCCTCTTTCATTGAAGT
TAAAAACTGCCACTGGCCAAAATCACACACCCTCTGGAGCAATGGAGTGCTAGAAAGTGAGATGATAATT
CCAAAGAATCTCGCTGGACCAGTGTCTCAACACAACTATAGACCAGGCTACCATACACAAATAACAGGAC
CATGGCATCTAGGTAAGCTTGAGATGGACTTTGATTTCTGTGATGGAACAACAGTGGTAGTGACTGAGGA
CTGCGGAAATAGAGGACCCTCTTTGAGAACAACCACTGCCTCTGGAAAACTCATAACAGAATGGTGCTGC
CGATCTTGCACATTACCACCGCTAAGATACAGAGGTGAGGATGGGTGCTGGTACGGGATGGAAATCAGAC
CATTGAAGGAGAAAGAAGAGAATTTGGTCAACTCCTTGGTCACAGCTGGACATGGGCAGGTCGACAACTT
TTCACTAGGAGTCTTGGGAATGGCATTGTTCCTGGAGGAAATGCTTAGGACCCGAGTAGGAACGAAACAT
GCAATACTACTAGTTGCAGTTTCTTTTGTGACATTGATCACAGGGAACATGTCCTTTAGAGACCTGGGAA
GAGTGATGGTTATGGTAGGCGCCACTATGACGGATGACATAGGTATGGGCGTGACTTATCTTGCCCTACT
AGCAGCCTTCAAAGTCAGACCAACTTTTGCAGCTGGACTACTCTTGAGAAAGCTGACCTCCAAGGAATTG
ATGATGACTACTATAGGAATTGTACTCCTCTCCCAGAGCACCATACCAGAGACCATTCTTGAGTTGACTG
ATGCGTTAGCCTTAGGCATGATGGTCCTCAAAATGGTGAGAAATATGGAAAAGTATCAATTGGCAGTGAC
TATCATGGCTATCTTGTGCGTCCCAAACGCAGTGATATTACAAAACGCATGGAAAGTGAGTTGCACAATA
TTGGCAGTGGTGTCCGTTTCCCCACTGCTCTTAACATCCTCACAGCAAAAAACAGATTGGATACCATTAG
CATTGACGATCAAAGGTCTCAATCCAACAGCTATTTTTCTAACAACCCTCTCAAGAACCAGCAAGAAAAG
GAGCTGGCCATTAAATGAGGCTATCATGGCAGTCGGGATGGTGAGCATTTTAGCCAGTTCTCTCCTAAAA
AATGATATTCCCATGACAGGACCATTAGTGGCTGGAGGGCTCCTCACTGTGTGCTACGTGCTCACTGGAC
GATCGGCCGATTTGGAACTGGAGAGAGCAGCCGATGTCAAATGGGAAGACCAGGCAGAGATATCAGGAAG
CAGTCCAATCCTGTCAATAACAATATCAGAAGATGGTAGCATGTCGATAAAAAATGAAGAGGAAGAACAA
ACACTGACCATACTCATTAGAACAGGATTGCTGGTGATCTCAGGACTTTTTCCTGTATCAATACCAATCA
CGGCAGCAGCATGGTACCTGTGGGAAGTGAAGAAACAACGGGCCGGAGTATTGTGGGATGTTCCTTCACC
CCCACCCATGGGAAAGGCTGAACTGGAAGATGGAGCCTATAGAATTAAGCAAAAAGGGATTCTTGGATAT
TCCCAGATCGGAGCCGGAGTTTACAAAGAAGGAACATTCCATACAATGTGGCATGTCACACGTGGCGCTG
TTCTAATGCATAAAGGAAAGAGGATTGAACCATCATGGGCGGACGTCAAGAAAGACCTAATATCATATGG
AGGAGGCTGGAAGTTAGAAGGAGAATGGAAGGAAGGAGAAGAAGTCCAGGTATTGGCACTGGAGCCTGGA
AAAAATCCAAGAGCCGTCCAAACGAAACCTGGTCTTTTCAAAACCAACGCCGGAACAATAGGTGCTGTAT
CTCTGGACTTTTCTCCTGGAACGTCAGGATCTCCAATTATCGACAAAAAAGGAAAAGTTGTGGGTCTTTA
