Home
Search 
BLAST
Manual
DownloadDetails of Virus RNA
| Strain Information | Strain Name |
Chikungunya virus (strain 181/25)
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Togaviridae
|
||||||||
| RNA Binding Site |
5'UTR - 3'UTR
|
||||||||
| Virus Information | Virus Name |
Chikungunya virus (CHIKV)
|
|||||||
| Taxonomy ID | 37124 | ||||||||
Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.66683774550481e-05 | . |
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.78572712534234e-05 | . |
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.67532417139995e-05 | . |
| 130 kDa leucine-rich protein | P42704 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00770744980629436 | . |
| 130 kDa leucine-rich protein | P42704 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00292087790191266 | . |
| 140 kDa Ser/Arg-rich domain protein | O15042 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.256741507273525 | . |
| 140 kDa Ser/Arg-rich domain protein | O15042 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.199548514119082 | . |
| 140 kDa Ser/Arg-rich domain protein | O15042 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0420018537027079 | . |
| 182 kDa tankyrase-1-binding protein | Q9C0C2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00147047860401794 | . |
| 182 kDa tankyrase-1-binding protein | Q9C0C2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000562079759418042 | . |
| 182 kDa tankyrase-1-binding protein | Q9C0C2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00044986016168261 | . |
| 2',3'-cyclic-nucleotide 3'-phosphodiesterase | P09543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 2',3'-cyclic-nucleotide 3'-phosphodiesterase | P09543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 2',3'-cyclic-nucleotide 3'-phosphodiesterase | P09543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 2'-5'-oligoadenylate synthase 3 | Q9Y6K5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0288103439902556 | . |
| 2'-5'-oligoadenylate synthase 3 | Q9Y6K5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000390831066133612 | . |
| 2'-5'-oligoadenylate synthase 3 | Q9Y6K5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 2-hydroxyacyl-CoA lyase 2 | A1L0T0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.498288189588704 | . |
| 2-hydroxyacyl-CoA lyase 2 | A1L0T0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.459741880543792 | . |
| 2-hydroxyacyl-CoA lyase 2 | A1L0T0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.371188593842319 | . |
| 26S proteasome non-ATPase regulatory subunit 1 | Q99460 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.48248232043498e-05 | . |
| 26S proteasome non-ATPase regulatory subunit 1 | Q99460 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00203847377029264 | . |
| 26S proteasome non-ATPase regulatory subunit 1 | Q99460 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000111177701020344 | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 26S proteasome non-ATPase regulatory subunit 3 | O43242 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.32825614429505e-05 | . |
| 26S proteasome non-ATPase regulatory subunit 3 | O43242 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.21814088579278e-05 | . |
| 26S proteasome non-ATPase regulatory subunit 3 | O43242 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000377385524838432 | . |
| 28S ribosomal protein S5 | P82675 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 28S ribosomal protein S5 | P82675 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 28S ribosomal protein S5 | P82675 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 3'-5' RNA exonuclease OLD35 | Q8TCS8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.399893209265952 | . |
| 3'-5' RNA exonuclease OLD35 | Q8TCS8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.167255901866203 | . |
| 3'-5' RNA exonuclease OLD35 | Q8TCS8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 3'-5' RNA helicase YTHDC2 | Q9H6S0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 3-hydroxyacyl-CoA dehydratase 2 | Q6Y1H2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 3-hydroxyacyl-CoA dehydratase 2 | Q6Y1H2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 3-hydroxyacyl-CoA dehydratase 2 | Q6Y1H2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 3-keto acyl-CoA synthase ELOVL1 | Q9BW60 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000576146903080668 | . |
| 3-keto acyl-CoA synthase ELOVL1 | Q9BW60 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000541711455495824 | . |
| 3-keto acyl-CoA synthase ELOVL1 | Q9BW60 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00030457661799887 | . |
| 3-keto acyl-CoA synthase ELOVL5 | Q9NYP7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000246969670205154 | . |
| 3-keto acyl-CoA synthase ELOVL5 | Q9NYP7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000104628784080247 | . |
| 350/400 kDa PCAF-associated factor | Q9Y4A5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.178363152483305 | . |
| 350/400 kDa PCAF-associated factor | Q9Y4A5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 350/400 kDa PCAF-associated factor | Q9Y4A5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 39S ribosomal protein L43 | Q8N983 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.315155591280573 | . |
| 39S ribosomal protein L43 | Q8N983 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 39S ribosomal protein L43 | Q8N983 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 40S ribosomal protein S11 | P62280 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 40S ribosomal protein S11 | P62280 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 40S ribosomal protein S11 | P62280 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 3.04392223267482e-05 | FC > 5 |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.0494788475312226 | FC > 5 |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.00681767867613462 | FC > 5 |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.00102772373799801 | FC > 5 |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.000184155259818739 | FC > 5 |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00681767867613462 | . |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00102772373799801 | . |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000184155259818739 | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 40S ribosomal protein S20 | P60866 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 40S ribosomal protein S20 | P60866 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 40S ribosomal protein S23 | P62266 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00112150287836047 | . |
| 40S ribosomal protein S23 | P62266 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000425025507623382 | . |
| 40S ribosomal protein S23 | P62266 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000158245648260688 | . |
| 40S ribosomal protein S24 | P62847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 6.93711476795079e-05 | FC > 5 |
| 40S ribosomal protein S24 | P62847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 5.4227234399913e-05 | FC > 5 |
| 40S ribosomal protein S24 | P62847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 4.74170623716339e-05 | FC > 5 |
| 40S ribosomal protein S24 | P62847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00415798204103762 | FC > 5 |
| 40S ribosomal protein S24 | P62847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.00128963114044519 | FC > 5 |
| 40S ribosomal protein S24 | P62847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.00126211151383592 | FC > 5 |
| 40S ribosomal protein S24 | P62847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.93711476795079e-05 | . |
| 40S ribosomal protein S24 | P62847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.74170623716339e-05 | . |
| 40S ribosomal protein S24 | P62847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00415798204103762 | . |
| 40S ribosomal protein S27 | P42677 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 40S ribosomal protein S27 | P42677 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 40S ribosomal protein S27 | P42677 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.0262665242862563 | FC > 5 |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.0123144435857701 | FC > 5 |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.00065044451844021 | FC > 5 |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000600495339817465 | FC > 5 |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.00059206795580375 | FC > 5 |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0262665242862563 | . |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0123144435857701 | . |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | . | FC > 5 |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 3.41068705126328e-05 | FC > 5 |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.00629004909017407 | FC > 5 |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.00336384166780624 | FC > 5 |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00197110168487744 | FC > 5 |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000324060718775099 | FC > 5 |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000200294359510181 | FC > 5 |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00629004909017407 | . |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00197110168487744 | . |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000324060718775099 | . |
| 40S ribosomal protein S7 | P62081 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00380223684220354 | . |
| 40S ribosomal protein S7 | P62081 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00118310522239768 | . |
| 40S ribosomal protein S7 | P62081 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000807043951422464 | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 9.28966099325417e-06 | FC > 5 |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 5.86511047886785e-05 | FC > 5 |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 4.75106596249036e-06 | FC > 5 |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 2.5998997467348e-05 | FC > 5 |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 2.17210293703192e-05 | FC > 5 |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.000101677484193522 | FC > 5 |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.28966099325417e-06 | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.5998997467348e-05 | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000101677484193522 | . |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 4E-T | Q9NRA8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 4E-T | Q9NRA8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 4E-T | Q9NRA8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 4F2 cell-surface antigen heavy chain | P08195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.52601739203966e-05 | . |
| 4F2 cell-surface antigen heavy chain | P08195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.37754560584913e-05 | . |
| 4F2 cell-surface antigen heavy chain | P08195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.77589135532703e-05 | . |
| 4F2 light chain | Q01650 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.217325749649686 | . |
| 4F2 light chain | Q01650 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0773754012028519 | . |
| 4F2 light chain | Q01650 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0384771359097732 | . |
| 5'-3' exoribonuclease 1 | Q8IZH2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0373434705923331 | . |
| 5'-3' exoribonuclease 1 | Q8IZH2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 5'-3' exoribonuclease 1 | Q8IZH2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 8.05385095208137e-05 | . |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.02967860726573e-05 | . |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.81221219282459e-05 | . |
| 5-oxoprolinase | O14841 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 5-oxoprolinase | O14841 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 5-oxoprolinase | O14841 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 6-phosphofructokinase type A | P08237 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 6-phosphofructokinase type A | P08237 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 6-phosphofructokinase type A | P08237 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L11 | P62913 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0238013248756942 | . |
| 60S ribosomal protein L11 | P62913 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0181697044099189 | . |
| 60S ribosomal protein L11 | P62913 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0121955169265545 | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.0146603544521739 | FC > 5 |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.00566356494072864 | FC > 5 |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.00497672090011735 | FC > 5 |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00439996811950177 | FC > 5 |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.00279852510013025 | FC > 5 |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000908762258197346 | FC > 5 |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00497672090011735 | . |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00439996811950177 | . |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000908762258197346 | . |
| 60S ribosomal protein L13a | P40429 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.40497484323461e-05 | . |
| 60S ribosomal protein L13a | P40429 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00525144246442285 | . |
| 60S ribosomal protein L13a | P40429 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000314433579540377 | . |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 8.85447678177598e-05 | FC > 5 |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000890023076228823 | FC > 5 |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000110670955814598 | FC > 5 |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | . | FC > 5 |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | . | FC > 5 |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | . | FC > 5 |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 4.69997230391513e-06 | FC > 5 |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 2.39992958119326e-05 | FC > 5 |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.195614737240143 | FC > 5 |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.00090460583802413 | FC > 5 |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.00069867388799209 | FC > 5 |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.0006263135647172 | FC > 5 |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.195614737240143 | . |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00090460583802413 | . |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00069867388799209 | . |
| 60S ribosomal protein L18 | Q07020 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L18 | Q07020 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L18 | Q07020 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 1.13236912134833e-05 | FC > 5 |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000784927821747704 | FC > 5 |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00063503309370867 | FC > 5 |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000504560316338266 | FC > 5 |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000245527497224397 | FC > 5 |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000220840923674354 | FC > 5 |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00063503309370867 | . |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000504560316338266 | . |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000220840923674354 | . |
| 60S ribosomal protein L21 | Q59GK9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L21 | Q59GK9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L22 | P35268 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00296200832149953 | . |
| 60S ribosomal protein L22 | P35268 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00127992455266534 | . |
| 60S ribosomal protein L22 | P35268 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00109458666132977 | . |
| 60S ribosomal protein L23 | P62829 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L23 | P62829 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L23 | P62829 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L27 | P61353 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L27 | P61353 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L27 | P61353 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L27a | P46776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.45791524877332e-05 | . |
| 60S ribosomal protein L27a | P46776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.01170394990614e-05 | . |
| 60S ribosomal protein L27a | P46776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000274420282057672 | . |
| 60S ribosomal protein L28 | P46779 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L28 | P46779 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L28 | P46779 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 9.22033234516658e-05 | FC > 5 |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.00166774314413153 | FC > 5 |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00107252391045681 | FC > 5 |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000530305806136799 | FC > 5 |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.0003003588043329 | FC > 5 |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000147358125915671 | FC > 5 |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00107252391045681 | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000530305806136799 | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000147358125915671 | . |
| 60S ribosomal protein L34 | P49207 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L36a | P83881 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L36a | P83881 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L36a | P83881 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L36a-like | Q969Q0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L36a-like | Q969Q0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L36a-like | Q969Q0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 9.0052444436731e-05 | FC > 5 |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.00704937206179714 | FC > 5 |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00219558334352662 | FC > 5 |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.00142877813818791 | FC > 5 |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000724660038492366 | FC > 5 |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000482575813530436 | FC > 5 |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00219558334352662 | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00142877813818791 | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000724660038492366 | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 9.83673097216218e-07 | FC > 5 |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 2.82896909720792e-06 | FC > 5 |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 2.49028034310454e-05 | FC > 5 |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 2.31012409274765e-05 | FC > 5 |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 1.0240619979592e-06 | FC > 5 |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00018495832912554 | FC > 5 |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.49028034310454e-05 | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.31012409274765e-05 | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00018495832912554 | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 5.71879032360005e-05 | FC > 5 |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.0008256124182421 | FC > 5 |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 1.17375819680061e-05 | FC > 5 |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000479865604024837 | FC > 5 |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000275050138252371 | FC > 5 |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0008256124182421 | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000111780661211923 | FC > 5 |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000479865604024837 | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000275050138252371 | . |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 2.43246622916437e-05 | FC > 5 |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 1.31246222234343e-05 | FC > 5 |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.000891535261088443 | FC > 5 |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000624939880504593 | FC > 5 |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000398101979427866 | FC > 5 |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000263735656503489 | FC > 5 |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000891535261088443 | . |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000398101979427866 | . |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000263735656503489 | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.304214290154219 | FC > 5 |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.123478915853063 | FC > 5 |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.0607367170307051 | FC > 5 |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.00516416686943737 | FC > 5 |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00507274892226006 | FC > 5 |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.00189347586481559 | FC > 5 |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00516416686943737 | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00507274892226006 | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00189347586481559 | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 60S ribosomal protein L9 | P32969 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 60S ribosomal protein L9 | P32969 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 60S ribosomal protein L9 | P32969 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| 78 kDa gastrin-binding protein | P40939 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 8.36892278865437e-05 | . |
| 78 kDa gastrin-binding protein | P40939 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.70837313196242e-05 | . |
| 78 kDa gastrin-binding protein | P40939 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.99233975462418e-05 | . |
| 7SK snRNA methylphosphate capping enzyme | Q7L2J0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| 7SK snRNA methylphosphate capping enzyme | Q7L2J0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| 7SK snRNA methylphosphate capping enzyme | Q7L2J0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| A-kinase anchor protein 2 | Q9Y2D5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00328345594260122 | . |
| A-kinase anchor protein 2 | Q9Y2D5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00207810636358756 | . |
| A-kinase anchor protein 2 | Q9Y2D5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00163804202211572 | . |
| Acetate--CoA ligase 3 | Q9H6R3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Acetyl-CoA carboxylase 1 | Q13085 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.910375482211137 | . |
| Acetyl-CoA carboxylase 1 | Q13085 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.146573644052515 | . |
| Acetyl-CoA carboxylase 1 | Q13085 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0813590044450951 | . |
| Actin-binding LIM protein 1 | O14639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000186415371396105 | . |
| Actin-binding LIM protein 1 | O14639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000111090936431031 | . |
| Actin-binding LIM protein 1 | O14639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000100558716567518 | . |
| Actin-related protein 2/3 complex subunit 1A | Q92747 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00990755979174139 | . |
| Actin-related protein 2/3 complex subunit 1A | Q92747 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00896232279551993 | . |
| Actin-related protein 2/3 complex subunit 1A | Q92747 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00467285375381218 | . |
| Actin-related protein 2/3 complex subunit 1B | O15143 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Actin-related protein 2/3 complex subunit 1B | O15143 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Actin-related protein 2/3 complex subunit 1B | O15143 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Activity-dependent neuroprotective protein | Q9H2P0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000887897078055462 | . |
| Activity-dependent neuroprotective protein | Q9H2P0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000707476438756393 | . |
| Activity-dependent neuroprotective protein | Q9H2P0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000497228707278805 | . |
| Acute-phase response factor | P40763 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0211218001382698 | . |
| Acute-phase response factor | P40763 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00125269869614294 | . |
| Acute-phase response factor | P40763 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000935801102509259 | . |
| Acyl-CoA 6-desaturase | O95864 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.348266163974102 | . |
| Acyl-CoA 6-desaturase | O95864 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.144626775338446 | . |
| Acyl-CoA 6-desaturase | O95864 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.14009200416138 | . |
| Acyl-coenzyme A thioesterase 9 | Q9Y305 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.014384069739177 | . |
| Acyl-coenzyme A thioesterase 9 | Q9Y305 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0104502538616595 | . |
| Acyl-coenzyme A thioesterase 9 | Q9Y305 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00445410037141989 | . |
| Acylamino-acid-releasing enzyme | P13798 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0163522576433456 | . |
| Acylamino-acid-releasing enzyme | P13798 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0126496208308817 | . |
| Acylamino-acid-releasing enzyme | P13798 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00642464568031609 | . |
| Adenomatous polyposis coli protein | P25054 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0266853921897631 | . |
| Adenomatous polyposis coli protein | P25054 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00905390133427975 | . |
| Adenomatous polyposis coli protein | P25054 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00555093645251646 | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Adenylyl cyclase-associated protein 1 | Q01518 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000449972898344711 | . |
| Adenylyl cyclase-associated protein 1 | Q01518 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000229414269636422 | . |
| Adenylyl cyclase-associated protein 1 | Q01518 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000170601038931017 | . |
| Adenylyl cyclase-associated protein 2 | P40123 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ADP-ribosylation factor GTPase-activating protein 3 | Q9NP61 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00102155373355439 | . |
| ADP-ribosylation factor GTPase-activating protein 3 | Q9NP61 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000905175739805544 | . |
| ADP-ribosylation factor GTPase-activating protein 3 | Q9NP61 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000368643498910947 | . |
| ADP-ribosylation factor-like protein 1 | P40616 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0182677278358217 | . |
| ADP-ribosylation factor-like protein 1 | P40616 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00901917258340337 | . |
| ADP-ribosylation factor-like protein 1 | P40616 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000976125421345957 | . |
| ADP-ribosylation factor-like protein 8B | Q9NVJ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ADP/ATP translocase 2 | P05141 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00234285053492499 | . |
| ADP/ATP translocase 2 | P05141 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00103862511141902 | . |
| ADP/ATP translocase 2 | P05141 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000281941628906046 | . |
| ADP/ATP translocase 3 | P12236 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000479420388896984 | . |
| ADP/ATP translocase 3 | P12236 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000213510734631972 | . |
| ADP/ATP translocase 3 | P12236 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000181901570144506 | . |
| AF4/FMR2 family member 4 | Q9UHB7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.02901728293991 | . |
| AF4/FMR2 family member 4 | Q9UHB7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0261950773677568 | . |
| AF4/FMR2 family member 4 | Q9UHB7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0137635191860886 | . |
| Afadin | P55196 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000685007089445377 | . |
| Afadin | P55196 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000357768414368574 | . |
| Afadin | P55196 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000162971600973565 | . |
| Aging-associated gene 5 protein | O00116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Aging-associated gene 5 protein | O00116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Aging-associated gene 5 protein | O00116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Agrin | O00468 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Agrin | O00468 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| AHA1 | O95433 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.85065187688756e-06 | . |
| AHA1 | O95433 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.94702980061464e-05 | . |
| AHA1 | O95433 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 1.8217289247121e-05 | . |
| Alanine--tRNA ligase | P49588 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.514555108767157 | . |
| Alanine--tRNA ligase | P49588 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00838097377078951 | . |
| Alanine--tRNA ligase | P49588 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Alpha-1,2-mannosyltransferase ALG9 | Q9H6U8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Alpha-1,2-mannosyltransferase ALG9 | Q9H6U8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Alpha-1,2-mannosyltransferase ALG9 | Q9H6U8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Alpha-2-macroglobulin-like protein 1 | A8K2U0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.655345826582059 | . |
| Alpha-2-macroglobulin-like protein 1 | A8K2U0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.5229978911111 | . |
| Alpha-2-macroglobulin-like protein 1 | A8K2U0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Alpha-enolase | P06733 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00040778154603323 | . |
| Alpha-enolase | P06733 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000401612093659245 | . |
| Alpha-enolase | P06733 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000223115835748831 | . |
| Alpha-mannosidase 2 | Q16706 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Alpha-mannosidase 2 | Q16706 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Alpha-mannosidase 2 | Q16706 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Alpha-mannosidase 2C1 | Q9NTJ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Alpha-mannosidase 2C1 | Q9NTJ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Alpha-mannosidase 2C1 | Q9NTJ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Amidophosphoribosyltransferase | Q06203 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00659612799732351 | . |
| Amidophosphoribosyltransferase | Q06203 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00045974643303576 | . |
| Amidophosphoribosyltransferase | Q06203 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000193505858069214 | . |
| Amplified in liver cancer protein 1 | Q86WJ1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Amplified in liver cancer protein 1 | Q86WJ1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Amplified in liver cancer protein 1 | Q86WJ1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Anaphase-promoting complex subunit 1 | Q9H1A4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Anaphase-promoting complex subunit 1 | Q9H1A4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Anaphase-promoting complex subunit 1 | Q9H1A4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Androgen-induced proliferation inhibitor | Q9NTI5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Androgen-induced proliferation inhibitor | Q9NTI5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Androgen-induced proliferation inhibitor | Q9NTI5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Anillin | Q9NQW6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00177348699852336 | . |
| Anillin | Q9NQW6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000766026325963722 | . |
| Anillin | Q9NQW6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000540837512081015 | . |
| Ankyrin repeat domain-containing protein 17 | O75179 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00164330253766639 | . |
| Ankyrin repeat domain-containing protein 17 | O75179 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00158881850043138 | . |
| Ankyrin repeat domain-containing protein 17 | O75179 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000417934752625243 | . |
| Ankyrin-2 | Q01484 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ankyrin-2 | Q01484 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ankyrin-2 | Q01484 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Annexin A1 | P04083 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Annexin A2 | P07355 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0737715850201673 | . |
| Annexin A2 | P07355 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0035824001131268 | . |
| Annexin A2 | P07355 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0014608718666052 | . |
| Anoctamin-10 | Q9NW15 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Anoctamin-10 | Q9NW15 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Anoctamin-10 | Q9NW15 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Antigen NY-CO-16 | Q9BVJ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Antigen NY-CO-16 | Q9BVJ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Antigen NY-CO-16 | Q9BVJ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Antigen peptide transporter 2 | Q03519 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Antigen peptide transporter 2 | Q03519 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Antigen peptide transporter 2 | Q03519 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| AP-1 complex subunit beta-1 | Q10567 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| AP-1 complex subunit beta-1 | Q10567 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| AP-1 complex subunit gamma-1 | O43747 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.769288610452131 | . |