TGGTAATGGTGTTGTTACAAGGAGTGGAGCATATGTGAGTGCTATAGCCCAGACTGAAAAAAGCATTGAA
GACAACCCAGAGATCGAAGATGACATTTTCCGAAAGAGAAGACTGACCATCATGGACCTCCACCCAGGAG
CGGGAAAGACGAAGAGATACCTTCCGGCCATAGTCAGAGAAGCTATAAAACGGGGTTTGAGAACATTAAT
CTTGGCCCCCACTAGAGTTGTGGCAGCTGAAATGGAGGAAGCCCTTAGAGGACTTCCAATAAGATACCAG
ACCCCAGCCATCAGAGCTGAGCACACCGGGCGGGAGATTGTGGACCTAATGTGTCATGCCACATTTACCA
TGAGGCTGCTATCACCAGTTAGAGTGCCAAACTACAACCTGATTATCATGGACGAAGCCCATTTCACAGA
CCCAGCAAGTATAGCAGCTAGAGGATACATCTCAACTCGAGTGGAGATGGGTGAGGCAGCTGGGATTTTT
ATGACAGCCACTCCCCCGGGAAGCAGAGACCCATTTCCTCAGAGCAATGCACCAATCATAGATGAAGAAA
GAGAAATCCCTGAACGTTCGTGGAATTCCGGACATGAATGGGTCACGGATTTTAAAGGGAAGACTGTTTG
GTTCGTTCCAAGTATAAAAGCAGGAAATGATATAGCAGCTTGCCTGAGGAAAAATGGAAAGAAAGTGATA
CAACTCAGTAGGAAGACCTTTGATTCTGAGTATGTCAAGACTAGAACCAATGATTGGGACTTCGTGGTTA
CAACTGACATTTCAGAAATGGGTGCCAATTTCAAGGCTGAGAGGGTTATAGACCCCAGACGCTGCATGAA
ACCAGTCATACTAACAGATGGTGAAGAGCGGGTGATTCTGGCAGGACCTATGCCAGTGACCCACTCTAGT
GCAGCACAAAGAAGAGGGAGAATAGGAAGAAATCCAAAAAATGAGAATGACCAGTACATATACATGGGGG
AACCTCTGGAAAATGATGAAGACTGTGCACACTGGAAAGAAGCTAAAATGCTCCTAGATAACATCAACAC
GCCAGAAGGAATCATTCCTAGCATGTTCGAACCAGAGCGTGAAAAGGTGGATGCCATTGATGGCGAATAC
CGCTTGAGAGGAGAAGCAAGGAAAACCTTTGTAGACTTAATGAGAAGAGGAGACCTACCAGTCTGGTTGG
CCTACAGAGTGGCAGCTGAAGGCATCAACTACGCAGACAGAAGGTGGTGTTTTGATGGAGTCAAGAACAA
CCAAATCCTAGAAGAAAACGTGGAAGTTGAAATCTGGACAAAAGAAGGGGAAAGGAAGAAATTGAAACCC
AGATGGTTGGATGCTAGGATCTATTCTGACCCACTGGCGCTAAAAGAATTTAAGGAATTTGCAGCCGGAA
GAAAGTCTCTGACCCTGAACCTAATCACAGAAATGGGTAGGCTCCCAACCTTCATGACTCAGAAGGCAAG
AGACGCACTGGACAACTTAGCAGTGCTGCACACGGCTGAGGCAGGTGGAAGGGCGTACAACCATGCTCTC
AGTGAACTGCCGGAGACCCTGGAGACATTGCTTTTACTGACACTTCTGGCTACAGTCACGGGAGGGATCT
TTTTATTCTTGATGAGCGGAAGGGGCATAGGGAAGATGACCCTGGGAATGTGCTGCATAATCACGGCTAG
CATCCTCCTATGGTACGCACAAATACAGCCACACTGGATAGCAGCTTCAATAATACTGGAGTTTTTTCTC
ATAGTTTTGCTTATTCCAGAACCTGAAAAACAGAGAACACCCCAAGACAACCAACTGACCTACGTTGTCA
TAGCCATCCTCACAGTGGTGGCCGCAACCATGGCAAACGAGATGGGTTTCCTAGAAAAAACGAAGAAAGA
TCTCGGATTGGGAAGCATTGCAACCCAGCAACCCGAGAGCAACATCCTGGACATAGATCTACGTCCTGCA