| AP-1 complex subunit gamma-1 | O43747 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.31123308362015 | . |
| AP-1 complex subunit gamma-1 | O43747 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.14123235202854 | . |
| AP-1 complex subunit mu-1 | Q9BXS5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.500893460706144 | . |
| AP-1 complex subunit mu-1 | Q9BXS5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.32603923416609 | . |
| AP-1 complex subunit mu-1 | Q9BXS5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00378526586151049 | . |
| AP-2 complex subunit alpha-1 | O95782 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| AP-2 complex subunit alpha-1 | O95782 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| AP-2 complex subunit alpha-1 | O95782 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| AP-2 complex subunit beta | P63010 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.99865808803538e-05 | . |
| AP-2 complex subunit beta | P63010 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00129840928963403 | . |
| AP-2 complex subunit beta | P63010 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000116233100170322 | . |
| AP-2 complex subunit mu | Q96CW1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.59426693164665e-05 | . |
| AP-2 complex subunit mu | Q96CW1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.6128801542092e-05 | . |
| AP-2 complex subunit mu | Q96CW1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.59110245352784e-05 | . |
| AP-3 complex subunit beta-1 | O00203 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00552474579715028 | . |
| AP-3 complex subunit beta-1 | O00203 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0010505244304608 | . |
| AP-3 complex subunit beta-1 | O00203 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000778966891664559 | . |
| AP-3 complex subunit delta-1 | O14617 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| AP-3 complex subunit delta-1 | O14617 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| AP-3 complex subunit delta-1 | O14617 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| AP-3 complex subunit mu-1 | Q9Y2T2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| AP-3 complex subunit mu-1 | Q9Y2T2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| AP-3 complex subunit mu-1 | Q9Y2T2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| AP2-associated protein kinase 1 | Q2M2I8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.77466590941244e-05 | . |
| AP2-associated protein kinase 1 | Q2M2I8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 8.21051971256128e-05 | . |
| AP2-associated protein kinase 1 | Q2M2I8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000103393674603087 | . |
| Apoptosis-inducing factor 1 | O95831 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0156519016924644 | . |
| Apoptosis-inducing factor 1 | O95831 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0140417126579058 | . |
| Apoptosis-inducing factor 1 | O95831 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00708129167207155 | . |
| Apoptotic chromatin condensation inducer in the nucleus | Q9UKV3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Apoptotic chromatin condensation inducer in the nucleus | Q9UKV3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Apoptotic chromatin condensation inducer in the nucleus | Q9UKV3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| apurinic or apyrimidinic site | P27695 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| apurinic or apyrimidinic site | P27695 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| apurinic or apyrimidinic site | P27695 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ARC130 | Q9ULK4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ARC130 | Q9ULK4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ARC130 | Q9ULK4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ARC150 | O60244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ARC150 | O60244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ARC150 | O60244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ARC205 | Q15648 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.15384935902203e-05 | . |
| ARC205 | Q15648 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.42118109338771e-05 | . |
| ARC205 | Q15648 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000656924778780561 | . |
| ARC240 | Q93074 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ARC240 | Q93074 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ARC240 | Q93074 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Arginase-1 | P05089 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Arginase-1 | P05089 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Arginase-1 | P05089 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Argininosuccinate synthase | P00966 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0144312374106567 | . |
| Argininosuccinate synthase | P00966 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00606172318867992 | . |
| Argininosuccinate synthase | P00966 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00318603645052252 | . |
| Arginyl-tRNA--protein transferase 1 | O95260 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Arginyl-tRNA--protein transferase 1 | O95260 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Asparagine--tRNA ligase | O43776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Asparagine--tRNA ligase | O43776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Asparagine--tRNA ligase | O43776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Asparagine-linked glycosylation protein 8 homolog | Q9BVK2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000636448919942513 | . |
| Asparagine-linked glycosylation protein 8 homolog | Q9BVK2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000402663696396275 | . |
| Aspartate--tRNA ligase | P14868 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000689817468266876 | . |
| Aspartate--tRNA ligase | P14868 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000194858627441838 | . |
| Aspartate--tRNA ligase | P14868 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000194550108475911 | . |
| Aspartate--tRNA ligase | Q6PI48 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Aspartate--tRNA ligase | Q6PI48 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Aspartate--tRNA ligase | Q6PI48 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Aspartyl aminopeptidase | Q9ULA0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Aspartyl aminopeptidase | Q9ULA0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Aspartyl aminopeptidase | Q9ULA0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| AT-rich interactive domain-containing protein 2 | Q68CP9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| AT-rich interactive domain-containing protein 2 | Q68CP9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| AT-rich interactive domain-containing protein 2 | Q68CP9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| AT1 receptor-associated protein | Q6RW13 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0308910385454967 | . |
| AT1 receptor-associated protein | Q6RW13 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00223702029142445 | . |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00147521843925273 | . |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00113898448246895 | . |
| ATP synthase subunit alpha | P25705 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.055436583974648 | . |
| ATP synthase subunit alpha | P25705 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ATP synthase subunit alpha | P25705 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ATP-binding cassette sub-family B member 7 | O75027 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0907280793754131 | . |
| ATP-binding cassette sub-family B member 7 | O75027 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0213385504927706 | . |
| ATP-binding cassette sub-family B member 7 | O75027 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00192761470684891 | . |
| ATP-binding cassette sub-family D member 3 | P28288 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ATP-binding cassette sub-family D member 3 | P28288 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ATP-binding cassette sub-family D member 3 | P28288 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ATP-binding cassette sub-family E member 1 | P61221 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00150650482494162 | . |
| ATP-binding cassette sub-family E member 1 | P61221 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00140185597696546 | . |
| ATP-binding cassette sub-family E member 1 | P61221 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000134051669740455 | . |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.77786304734857e-05 | . |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 6.8368336385658e-05 | . |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.3623835156332e-05 | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.63156580124467e-05 | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.09519805759645e-05 | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.88203977191197e-05 | . |
| ATP-dependent 6-phosphofructokinase | P17858 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0556449607632186 | . |
| ATP-dependent 6-phosphofructokinase | P17858 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000901300337748573 | . |
| ATP-dependent 6-phosphofructokinase | P17858 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000802626850422474 | . |
| ATP-dependent 6-phosphofructokinase | Q01813 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ATP-dependent DNA helicase Q1 | P46063 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000187709051439915 | . |
| ATP-dependent DNA helicase Q1 | P46063 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00017032823347584 | . |
| ATP-dependent DNA helicase Q1 | P46063 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000146137377037545 | . |
| ATP-dependent DNA/RNA helicase DHX36 | Q9H2U1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00405331480154402 | . |
| ATP-dependent DNA/RNA helicase DHX36 | Q9H2U1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000490196471381023 | . |
| ATP-dependent DNA/RNA helicase DHX36 | Q9H2U1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000353037538273274 | . |
| ATP-dependent helicase 1 | Q9H4L7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0701124532720766 | . |
| ATP-dependent helicase 1 | Q9H4L7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ATP-dependent helicase 1 | Q9H4L7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.10808533412214e-05 | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.91776689659519e-05 | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.76818434077026e-05 | . |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00019951963359743 | . |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000184697942623063 | . |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000140015428901361 | . |
| ATP-dependent RNA helicase DDX18 | Q9NVP1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ATP-dependent RNA helicase DDX18 | Q9NVP1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ATP-dependent RNA helicase DDX18 | Q9NVP1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ATP-dependent RNA helicase DDX24 | Q9GZR7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ATP-dependent RNA helicase DDX24 | Q9GZR7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ATP-dependent RNA helicase DDX24 | Q9GZR7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ATP-dependent RNA helicase DDX3X | O00571 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.07761957682483e-05 | . |
| ATP-dependent RNA helicase DDX3X | O00571 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000484935146848733 | . |
| ATP-dependent RNA helicase DDX3X | O00571 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000227699995047613 | . |
| ATP-dependent RNA helicase DDX42 | Q86XP3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.958055388644e-05 | . |
| ATP-dependent RNA helicase DDX42 | Q86XP3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000433837000067702 | . |
| ATP-dependent RNA helicase DDX42 | Q86XP3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00010000800883715 | . |
| ATP-dependent RNA helicase DDX50 | Q9BQ39 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ATP-dependent RNA helicase DDX50 | Q9BQ39 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ATP-dependent RNA helicase DDX50 | Q9BQ39 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ATP-dependent RNA helicase DDX54 | Q8TDD1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00576876411549489 | . |
| ATP-dependent RNA helicase DDX54 | Q8TDD1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00285474001731011 | . |
| ATP-dependent RNA helicase DDX54 | Q8TDD1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000949786771795049 | . |
| ATP-dependent RNA helicase DHX15 | O43143 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.14244921882955e-05 | . |
| ATP-dependent RNA helicase DHX15 | O43143 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.26385467858156e-05 | . |
| ATP-dependent RNA helicase DHX15 | O43143 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000188711152786766 | . |
| ATP-dependent RNA helicase DHX29 | Q7Z478 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000755113778090697 | . |
| ATP-dependent RNA helicase DHX29 | Q7Z478 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000566981979384909 | . |
| ATP-dependent RNA helicase DHX29 | Q7Z478 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000128178312109526 | . |
| ATP-dependent RNA helicase DHX30 | Q7L2E3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.04904149771982e-05 | . |
| ATP-dependent RNA helicase DHX30 | Q7L2E3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.97190640197032e-05 | . |
| ATP-dependent RNA helicase DHX30 | Q7L2E3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000223257787945596 | . |
| ATP-dependent RNA helicase DHX38 | Q92620 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.78123909385406e-05 | . |
| ATP-dependent RNA helicase DHX38 | Q92620 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.38828376972311e-05 | . |
| ATP-dependent RNA helicase DHX38 | Q92620 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00108606209899473 | . |
| ATP-dependent RNA helicase DHX8 | Q14562 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ATP-dependent RNA helicase DHX8 | Q14562 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ATP-dependent RNA helicase DHX8 | Q14562 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ATPase family AAA domain-containing protein 2 | Q6PL18 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ATPase family AAA domain-containing protein 2 | Q6PL18 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ATPase family AAA domain-containing protein 2 | Q6PL18 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ATPase MORC2 | Q9Y6X9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ATPase MORC2 | Q9Y6X9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ATPase MORC2 | Q9Y6X9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Atrophin-1-interacting protein 3 | Q96QZ7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Atrophin-1-interacting protein 3 | Q96QZ7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Atrophin-1-interacting protein 3 | Q96QZ7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| B-cell CLL/lymphoma 9-like protein | Q86UU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| B-cell CLL/lymphoma 9-like protein | Q86UU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| B-cell CLL/lymphoma 9-like protein | Q86UU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| B120 | O14497 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.885138162899462 | . |
| B120 | O14497 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.336339658581954 | . |
| B120 | O14497 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Baculoviral IAP repeat-containing protein 6 | Q9NR09 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Baculoviral IAP repeat-containing protein 6 | Q9NR09 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Baculoviral IAP repeat-containing protein 6 | Q9NR09 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Band 4.1-like protein 2 | O43491 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 6.9965948312963e-05 | . |
| Band 4.1-like protein 2 | O43491 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00055695115070172 | . |
| Band 4.1-like protein 2 | O43491 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000114556318385794 | . |
| Band 4.1-like protein 3 | Q9Y2J2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.33752363437052e-05 | . |
| Band 4.1-like protein 3 | Q9Y2J2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000159707054886615 | . |
| Band 4.1-like protein 3 | Q9Y2J2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000135960797203227 | . |
| Bax inhibitor 1 | P55061 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Bax inhibitor 1 | P55061 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Bax inhibitor 1 | P55061 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Bcl-2-associated transcription factor 1 | Q9NYF8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.20677695781531e-05 | . |
| Bcl-2-associated transcription factor 1 | Q9NYF8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000308955402461516 | . |
| Bcl-2-associated transcription factor 1 | Q9NYF8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000244407570140348 | . |
| BFA-resistant GEF 1 | Q92538 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.427969903082174 | . |
| BFA-resistant GEF 1 | Q92538 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| BFA-resistant GEF 1 | Q92538 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 9.44235688645617e-05 | . |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000252878307489029 | . |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000149616784640736 | . |
| Bifunctional purine biosynthesis protein ATIC | P31939 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00309919406842423 | . |
| Bifunctional purine biosynthesis protein ATIC | P31939 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00164080780658957 | . |
| Bifunctional purine biosynthesis protein ATIC | P31939 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00118320910315787 | . |
| Biorientation of chromosomes in cell division protein 1-like 1 | Q8NFC6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Biorientation of chromosomes in cell division protein 1-like 1 | Q8NFC6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| BMP-2-inducible protein kinase | Q9NSY1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.343474385896225 | . |
| BMP-2-inducible protein kinase | Q9NSY1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0489275548773125 | . |
| BMP-2-inducible protein kinase | Q9NSY1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0229566082865591 | . |
| BOS complex subunit NCLN | Q969V3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| BOS complex subunit NCLN | Q969V3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| BRCA2-interacting transcriptional repressor EMSY | Q7Z589 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| BRCA2-interacting transcriptional repressor EMSY | Q7Z589 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| BRCA2-interacting transcriptional repressor EMSY | Q7Z589 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Brefeldin A-inhibited GEP 1 | Q9Y6D6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Brefeldin A-inhibited GEP 1 | Q9Y6D6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Brefeldin A-inhibited GEP 1 | Q9Y6D6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Bromodomain-containing protein 1 | O95696 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Bromodomain-containing protein 4 | O60885 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Bromodomain-containing protein 4 | O60885 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Bromodomain-containing protein 4 | O60885 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| BRR2 homolog | O75643 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000237998934561449 | . |
| BRR2 homolog | O75643 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000180341316972973 | . |
| BRR2 homolog | O75643 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000177489984336081 | . |
| BUD13 homolog | Q9BRD0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0018715788123923 | . |
| BUD13 homolog | Q9BRD0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000879592139690246 | . |
| BUD13 homolog | Q9BRD0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000227869990363714 | . |
| Butyrate-induced protein 1 | Q9P035 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.99848158868458e-05 | . |
| Butyrate-induced protein 1 | Q9P035 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.71315232456863e-05 | . |
| Butyrate-induced protein 1 | Q9P035 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.04170797275883e-05 | . |
| C-1-tetrahydrofolate synthase | P11586 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0110304661990556 | . |
| C-1-tetrahydrofolate synthase | P11586 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00565788461125687 | . |
| C-1-tetrahydrofolate synthase | P11586 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000301222059074046 | . |
| CAAX prenyl protease 1 homolog | O75844 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| CAAX prenyl protease 1 homolog | O75844 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| CAAX prenyl protease 1 homolog | O75844 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| CAAX prenyl protease 2 | Q9Y256 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| CAAX prenyl protease 2 | Q9Y256 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| CAD protein | P27708 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00126149504959472 | . |
| CAD protein | P27708 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000988862890708492 | . |
| CAD protein | P27708 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000495331665622068 | . |
| Calcyclin-binding protein | Q9HB71 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Calmodulin-regulated spectrin-associated protein 1 | Q5T5Y3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0611996719056241 | . |
| Calmodulin-regulated spectrin-associated protein 1 | Q5T5Y3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0380866239734812 | . |
| Calmodulin-regulated spectrin-associated protein 1 | Q5T5Y3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0286197808508337 | . |
| Calmodulin-regulated spectrin-associated protein 2 | Q08AD1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Calmodulin-regulated spectrin-associated protein 2 | Q08AD1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Calmodulin-regulated spectrin-associated protein 2 | Q08AD1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cap methyltransferase 1 | Q8N1G2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0615279178855674 | . |
| Cap methyltransferase 1 | Q8N1G2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0601408590905744 | . |
| Cap methyltransferase 1 | Q8N1G2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0174618788774394 | . |
| Capsid | Capsid | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.85782769383136e-06 | . |
| Capsid | Capsid | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.71507079985416e-05 | . |
| Capsid | Capsid | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.61687210274928e-06 | . |
| Carbamoyl-phosphate synthase [ammonia] | P31327 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Carbamoyl-phosphate synthase [ammonia] | P31327 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Carbamoyl-phosphate synthase [ammonia] | P31327 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Carbonic anhydrase 6 | P23280 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Carbonic anhydrase 6 | P23280 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Caspase-14 | P31944 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.892063300792743 | . |
| Caspase-14 | P31944 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.358925223259349 | . |
| Caspase-14 | P31944 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.183098862245481 | . |
| Catalase | P04040 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Catenin beta-1 | P35222 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Catenin beta-1 | P35222 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Catenin beta-1 | P35222 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Catenin delta-1 | O60716 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Catenin delta-1 | O60716 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Catenin delta-1 | O60716 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cathepsin D | P07339 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0206239636707958 | . |
| Cathepsin D | P07339 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0104484652816985 | . |
| Cathepsin D | P07339 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cation-independent mannose-6-phosphate receptor | P11717 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| CCAAT/enhancer-binding protein zeta | Q03701 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| CCAAT/enhancer-binding protein zeta | Q03701 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| CCAAT/enhancer-binding protein zeta | Q03701 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| CCR4-NOT transcription complex subunit 1 | A5YKK6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0195556585124734 | . |
| CCR4-NOT transcription complex subunit 1 | A5YKK6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00717509306168504 | . |
| CCR4-NOT transcription complex subunit 1 | A5YKK6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00292572627612494 | . |
| CD2-associated protein | Q9Y5K6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| CD2-associated protein | Q9Y5K6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| CD2-associated protein | Q9Y5K6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cell cycle and apoptosis regulator protein 2 | Q8N163 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cell cycle and apoptosis regulator protein 2 | Q8N163 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cell cycle and apoptosis regulator protein 2 | Q8N163 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cell cycle control protein TS11 | P08243 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0246097653209707 | . |
| Cell cycle control protein TS11 | P08243 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0106519517468856 | . |
| Cell cycle control protein TS11 | P08243 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00843000560138237 | . |
| Cell division control protein 42 homolog | P60953 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 6.57776343267714e-05 | . |
| Cell division control protein 42 homolog | P60953 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.23924127896155e-05 | . |
| Cell division control protein 42 homolog | P60953 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000134687073250936 | . |
| Cell division cycle 5-like protein | Q99459 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cell division cycle 5-like protein | Q99459 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cell division cycle 5-like protein | Q99459 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cell division cycle protein 20 homolog | Q12834 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0333871360417934 | . |
| Cell division cycle protein 20 homolog | Q12834 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0311595699363494 | . |
| Cell division cycle protein 20 homolog | Q12834 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00141868978759083 | . |
| Cell division cycle protein 91-like 1 | Q9H490 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cell division cycle protein 91-like 1 | Q9H490 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cell division cycle protein 91-like 1 | Q9H490 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cell division cycle-associated protein 2 | Q69YH5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cell division cycle-associated protein 2 | Q69YH5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cell division cycle-associated protein 2 | Q69YH5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cell proliferation-inducing gene 54 protein | Q29RF7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.298807467902895 | . |
| Cell proliferation-inducing gene 54 protein | Q29RF7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.215049054892275 | . |
| Cell proliferation-inducing gene 54 protein | Q29RF7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0568764470370656 | . |
| Centaurin-delta-2 | Q96P48 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.5014536700787e-05 | . |
| Centaurin-delta-2 | Q96P48 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000375418073596521 | . |
| Centaurin-delta-2 | Q96P48 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000118459803491283 | . |
| Centromere protein 33 | Q9UFC0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Centromere protein 33 | Q9UFC0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Centromere protein 33 | Q9UFC0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Centromere protein C | Q03188 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Centromere protein C | Q03188 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Centromere protein C | Q03188 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Centrosomal protein of 170 kDa | Q5SW79 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00039866727997001 | . |
| Centrosomal protein of 170 kDa | Q5SW79 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000188000427058733 | . |
| Centrosomal protein of 170 kDa | Q5SW79 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000128634246117231 | . |
| Centrosomal protein of 170 kDa protein B | Q9Y4F5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Centrosomal protein of 170 kDa protein B | Q9Y4F5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Centrosomal protein of 170 kDa protein B | Q9Y4F5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Centrosome-associated protein ALMS1 | Q8TCU4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Centrosome-associated protein ALMS1 | Q8TCU4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Chloride intracellular channel protein 1 | O00299 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Chloride intracellular channel protein 1 | O00299 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Chloride intracellular channel protein 1 | O00299 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Chondrocyte-derived ezrin-like protein | Q9Y4F1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Chondrocyte-derived ezrin-like protein | Q9Y4F1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Chondrocyte-derived ezrin-like protein | Q9Y4F1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| CHORD domain-containing protein 1 | Q9UHD1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000451066591969518 | . |
| CHORD domain-containing protein 1 | Q9UHD1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000333291971057267 | . |
| CHORD domain-containing protein 1 | Q9UHD1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000135945929868342 | . |
| CHRAC subunit ACF1 | Q9NRL2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| CHRAC subunit ACF1 | Q9NRL2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| CHRAC subunit ACF1 | Q9NRL2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Chromatin assembly factor 1 subunit B | Q13112 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.493908355299132 | . |
| Chromatin assembly factor 1 subunit B | Q13112 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.301718412425666 | . |
| Chromodomain-helicase-DNA-binding protein 1 | O14646 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Chromodomain-helicase-DNA-binding protein 1 | O14646 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Chromodomain-helicase-DNA-binding protein 1 | O14646 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Chromodomain-helicase-DNA-binding protein 4 | Q14839 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0114422072125314 | . |
| Chromodomain-helicase-DNA-binding protein 4 | Q14839 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0027840543587468 | . |
| Chromodomain-helicase-DNA-binding protein 4 | Q14839 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00163560444841729 | . |
| Chromodomain-helicase-DNA-binding protein 8 | Q9HCK8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Chromodomain-helicase-DNA-binding protein 8 | Q9HCK8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Chromodomain-helicase-DNA-binding protein 8 | Q9HCK8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Chromosome-associated kinesin KIF4A | O95239 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00122571381278555 | . |
| Chromosome-associated kinesin KIF4A | O95239 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00068163447480674 | . |
| Chromosome-associated kinesin KIF4A | O95239 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000430499725987122 | . |
| Cirhin | Q969X6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.050598052252034 | . |
| Cirhin | Q969X6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.040161818969011 | . |
| Cirhin | Q969X6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0166834219029212 | . |
| Citron Rho-interacting kinase | O14578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Citron Rho-interacting kinase | O14578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Citron Rho-interacting kinase | O14578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 8.66871655978691e-05 | FC > 5 |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 8.64757155310421e-06 | FC > 5 |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 6.62461541095178e-05 | FC > 5 |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 5.17449220548779e-05 | FC > 5 |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 3.41059662124474e-05 | FC > 5 |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 1.31836678682626e-05 | FC > 5 |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.62461541095178e-05 | . |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.17449220548779e-05 | . |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.41059662124474e-05 | . |
| Clathrin heavy chain 2 | P53675 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Clathrin heavy chain 2 | P53675 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Clathrin interactor 1 | Q14677 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000896946285795792 | . |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00041085132061322 | . |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000384037234055998 | . |