TCAGCATGGACGCTGTATGCCGTGGCCACAACATTTGTTACACCAATGTTGAGACATAGCATTGAAAATT
CCTCAGTGAATGTGTCCCTAACAGCTATAGCCAACCAAGCCACAGTGTTAATGGGTCTCGGGAAAGGATG
GCCATTGTCAAAGATGGACATCGGAGTTCCCCTTCTCGCCATTGGATGCTACTCACAAGTCAACCCCATA
ACTCTCACAGCAGCTCTTTTCTTATTGGTAGCACATTATGCCATCATAGGGCCAGGACTCCAAGCAAAAG
CAACCAGAGAAGCTCAGAAAAGAGCAGCGGCGGGCATCATGAAAAACCCAACTGTCGATGGAATAACAGT
GATTGACCTAGATCCAATACCTTATGATCCAAAGTTTGAAAAGCAGTTGGGACAAGTAATGCTCCTAGTC
CTCTGCGTGACTCAAGTATTGATGATGAGGACTACATGGGCTCTGTGTGAGGCTTTAACCTTAGCTACCG
GGCCCATCTCCACATTGTGGGAAGGAAATCCAGGGAGGTTTTGGAACACTACCATTGCGGTGTCAATGGC
TAACATTTTTAGAGGGAGTTACTTGGCCGGAGCTGGACTTCTCTTTTCTATTATGAAGAACACAACCAAC
ACAAGAAGGGGAACTGGCAACATAGGAGAGACGCTTGGAGAGAAATGGAAAAGCCGATTGAACGCATTGG
GAAAAAGTGAATTCCAGATCTACAAGAAAAGTGGAATCCAGGAAGTGGATAGAACCTTAGCAAAAGAAGG
CATTAAAAGAGGAGAAACGGACCATCACGCTGTGTCGCGAGGCTCAGCAAAACTGAGATGGTTCGTTGAG
AGAAACATGGTCACACCAGAAGGGAAAGTAGTGGACCTCGGTTGTGGCAGAGGAGGCTGGTCATACTATT
GTGGAGGACTAAAGAATGTAAGAGAAGTCAAAGGCCTAACAAAAGGAGGACCAGGACACGAAGAACCCAT
CCCCATGTCAACATATGGGTGGAATCTAGTGCGTCTTCAAAGTGGAGTTGACGTTTTCTTCATCCCGCCA
GAAAAGTGTGACACATTATTGTGTGACATAGGGGAGTCATCACCAAATCCCACAGTGGAAGCAGGACGAA
CACTCAGAGTCCTTAACTTAGTAGAAAATTGGTTGAACAACAACACTCAATTTTGCATAAAGGTTCTCAA
CCCATATATGCCCTCAGTCATAGAAAAAATGGAAGCACTACAAAGGAAATATGGAGGAGCCTTAGTGAGG
AATCCACTCTCACGAAACTCCACACATGAGATGTACTGGGTATCCAATGCTTCCGGGAACATAGTGTCAT
CAGTGAACATGATTTCAAGGATGTTGATCAACAGATTTACAATGAGATACAAGAAAGCCACTTACGAGCC
GGATGTTGACCTCGGAAGCGGAACCCGTAACATCGGGATTGAAAGTGAGATACCAAACCTAGATATAATT
GGGAAAAGAATAGAAAAAATAAAGCAAGAGCATGAAACATCATGGCACTATGACCAAGACCACCCATACA
AAACGTGGGCATACCATGGTAGCTATGAAACAAAACAGACTGGATCAGCATCATCCATGGTCAACGGAGT
GGTCAGGCTGCTGACAAAACCTTGGGACGTCGTCCCCATGGTGACACAGATGGCAATGACAGACACGACT
CCATTTGGACAACAGCGCGTTTTTAAAGAGAAAGTGGACACGAGAACCCAAGAACCGAAAGAAGGCACGA
AGAAACTAATGAAAATAACAGCAGAGTGGCTTTGGAAAGAATTAGGGAAGAAAAAGACACCCAGGATGTG
CACCAGAGAAGAATTCACAAGAAAGGTGAGAAGCAATGCAGCCTTGGGGGCCATATTCACTGATGAGAAC