| Cleavage stimulation factor subunit 1 | Q05048 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| CLIP-associating protein 1 | Q7Z460 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| CLIP-associating protein 1 | Q7Z460 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| CLIP-associating protein 1 | Q7Z460 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Clustered mitochondria protein homolog | O75153 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.548193489414258 | . |
| Clustered mitochondria protein homolog | O75153 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Clustered mitochondria protein homolog | O75153 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Coatomer subunit alpha | P53621 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.64096847609619e-05 | . |
| Coatomer subunit alpha | P53621 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.57949678421318e-05 | . |
| Coatomer subunit alpha | P53621 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000100690397415059 | . |
| Coatomer subunit beta | P53618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.36289747332553e-05 | . |
| Coatomer subunit beta | P53618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.23920708230494e-05 | . |
| Coatomer subunit beta | P53618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.97676394567336e-05 | . |
| Coatomer subunit beta' | P35606 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.00329078204061e-05 | . |
| Coatomer subunit beta' | P35606 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000164875130404184 | . |
| Coatomer subunit beta' | P35606 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00015442252509011 | . |
| Coatomer subunit delta | P48444 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.03693022463215e-05 | . |
| Coatomer subunit delta | P48444 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000250053773359258 | . |
| Coatomer subunit delta | P48444 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000142228357480458 | . |
| Coatomer subunit gamma-1 | Q9Y678 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.52908009028671e-05 | . |
| Coatomer subunit gamma-1 | Q9Y678 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.08707012276565e-05 | . |
| Coatomer subunit gamma-1 | Q9Y678 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.26797053473137e-05 | . |
| Cofilin-1 | P23528 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | . | FC > 5 |
| Cofilin-1 | P23528 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | . | FC > 5 |
| Cofilin-1 | P23528 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | . | FC > 5 |
| Cofilin-1 | P23528 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | . | FC > 5 |
| Cofilin-1 | P23528 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cofilin-1 | P23528 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Coiled-coil and C2 domain-containing protein 1A | Q6P1N0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Coiled-coil and C2 domain-containing protein 1A | Q6P1N0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Coiled-coil and C2 domain-containing protein 1B | Q5T0F9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Coiled-coil and C2 domain-containing protein 1B | Q5T0F9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Coiled-coil and C2 domain-containing protein 1B | Q5T0F9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Collagen alpha-1(I) chain | P02452 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 7.86322391399653e-05 | FC > 5 |
| Collagen alpha-1(I) chain | P02452 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 3.03512578276255e-05 | FC > 5 |
| Collagen alpha-1(I) chain | P02452 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 1.94172207925893e-05 | FC > 5 |
| Collagen alpha-1(I) chain | P02452 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.000848686440192928 | FC > 5 |
| Collagen alpha-1(I) chain | P02452 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000157257958961926 | FC > 5 |
| Collagen alpha-1(I) chain | P02452 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.00010495700758868 | FC > 5 |
| Collagen alpha-1(I) chain | P02452 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000848686440192928 | . |
| Collagen alpha-1(I) chain | P02452 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000157257958961926 | . |
| Collagen alpha-1(I) chain | P02452 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00010495700758868 | . |
| Collagen alpha-1(V) chain | P20908 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Collagen alpha-1(V) chain | P20908 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Collagen alpha-1(V) chain | P20908 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Collagen alpha-1(XII) chain | Q99715 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 9.20516194341094e-05 | . |
| Collagen alpha-1(XII) chain | Q99715 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000915115712964787 | . |
| Collagen alpha-1(XII) chain | Q99715 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000399822223772621 | . |
| Collagen alpha-2(IV) chain | P08572 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000684294214190206 | . |
| Collagen alpha-2(IV) chain | P08572 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000485800323837073 | . |
| Collagen alpha-2(IV) chain | P08572 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000464272743064834 | . |
| Collagen alpha-3(VI) chain | P12111 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Collagen alpha-3(VI) chain | P12111 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Condensin complex subunit 1 | Q15021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0146875684363392 | . |
| Condensin complex subunit 1 | Q15021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0130254018526196 | . |
| Condensin complex subunit 1 | Q15021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000448149055300192 | . |
| Condensin-2 complex subunit D3 | P42695 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Condensin-2 complex subunit D3 | P42695 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Condensin-2 complex subunit D3 | P42695 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Condensin-2 complex subunit G2 | Q86XI2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Condensin-2 complex subunit G2 | Q86XI2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Copine-3 | O75131 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0131162428029127 | . |
| Copine-3 | O75131 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00781958955966476 | . |
| Copine-3 | O75131 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00639254229564739 | . |
| Core histone macro-H2A.1 | O75367 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Core histone macro-H2A.1 | O75367 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Core histone macro-H2A.1 | O75367 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Coronin-1B | Q9BR76 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Coronin-1B | Q9BR76 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Coronin-1C | Q9ULV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0350816223083731 | . |
| Coronin-1C | Q9ULV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0247702102668546 | . |
| Coronin-1C | Q9ULV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Coronin-7 | P57737 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Coronin-7 | P57737 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Coronin-7 | P57737 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| CREB-binding protein | Q92793 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cullin-1 | Q13616 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cullin-1 | Q13616 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cullin-1 | Q13616 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cullin-2 | Q13617 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.686840715893745 | . |
| Cullin-2 | Q13617 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.674363019234112 | . |
| Cullin-2 | Q13617 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.173071643939925 | . |
| Cullin-3 | Q13618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cullin-3 | Q13618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cullin-3 | Q13618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cyclin-dependent kinase 12 | Q9NYV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cyclin-dependent kinase 12 | Q9NYV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cyclin-dependent kinase 12 | Q9NYV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cyclin-G-associated kinase | O14976 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.839409729636179 | . |
| Cyclin-G-associated kinase | O14976 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.670229147234339 | . |
| Cyclin-G-associated kinase | O14976 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.235394360320589 | . |
| Cyclin-T1 | O60563 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0470945983253375 | . |
| Cyclin-T1 | O60563 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0462384769529854 | . |
| Cyclin-T1 | O60563 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0143397805599007 | . |
| Cystatin-SN | P01037 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cytochrome c oxidase subunit 1 | P00395 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cytochrome c oxidase subunit 1 | P00395 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cytochrome c oxidase subunit 1 | P00395 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cytochrome c oxidase subunit 3 | P00414 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cytochrome c oxidase subunit 3 | P00414 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cytoplasmic aconitate hydratase | P21399 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.41399518390429e-05 | . |
| Cytoplasmic aconitate hydratase | P21399 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.82133289332355e-05 | . |
| Cytoplasmic aconitate hydratase | P21399 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000137033199477078 | . |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000451897287816643 | FC > 5 |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000318657497217159 | FC > 5 |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.000311439131916098 | FC > 5 |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.000250462273470328 | FC > 5 |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000138075242891426 | FC > 5 |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000129956812630837 | FC > 5 |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000451897287816643 | . |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000318657497217159 | . |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000311439131916098 | . |
| Cytoplasmic dynein 1 intermediate chain 2 | Q13409 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000424139796427681 | . |
| Cytoplasmic dynein 1 intermediate chain 2 | Q13409 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000133909888517262 | . |
| Cytoplasmic dynein 1 intermediate chain 2 | Q13409 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000131743203656171 | . |
| Cytoplasmic FMR1-interacting protein 1 | Q7L576 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cytoplasmic FMR1-interacting protein 1 | Q7L576 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cytoplasmic FMR1-interacting protein 1 | Q7L576 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cytoplasmic FMR1-interacting protein 2 | Q96F07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cytoplasmic FMR1-interacting protein 2 | Q96F07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cytoplasmic FMR1-interacting protein 2 | Q96F07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cytoskeleton-associated protein 2 | Q8WWK9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cytoskeleton-associated protein 2 | Q8WWK9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cytoskeleton-associated protein 2 | Q8WWK9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cytoskeleton-associated protein 2-like | Q8IYA6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Cytoskeleton-associated protein 2-like | Q8IYA6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Cytoskeleton-associated protein 2-like | Q8IYA6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Cytoskeleton-associated protein 5 | Q14008 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.67268450978178e-05 | . |
| Cytoskeleton-associated protein 5 | Q14008 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.35654738450189e-05 | . |
| Cytoskeleton-associated protein 5 | Q14008 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000117173338965856 | . |
| Cytosolic acyl coenzyme A thioester hydrolase | O00154 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 9.86594503822534e-05 | . |
| Cytosolic acyl coenzyme A thioester hydrolase | O00154 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.2769594037174e-05 | . |
| Cytosolic acyl coenzyme A thioester hydrolase | O00154 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000106800937395092 | . |
| Cytosolic non-specific dipeptidase | Q96KP4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000723328782742854 | . |
| Cytosolic non-specific dipeptidase | Q96KP4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000390964764113421 | . |
| D-3-phosphoglycerate dehydrogenase | O43175 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| D-3-phosphoglycerate dehydrogenase | O43175 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| D-fructose-6-phosphate amidotransferase 1 | Q06210 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| D-fructose-6-phosphate amidotransferase 1 | Q06210 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| D-fructose-6-phosphate amidotransferase 1 | Q06210 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DDB1- and CUL4-associated factor 1 | Q9Y4B6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DDB1- and CUL4-associated factor 1 | Q9Y4B6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DDB1- and CUL4-associated factor 1 | Q9Y4B6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DDB1- and CUL4-associated factor 13 | Q9NV06 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.88382971135138e-05 | . |
| DDB1- and CUL4-associated factor 13 | Q9NV06 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000425148415527101 | . |
| DDB1- and CUL4-associated factor 13 | Q9NV06 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000225238995890104 | . |
| DDB1- and CUL4-associated factor 3 | Q9C0C7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DDB1- and CUL4-associated factor 3 | Q9C0C7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DDB1- and CUL4-associated factor 3 | Q9C0C7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DDOST 48 kDa subunit | P39656 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.357876006579912 | . |
| DDOST 48 kDa subunit | P39656 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.284007125577255 | . |
| DDOST 48 kDa subunit | P39656 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00130917702813491 | . |
| DEAH-box protein 16 | O60231 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.79779641668859e-05 | . |
| DEAH-box protein 16 | O60231 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000371659841929744 | . |
| DEAH-box protein 16 | O60231 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000223126066598851 | . |
| Death inducer with SAP domain | Q8IX12 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0020408662893815 | . |
| Death inducer with SAP domain | Q8IX12 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00107092553591022 | . |
| Death inducer with SAP domain | Q8IX12 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000884883699392015 | . |
| Death-inducer obliterator 1 | Q9BTC0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.467178945690786 | . |
| Death-inducer obliterator 1 | Q9BTC0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.269119699242628 | . |
| Death-inducer obliterator 1 | Q9BTC0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0891775267662247 | . |
| Decreased expression in renal and prostate cancer protein | P0CG12 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Decreased expression in renal and prostate cancer protein | P0CG12 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Decreased expression in renal and prostate cancer protein | P0CG12 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Dedicator of cytokinesis protein 1 | Q14185 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Dedicator of cytokinesis protein 1 | Q14185 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Dedicator of cytokinesis protein 1 | Q14185 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Dedicator of cytokinesis protein 5 | Q9H7D0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Dedicator of cytokinesis protein 5 | Q9H7D0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Dedicator of cytokinesis protein 5 | Q9H7D0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Dedicator of cytokinesis protein 7 | Q96N67 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Dedicator of cytokinesis protein 7 | Q96N67 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Dedicator of cytokinesis protein 7 | Q96N67 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Delta(14)-sterol reductase LBR | Q14739 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.98879738939698e-06 | . |
| Delta(14)-sterol reductase LBR | Q14739 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.96156038189132e-06 | . |
| Delta(14)-sterol reductase LBR | Q14739 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.68105103204133e-05 | . |
| Delta-1-pyrroline-5-carboxylate synthase | P54886 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Delta-1-pyrroline-5-carboxylate synthase | P54886 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Delta-1-pyrroline-5-carboxylate synthase | P54886 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DENN domain-containing protein 1A | Q8TEH3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DENN domain-containing protein 1A | Q8TEH3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DENN domain-containing protein 1A | Q8TEH3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DENN domain-containing protein 2B | P78524 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DENN domain-containing protein 2B | P78524 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DENN domain-containing protein 2B | P78524 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Derlin-1 | Q9BUN8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Derlin-1 | Q9BUN8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Derlin-1 | Q9BUN8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Dermcidin | P81605 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.342897212028809 | . |
| Dermcidin | P81605 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0200291445538512 | . |
| Dermcidin | P81605 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0182832453782528 | . |
| Desmocollin-1 | Q08554 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.346630224900966 | FC > 5 |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.287093854629259 | FC > 5 |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.0496431215633015 | FC > 5 |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.0440869655629562 | FC > 5 |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000985716841547333 | FC > 5 |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.346630224900966 | . |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.287093854629259 | . |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | . | FC > 5 |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Desmoplakin | P15924 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.0585910521781797 | FC > 5 |
| Desmoplakin | P15924 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.0243019483395615 | FC > 5 |
| Desmoplakin | P15924 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00605473066700933 | FC > 5 |
| Desmoplakin | P15924 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.00331968023109822 | FC > 5 |
| Desmoplakin | P15924 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.00158195576199744 | FC > 5 |
| Desmoplakin | P15924 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000765098775143216 | FC > 5 |
| Desmoplakin | P15924 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0585910521781797 | . |
| Desmoplakin | P15924 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0243019483395615 | . |
| Desmoplakin | P15924 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00605473066700933 | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.03076815590383e-05 | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.7103807052171e-05 | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000115488397915965 | . |
| Deubiquitinating enzyme FAF-X | Q93008 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Deubiquitinating enzyme FAF-X | Q93008 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Deubiquitinating enzyme FAF-X | Q93008 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Diacylglycerol O-acyltransferase 1 | O75907 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Diacylglycerol O-acyltransferase 1 | O75907 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Digestive organ expansion factor homolog | Q68CQ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Digestive organ expansion factor homolog | Q68CQ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Digestive organ expansion factor homolog | Q68CQ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Dihydrolipoyl dehydrogenase | P09622 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.895527931015055 | . |
| Dihydrolipoyl dehydrogenase | P09622 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.400997628357305 | . |
| Dihydrolipoyl dehydrogenase | P09622 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.186190021359119 | . |
| Dihydropyrimidinase-related protein 2 | Q16555 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0236859356706606 | . |
| Dihydropyrimidinase-related protein 2 | Q16555 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Diphosphoinositol pentakisphosphate kinase 2 | O43314 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Diphosphoinositol pentakisphosphate kinase 2 | O43314 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Disabled homolog 2 | P98082 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Disabled homolog 2 | P98082 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Disabled homolog 2 | P98082 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Disco-interacting protein 2 homolog B | Q9P265 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Disco-interacting protein 2 homolog B | Q9P265 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Disco-interacting protein 2 homolog B | Q9P265 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Disks large homolog 5 | Q8TDM6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Disks large homolog 5 | Q8TDM6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Disks large homolog 5 | Q8TDM6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Disks large-associated protein 5 | Q15398 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Disks large-associated protein 5 | Q15398 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Disks large-associated protein 5 | Q15398 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA (cytosine-5)-methyltransferase 1 | P26358 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0268134935243223 | . |
| DNA (cytosine-5)-methyltransferase 1 | P26358 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00761101107803512 | . |
| DNA (cytosine-5)-methyltransferase 1 | P26358 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000604932912285388 | . |
| DNA damage-binding protein 1 | Q16531 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00420481384304526 | . |
| DNA damage-binding protein 1 | Q16531 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0037858821205578 | . |
| DNA damage-binding protein 1 | Q16531 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00217861420021124 | . |
| DNA damage-binding protein 2 | Q92466 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.939040323989992 | . |
| DNA damage-binding protein 2 | Q92466 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.577096540664317 | . |
| DNA damage-binding protein 2 | Q92466 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.400491789236025 | . |
| DNA dC->dU-editing enzyme APOBEC-3B | Q9UH17 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA excision repair protein ERCC-6-like | Q2NKX8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA excision repair protein ERCC-6-like | Q2NKX8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA excision repair protein ERCC-6-like | Q2NKX8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA ligase 3 | P49916 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA ligase 3 | P49916 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA ligase 3 | P49916 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA mismatch repair protein Mlh1 | P40692 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA mismatch repair protein Mlh1 | P40692 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA mismatch repair protein Mlh1 | P40692 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA mismatch repair protein Msh2 | P43246 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA mismatch repair protein Msh2 | P43246 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA mismatch repair protein Msh2 | P43246 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA mismatch repair protein Msh3 | P20585 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA mismatch repair protein Msh3 | P20585 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA mismatch repair protein Msh3 | P20585 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA mismatch repair protein Msh6 | P52701 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.67996103140452e-05 | . |
| DNA mismatch repair protein Msh6 | P52701 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000127301136415127 | . |
| DNA mismatch repair protein Msh6 | P52701 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000102470550885902 | . |
| DNA polymerase alpha catalytic subunit | P09884 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA polymerase alpha catalytic subunit | P09884 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA polymerase alpha catalytic subunit | P09884 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA polymerase delta catalytic subunit | P28340 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0896858621081466 | . |
| DNA polymerase delta catalytic subunit | P28340 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0768237459905137 | . |
| DNA polymerase delta catalytic subunit | P28340 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.041191522540757 | . |
| DNA polymerase delta subunit 3 | Q15054 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA polymerase delta subunit 3 | Q15054 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA polymerase delta subunit 3 | Q15054 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA polymerase epsilon catalytic subunit A | Q07864 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA polymerase epsilon catalytic subunit A | Q07864 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA polymerase epsilon catalytic subunit A | Q07864 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA repair endonuclease XPF | Q92889 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA repair endonuclease XPF | Q92889 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA repair endonuclease XPF | Q92889 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA repair protein complementing XP-C cells | Q01831 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA repair protein complementing XP-C cells | Q01831 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA repair protein complementing XP-C cells | Q01831 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA repair protein RAD50 | Q92878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA repair protein RAD50 | Q92878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA repair protein RAD50 | Q92878 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA replication licensing factor MCM3 | P25205 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0517215523935615 | . |
| DNA replication licensing factor MCM3 | P25205 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0192523502257689 | . |
| DNA replication licensing factor MCM3 | P25205 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.017438130620772 | . |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA replication licensing factor MCM5 | P33992 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.95439590220963e-05 | . |
| DNA replication licensing factor MCM5 | P33992 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.77894823112904e-05 | . |
| DNA replication licensing factor MCM5 | P33992 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.94487508973462e-05 | . |
| DNA replication licensing factor MCM7 | P33993 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0343033939934296 | . |
| DNA replication licensing factor MCM7 | P33993 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00930856255582956 | . |
| DNA replication licensing factor MCM7 | P33993 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00861305345367747 | . |
| DNA topoisomerase 1 | P11387 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.15975154190082 | . |
| DNA topoisomerase 1 | P11387 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0536614125488371 | . |
| DNA topoisomerase 1 | P11387 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA topoisomerase 2-alpha | P11388 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 8.87882831114807e-05 | . |
| DNA topoisomerase 2-alpha | P11388 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.14283600024559e-05 | . |
| DNA topoisomerase 2-alpha | P11388 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.98255771882961e-05 | . |
| DNA topoisomerase 2-beta | Q02880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 7.45888288118149e-05 | . |
| DNA topoisomerase 2-beta | Q02880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.40646055282218e-05 | . |
| DNA topoisomerase 2-beta | Q02880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.54168713041363e-05 | . |
| DNA topoisomerase 2-binding protein 1 | Q92547 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA topoisomerase 3-alpha | Q13472 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.682334656820761 | . |
| DNA topoisomerase 3-alpha | Q13472 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.231441313138982 | . |
| DNA topoisomerase 3-alpha | Q13472 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0541344302281438 | . |
| DNA-binding protein R kappa-B | Q6P4R8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA-binding protein R kappa-B | Q6P4R8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA-binding protein R kappa-B | Q6P4R8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA-binding protein SMUBP-2 | P38935 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA-binding protein SMUBP-2 | P38935 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA-binding protein SMUBP-2 | P38935 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 9.40713263693118e-05 | . |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000475675297551367 | . |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00021429712688954 | . |
| DNA-directed RNA polymerase | O00411 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA-directed RNA polymerase | O00411 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA-directed RNA polymerase | O00411 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA-directed RNA polymerase I subunit RPA1 | O95602 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00522350524451929 | . |
| DNA-directed RNA polymerase I subunit RPA1 | O95602 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA-directed RNA polymerase I subunit RPA1 | O95602 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA-directed RNA polymerase I subunit RPA2 | Q9H9Y6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA-directed RNA polymerase I subunit RPA2 | Q9H9Y6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA-directed RNA polymerase I subunit RPA2 | Q9H9Y6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA-directed RNA polymerase II subunit RPB1 | P24928 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0156344840307585 | . |
| DNA-directed RNA polymerase II subunit RPB1 | P24928 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00574940016569806 | . |
| DNA-directed RNA polymerase II subunit RPB1 | P24928 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00380295852246222 | . |
| DNA-directed RNA polymerase II subunit RPB2 | P30876 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.26855106175367e-05 | . |
| DNA-directed RNA polymerase II subunit RPB2 | P30876 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000265662804426044 | . |
| DNA-directed RNA polymerase II subunit RPB2 | P30876 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000244635743279706 | . |
| DNA-directed RNA polymerase III subunit RPC1 | O14802 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA-directed RNA polymerase III subunit RPC1 | O14802 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA-directed RNA polymerase III subunit RPC1 | O14802 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DNA-directed RNA polymerase III subunit RPC2 | Q9NW08 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DNA-directed RNA polymerase III subunit RPC2 | Q9NW08 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DNA-directed RNA polymerase III subunit RPC2 | Q9NW08 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DnaJ homolog subfamily A member 1 | P31689 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DnaJ homolog subfamily A member 1 | P31689 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DnaJ homolog subfamily C member 10 | Q8IXB1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DnaJ homolog subfamily C member 10 | Q8IXB1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DnaJ homolog subfamily C member 10 | Q8IXB1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DnaJ homolog subfamily C member 11 | Q9NVH1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0503725200341782 | . |
| DnaJ homolog subfamily C member 11 | Q9NVH1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0484105357170543 | . |
| DnaJ homolog subfamily C member 11 | Q9NVH1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0411136944922006 | . |