AAGTGGAAGTCGGCACGTGAGGCTGTTGAAGATAGTAGGTTTTGGGAGCTGGTTGACAAGGAAAGGAATC
TCCATCTTGAAGGAAAGTGTGAAACATGTGTGTACAACATGATGGGAAAAAGAGAGAAGAAGCTAGGGGA
ATTCGGCAAGGCAAAAGGCAGCAGAGCCATATGGTACATGTGGCTTGGAGCACGCTTCTTAGAGTTTGAA
GCCCTAGGATTCTTAAATGAAGATCACTGGTTCTCCAGAGAGAACTCCCTGAGTGGAGTGGAAGGAGAAG
GGCTGCACAAGCTAGGTTACATTCTAAGAGACGTGAGCAAGAAAGAGGGAGGAGCAATGTATGCCGATGA
CACCGCAGGATGGGATACAAGAATCACACTAGAAGACCTAAAAAATGAAGAAATGGTAACAAACCACATG
GAAGGAGAACACAAGAAACTAGCCGAGGCCATTTTCAAACTAACGTACCAAAACAAGGTGGTGCGTGTGC
AAAGACCAACACCAAGAGGCACAGTAATGGACATCATATCGAGAAGAGACCAAAGAGGTAGTGGACAAGT
TGGCACCTATGGACTCAATACTTTCACCAATATGGAAGCCCAACTAATCAGACAGATGGAGGGAGAAGGA
GTCTTTAAAAGCATTCAGCACCTAACAATCACAGAAGAAATCGCTGTGCAAAACTGGTTAGCAAGAGTGG
GGCGCGAAAGGTTATCAAGAATGGCCATCAGTGGAGATGATTGTGTTGTGAAACCTTTAGATGACAGGTT
CGCAAGCGCTTTAACAGCTCTAAATGACATGGGAAAGATTAGGAAAGACATACAACAATGGGAACCTTCA
AGAGGATGGAATGATTGGACACAAGTGCCCTTCTGTTCACACCATTTCCATGAGTTAATCATGAAAGACG
GTCGCGTACTCGTTGTTCCATGTAGAAACCAAGATGAACTGATTGGCAGAGCCCGAATCTCCCAAGGAGC
AGGGTGGTCTTTGCGGGAGACGGCCTGTTTGGGGAAGTCTTACGCCCAAATGTGGAGCTTGATGTACTTC
CACAGACGCGACCTCAGGCTGGCGGCAAATGCTATTTGCTCGGCAGTACCATCACATTGGGTTCCAACAA
GTCGAACAACCTGGTCCATACATGCTAAACATGAATGGATGACAACGGAAGACATGCTGACAGTCTGGAA
CAGGGTGTGGATTCAAGAAAACCCATGGATGGAAGACAAAACTCCAGTGGAATCATGGGAGGAAATCCCA
TACTTGGGGAAAAGAGAAGACCAATGGTGCGGCTCATTGATTGGGTTAACAAGCAGGGCCACCTGGGCAA
AGAACATCCAAGCAGCAATAAATCAAGTTAGATCCCTTATAGGCAATGAAGAATACACAGATTACATGCC
ATCCATGAAAAGATTCAGAAGAGAAGAGGAAGAAGCAGGAGTTCTGTGGTAGAAAGCAAAACTAACATGA
AACAAGGCTAGAAGTCAGGTCGGATTAAGCCATAGTACGGAAAAAACTATGCTACCTGTGAGCCCCGTCC
AAGGACGTTAAAAGAAGTCAGGCCATCATAAATGCCATAGCTTGAGTAAACTATGCAGCCTGTAGCTCCA
CCTGAGAAGGTGTAAAAAATCCGGGAGGCCACAAACCATGGAAGCTGTACGCATGGCGTAGTGGACTAGC
GGTTAGAGGAGACCCCTCCCTTACAAATCGCAGCAACAATGGGGGCCCAAGGCGAGATGAAGCTGTAGTC
TCGCTGGAAGGACTAGAGGTTAGAGGAGACCCCCCCGAAACAAAAAACAGCATATTGACGCTGGGAAAGA
CCAGAGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAATGGTGCTGTTGA
ATCAACAGGTTCT
Click to Show/Hide
|