| DnaJ homolog subfamily C member 13 | O75165 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DnaJ homolog subfamily C member 13 | O75165 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DnaJ homolog subfamily C member 13 | O75165 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| DnaJ homolog subfamily C member 16 | Q9Y2G8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| DnaJ homolog subfamily C member 16 | Q9Y2G8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| DnaJ homolog subfamily C member 16 | Q9Y2G8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Double-strand break repair protein MRE11 | P49959 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Double-strand break repair protein MRE11 | P49959 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Double-strand break repair protein MRE11 | P49959 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Double-stranded RNA-binding protein Staufen homolog 1 | O95793 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Double-stranded RNA-binding protein Staufen homolog 1 | O95793 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Double-stranded RNA-binding protein Staufen homolog 1 | O95793 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Double-stranded RNA-binding protein Staufen homolog 2 | Q9NUL3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Double-stranded RNA-binding protein Staufen homolog 2 | Q9NUL3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Double-stranded RNA-binding protein Staufen homolog 2 | Q9NUL3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Dynactin subunit 4 | Q9UJW0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Dynactin subunit 4 | Q9UJW0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Dynactin subunit 4 | Q9UJW0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Dynamin-1 | Q05193 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00854954178079987 | . |
| Dynamin-1 | Q05193 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00388214850317251 | . |
| Dynamin-1 | Q05193 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000232469147661267 | . |
| Dynamin-1-like protein | O00429 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Dynamin-1-like protein | O00429 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Dynamin-1-like protein | O00429 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Dynamin-2 | P50570 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Dynamin-2 | P50570 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Dynamin-2 | P50570 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Dynamin-binding protein | Q6XZF7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Dynamin-binding protein | Q6XZF7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Dystonin | Q03001 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.819270629417131 | . |
| Dystonin | Q03001 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0775775928817162 | . |
| Dystonin | Q03001 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.03418237772773 | . |
| E1A-binding protein p400 | Q96L91 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E1A-binding protein p400 | Q96L91 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E1A-binding protein p400 | Q96L91 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.109062832567883 | . |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0932647701346909 | . |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0540711342378197 | . |
| E3 SUMO-protein ligase RanBP2 | P49792 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.039827048289155 | . |
| E3 SUMO-protein ligase RanBP2 | P49792 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 SUMO-protein ligase RanBP2 | P49792 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| E3 ubiquitin-protein ligase AMFR | Q9UKV5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase DTX3L | Q8TDB6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase DTX3L | Q8TDB6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 ubiquitin-protein ligase DTX3L | Q8TDB6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| E3 ubiquitin-protein ligase HECTD1 | Q9ULT8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00714622218062454 | . |
| E3 ubiquitin-protein ligase HECTD1 | Q9ULT8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00633398943870404 | . |
| E3 ubiquitin-protein ligase HECTD1 | Q9ULT8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00620223280618134 | . |
| E3 ubiquitin-protein ligase HERC2 | O95714 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase HUWE1 | Q7Z6Z7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0128037331545206 | . |
| E3 ubiquitin-protein ligase HUWE1 | Q7Z6Z7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00756782475587123 | . |
| E3 ubiquitin-protein ligase HUWE1 | Q7Z6Z7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00643397048595272 | . |
| E3 ubiquitin-protein ligase listerin | O94822 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0408845852237639 | . |
| E3 ubiquitin-protein ligase listerin | O94822 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0215208396238592 | . |
| E3 ubiquitin-protein ligase listerin | O94822 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0081812925860313 | . |
| E3 ubiquitin-protein ligase NEDD4 | P46934 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase NEDD4 | P46934 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 ubiquitin-protein ligase NEDD4 | P46934 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| E3 ubiquitin-protein ligase RBBP6 | Q7Z6E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase RBBP6 | Q7Z6E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 ubiquitin-protein ligase RBBP6 | Q7Z6E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| E3 ubiquitin-protein ligase RNF213 | Q63HN8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase RNF213 | Q63HN8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 ubiquitin-protein ligase RNF213 | Q63HN8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| E3 ubiquitin-protein ligase SHPRH | Q149N8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 ubiquitin-protein ligase SHPRH | Q149N8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| E3 ubiquitin-protein ligase TRIM22 | Q8IYM9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase TRIM22 | Q8IYM9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 ubiquitin-protein ligase TRIM22 | Q8IYM9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| E3 ubiquitin-protein ligase TRIP12 | Q14669 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0323475777049909 | . |
| E3 ubiquitin-protein ligase TRIP12 | Q14669 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase TRIP12 | Q14669 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 ubiquitin-protein ligase UBR1 | Q8IWV7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase UBR2 | Q8IWV8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase UBR2 | Q8IWV8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 ubiquitin-protein ligase UBR4 | Q5T4S7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0162623714828644 | . |
| E3 ubiquitin-protein ligase UBR4 | Q5T4S7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0153803826468703 | . |
| E3 ubiquitin-protein ligase UBR4 | Q5T4S7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0110762863794159 | . |
| E3 ubiquitin-protein ligase UBR5 | O95071 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.105835025511772 | . |
| E3 ubiquitin-protein ligase UBR5 | O95071 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0488412782994651 | . |
| E3 ubiquitin-protein ligase UBR5 | O95071 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00617366085842304 | . |
| E3 ubiquitin-protein ligase UHRF1 | Q96T88 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase UHRF1 | Q96T88 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 ubiquitin-protein ligase UHRF1 | Q96T88 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| E3 ubiquitin-protein ligase ZNF598 | Q86UK7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| E3 ubiquitin-protein ligase ZNF598 | Q86UK7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| E3 ubiquitin-protein ligase ZNF598 | Q86UK7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| E3 ubiquitin/ISG15 ligase TRIM25 | Q14258 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0268040614872936 | . |
| E3 ubiquitin/ISG15 ligase TRIM25 | Q14258 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00755216175570199 | . |
| E3 ubiquitin/ISG15 ligase TRIM25 | Q14258 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00243602699079637 | . |
| EH domain-binding protein 1 | Q8NDI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| EH domain-binding protein 1 | Q8NDI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| EH domain-binding protein 1 | Q8NDI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| EH domain-binding protein 1-like protein 1 | Q8N3D4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000192193715572864 | . |
| EH domain-binding protein 1-like protein 1 | Q8N3D4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000166367048393223 | . |
| EH domain-binding protein 1-like protein 1 | Q8N3D4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000162148013503583 | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| eIF-2-alpha kinase activator GCN1 | Q92616 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 7.10826277906079e-05 | . |
| eIF-2-alpha kinase activator GCN1 | Q92616 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00019756764694535 | . |
| eIF-2-alpha kinase activator GCN1 | Q92616 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000123200793158395 | . |
| eIF-2-alpha kinase GCN2 | Q9P2K8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| eIF-2-alpha kinase GCN2 | Q9P2K8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| eIF-2-alpha kinase GCN2 | Q9P2K8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.0274511328903647 | FC > 5 |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.0194058476336753 | FC > 5 |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.016564125351617 | FC > 5 |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.0114111106747407 | FC > 5 |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.00781236821723218 | FC > 5 |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000758123870694485 | FC > 5 |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.016564125351617 | . |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0114111106747407 | . |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000758123870694485 | . |
| eIF-4-gamma 3 | O43432 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00735453853125018 | . |
| eIF-4-gamma 3 | O43432 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00401619019149113 | . |
| eIF-4-gamma 3 | O43432 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00305130539369965 | . |
| eIF3a | Q14152 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.58674760346654e-05 | . |
| eIF3a | Q14152 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.75287017591493e-05 | . |
| eIF3a | Q14152 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0007170318828035 | . |
| eIF3d | O15371 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| eIF3d | O15371 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| eIF3d | O15371 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| eIF3g | O75821 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0225200444701979 | . |
| eIF3g | O75821 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00356831348442219 | . |
| eIF3g | O75821 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00284609696691247 | . |
| eIF3h | O15372 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| eIF3h | O15372 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ELAV-like protein 1 | Q15717 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ELAV-like protein 1 | Q15717 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ELM2 and SANT domain-containing protein 1 | Q6PJG2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0664330443218685 | . |
| ELM2 and SANT domain-containing protein 1 | Q6PJG2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0135955201345594 | . |
| ELM2 and SANT domain-containing protein 1 | Q6PJG2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00392509670458565 | . |
| Elongation factor 1-alpha 2 | Q05639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.37652408016467e-05 | . |
| Elongation factor 1-alpha 2 | Q05639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.84943339999847e-05 | . |
| Elongation factor 1-alpha 2 | Q05639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000111758875302735 | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00218717334116256 | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00136300719635549 | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000763565743491981 | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 7.39495366501613e-05 | FC > 5 |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 6.83245363161819e-05 | FC > 5 |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 5.86280941377418e-06 | FC > 5 |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 4.15534314611995e-05 | FC > 5 |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 4.07231455796689e-05 | FC > 5 |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 2.83960649238957e-06 | FC > 5 |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.39495366501613e-05 | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.83245363161819e-05 | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 4.15534314611995e-05 | . |
| Elongation factor Tu | P49411 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000165772815646925 | . |
| Elongation factor Tu | P49411 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000140360320534022 | . |
| Elongation factor Tu | P49411 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000101308128081607 | . |
| Elongation factor-like GTPase 1 | Q7Z2Z2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0576369702658947 | . |
| Elongation factor-like GTPase 1 | Q7Z2Z2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0565792785778158 | . |
| Elongation factor-like GTPase 1 | Q7Z2Z2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0308177223993221 | . |
| Elongator complex protein 1 | O95163 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Elongator complex protein 1 | O95163 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Elongator complex protein 1 | O95163 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Elongator complex protein 2 | Q6IA86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Elongator complex protein 3 | Q9H9T3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Elongator complex protein 3 | Q9H9T3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Elongator complex protein 3 | Q9H9T3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Elongin-A | Q14241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Elongin-A | Q14241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Elongin-A | Q14241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| EMAP-4 | Q9HC35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| EMAP-4 | Q9HC35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| EMAP-4 | Q9HC35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Endoplasmic reticulum aminopeptidase 1 | Q9NZ08 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Endoplasmic reticulum aminopeptidase 1 | Q9NZ08 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Endoplasmin | P14625 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Endoplasmin | P14625 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Enhancer of mRNA-decapping protein 4 | Q6P2E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.721672958909964 | . |
| Enhancer of mRNA-decapping protein 4 | Q6P2E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.627158580862099 | . |
| Enhancer of mRNA-decapping protein 4 | Q6P2E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.257727908655625 | . |
| Epiplakin | P58107 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Epiplakin | P58107 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Epiplakin | P58107 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Equilibrative nucleoside transporter 1 | Q99808 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Equilibrative nucleoside transporter 1 | Q99808 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ER membrane protein complex subunit 1 | Q8N766 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0475138447531188 | . |
| ER membrane protein complex subunit 1 | Q8N766 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0217662386210909 | . |
| ER membrane protein complex subunit 1 | Q8N766 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00204367773357189 | . |
| Erbin | Q96RT1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Erbin | Q96RT1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Erbin | Q96RT1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ESF1 homolog | Q9H501 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ESF1 homolog | Q9H501 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ESF1 homolog | Q9H501 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Estradiol 17-beta-dehydrogenase 11 | Q8NBQ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Estradiol 17-beta-dehydrogenase 11 | Q8NBQ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Estradiol 17-beta-dehydrogenase 11 | Q8NBQ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Estrogen receptor-binding protein | Q5QJE6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Estrogen receptor-binding protein | Q5QJE6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Estrogen receptor-binding protein | Q5QJE6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ethanolaminephosphotransferase 1 | Q9C0D9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ethanolaminephosphotransferase 1 | Q9C0D9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Eukaryotic translation initiation factor 2A | Q9BY44 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000661482485592646 | . |
| Eukaryotic translation initiation factor 2A | Q9BY44 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000408435467505758 | . |
| Eukaryotic translation initiation factor 2A | Q9BY44 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00024740696506483 | . |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Eukaryotic translation initiation factor 5B | O60841 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.28129294471666e-05 | . |
| Eukaryotic translation initiation factor 5B | O60841 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.5881894391329e-05 | . |
| Eukaryotic translation initiation factor 5B | O60841 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0148391120495295 | . |
| Exocyst complex component 4 | Q96A65 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Exocyst complex component 4 | Q96A65 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Exocyst complex component 4 | Q96A65 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Exosome complex component RRP45 | Q06265 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Exosome complex component RRP45 | Q06265 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Exosome complex component RRP45 | Q06265 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Exosome complex exonuclease RRP44 | Q9Y2L1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.44164682265088e-06 | . |
| Exosome complex exonuclease RRP44 | Q9Y2L1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 2.63703411443133e-05 | . |
| Exosome complex exonuclease RRP44 | Q9Y2L1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 1.41309411164249e-05 | . |
| Exosome component 10 | Q01780 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0363370747406178 | . |
| Exosome component 10 | Q01780 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0164521686689467 | . |
| Exosome component 10 | Q01780 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00544198248289083 | . |
| Exosome RNA helicase MTR4 | P42285 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0217993979824162 | . |
| Exosome RNA helicase MTR4 | P42285 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0178146785494793 | . |
| Exosome RNA helicase MTR4 | P42285 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00358279612892356 | . |
| Exportin-1 | O14980 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Exportin-1 | O14980 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Exportin-1 | O14980 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Exportin-5 | Q9HAV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Exportin-5 | Q9HAV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Exportin-5 | Q9HAV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Extended synaptotagmin-1 | Q9BSJ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.5105563024994e-05 | . |
| Extended synaptotagmin-1 | Q9BSJ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.7414586779776e-05 | . |
| Extended synaptotagmin-1 | Q9BSJ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.86366728511986e-05 | . |
| Extended synaptotagmin-2 | A0FGR8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.8427345415487e-05 | . |
| Extended synaptotagmin-2 | A0FGR8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00040016520869838 | . |
| Extended synaptotagmin-2 | A0FGR8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000135754591959982 | . |
| Ezrin | P15311 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00746021975125948 | . |
| Ezrin | P15311 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0051437698244726 | . |
| Ezrin | P15311 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00485822049639339 | . |
| F-actin-capping protein subunit beta | P47756 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | . | FC > 5 |
| F-actin-capping protein subunit beta | P47756 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | . | FC > 5 |
| F-actin-capping protein subunit beta | P47756 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | . | FC > 5 |
| F-actin-capping protein subunit beta | P47756 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| F-actin-capping protein subunit beta | P47756 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| F-actin-uncapping protein RLTPR | Q6F5E8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| F-actin-uncapping protein RLTPR | Q6F5E8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| F-box only protein 7 | Q9Y3I1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| F-box only protein 7 | Q9Y3I1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| F-box only protein 7 | Q9Y3I1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| FACT complex subunit SPT16 | Q9Y5B9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.52488604989154e-05 | . |
| FACT complex subunit SPT16 | Q9Y5B9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.01662965734686e-05 | . |
| FACT complex subunit SPT16 | Q9Y5B9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.63026710144318e-05 | . |
| FACT complex subunit SSRP1 | Q08945 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00069620390645934 | . |
| FACT complex subunit SSRP1 | Q08945 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000567645152394831 | . |
| FACT complex subunit SSRP1 | Q08945 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000218703365152799 | . |
| Factor for adipocyte differentiation 104 | Q53EP0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Factor for adipocyte differentiation 104 | Q53EP0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Factor for adipocyte differentiation 104 | Q53EP0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Fanconi anemia group I protein | Q9NVI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Fanconi anemia group I protein | Q9NVI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Fanconi anemia group I protein | Q9NVI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Fascin | Q16658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 8.91872722529464e-05 | FC > 5 |
| Fascin | Q16658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 7.59060235547015e-06 | FC > 5 |
| Fascin | Q16658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 5.19721414960352e-05 | FC > 5 |
| Fascin | Q16658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 5.1168580087714e-06 | FC > 5 |
| Fascin | Q16658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 4.16320586869065e-05 | FC > 5 |
| Fascin | Q16658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 3.35508583706847e-05 | FC > 5 |
| Fascin | Q16658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.91872722529464e-05 | . |
| Fascin | Q16658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.19721414960352e-05 | . |
| Fascin | Q16658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.16320586869065e-05 | . |
| FAST kinase domain-containing protein 2 | Q9NYY8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| FAST kinase domain-containing protein 2 | Q9NYY8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| FAST kinase domain-containing protein 2 | Q9NYY8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Fatty acid CoA ligase Acsl3 | O95573 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Fatty acid CoA ligase Acsl3 | O95573 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Fatty acid CoA ligase Acsl3 | O95573 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Fatty acid synthase | P49327 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000703850743054949 | . |
| Fatty acid synthase | P49327 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000366430220655421 | . |
| Fatty acid synthase | P49327 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000118602985343339 | . |
| Felix-ina | Q7Z2K6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Felix-ina | Q7Z2K6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Fermitin family homolog 2 | Q96AC1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.4269149568929e-05 | . |
| Fermitin family homolog 2 | Q96AC1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000169848786695257 | . |
| Fermitin family homolog 2 | Q96AC1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000130274836880966 | . |
| FH1/FH2 domain-containing protein 1 | Q9Y613 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.417290318047848 | . |
| FH1/FH2 domain-containing protein 1 | Q9Y613 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.22761876059302 | . |
| FH1/FH2 domain-containing protein 1 | Q9Y613 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0473761258889966 | . |
| Fibronectin | P02751 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00193745791438365 | . |
| Fibronectin | P02751 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00164306817040328 | . |
| Fibronectin | P02751 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000654362393813809 | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00177486227870543 | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00156577096134126 | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000304660195756064 | . |
| Filamin-B | O75369 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0012678281790855 | . |
| Filamin-B | O75369 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000895622267239891 | . |
| Filamin-B | O75369 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000294985974109818 | . |
| Filamin-C | Q14315 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00243357098295022 | . |
| Filamin-C | Q14315 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00136738142461779 | . |
| Filamin-C | Q14315 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000501995734507337 | . |
| FK506-binding protein 15 | Q5T1M5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| FK506-binding protein 15 | Q5T1M5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| FK506-binding protein 15 | Q5T1M5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Flavoprotein subunit of complex II | P31040 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.285517640398374 | . |
| Flavoprotein subunit of complex II | P31040 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0153043861628991 | . |
| Flotillin-1 | O75955 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Flotillin-1 | O75955 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Focadhesin | Q5VW36 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Focadhesin | Q5VW36 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Focadhesin | Q5VW36 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Focal adhesion kinase 1 | Q05397 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00241809784187763 | . |
| Focal adhesion kinase 1 | Q05397 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00127761489375071 | . |
| Focal adhesion kinase 1 | Q05397 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000943319181411703 | . |
| Forkhead box protein K1 | P85037 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Forkhead box protein K1 | P85037 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Forkhead box protein K1 | P85037 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Forkhead box protein K2 | Q01167 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0248571506470872 | . |
| Forkhead box protein K2 | Q01167 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0124898647712385 | . |
| Forkhead box protein K2 | Q01167 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00767777744257508 | . |
| Formyltetrahydrofolate synthetase | Q6UB35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.013540144081795 | . |
| Formyltetrahydrofolate synthetase | Q6UB35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00342507164839494 | . |
| Formyltetrahydrofolate synthetase | Q6UB35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00110954386897402 | . |
| Four and a half LIM domains protein 1 | Q13642 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Four and a half LIM domains protein 1 | Q13642 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Fragile X messenger ribonucleoprotein 1 | Q06787 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Fragile X messenger ribonucleoprotein 1 | Q06787 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Fragile X messenger ribonucleoprotein 1 | Q06787 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Fructose-bisphosphate aldolase A | P04075 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00403457435234875 | . |
| Fructose-bisphosphate aldolase A | P04075 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00372795816377847 | . |
| Fructose-bisphosphate aldolase A | P04075 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000769493596440353 | . |
| G2 and S phase-expressed protein 1 | Q9NYZ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| G2 and S phase-expressed protein 1 | Q9NYZ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| G2 and S phase-expressed protein 1 | Q9NYZ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Gamma-adducin | Q9UEY8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00126158488173793 | . |
| Gamma-adducin | Q9UEY8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00040350675008478 | . |
| Gamma-adducin | Q9UEY8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000228165079231366 | . |
| Gamma-glutamylcyclotransferase | O75223 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0949939287119592 | . |
| Gamma-glutamylcyclotransferase | O75223 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0753423833372651 | . |
| Gamma-glutamylcyclotransferase | O75223 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Gamma-interferon-inducible protein 16 | Q16666 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.5541249511093e-05 | . |
| Gamma-interferon-inducible protein 16 | Q16666 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.15965037875508e-05 | . |
| Gamma-interferon-inducible protein 16 | Q16666 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000389065808127617 | . |
| Gamma-tubulin complex component 3 | Q96CW5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Gamma-tubulin complex component 3 | Q96CW5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Gamma-tubulin complex component 6 | Q96RT7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Gamma-tubulin complex component 6 | Q96RT7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| GAPex-5 | Q14C86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| GAPex-5 | Q14C86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| GAPex-5 | Q14C86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Gelsolin | P06396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00239717762123989 | . |
| Gelsolin | P06396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000840915077029799 | . |
| Gelsolin | P06396 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000797417680006529 | . |
| Gem-associated protein 5 | Q8TEQ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Gem-associated protein 5 | Q8TEQ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Gem-associated protein 5 | Q8TEQ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| General transcription factor 3C polypeptide 1 | Q12789 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| General transcription factor 3C polypeptide 1 | Q12789 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| General transcription factor 3C polypeptide 1 | Q12789 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| General transcription factor 3C polypeptide 2 | Q8WUA4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| General transcription factor 3C polypeptide 2 | Q8WUA4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| General transcription factor 3C polypeptide 2 | Q8WUA4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| General transcription factor 3C polypeptide 3 | Q9Y5Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0576509988535676 | . |
| General transcription factor 3C polypeptide 3 | Q9Y5Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0315931662434134 | . |
| General transcription factor 3C polypeptide 3 | Q9Y5Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0255711428296221 | . |
| General transcription factor 3C polypeptide 4 | Q9UKN8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| General transcription factor 3C polypeptide 4 | Q9UKN8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| General transcription factor 3C polypeptide 4 | Q9UKN8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Genetic suppressor element 1 | Q14687 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0464238300829805 | . |
| Genetic suppressor element 1 | Q14687 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0142901798059452 | . |
| Genetic suppressor element 1 | Q14687 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00241763380476228 | . |
| Gephyrin | Q9NQX3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0249145533785014 | . |
| Gephyrin | Q9NQX3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0100611150456469 | . |
| Gephyrin | Q9NQX3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00165124720869084 | . |
| Girdin | Q3V6T2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Girdin | Q3V6T2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Girdin | Q3V6T2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Glucose-6-phosphate 1-dehydrogenase | P11413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 9.76370263177603e-05 | . |
| Glucose-6-phosphate 1-dehydrogenase | P11413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000157601739131388 | . |
| Glucose-6-phosphate 1-dehydrogenase | P11413 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000102704273329155 | . |
| GLUT-1 | P11166 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.55970951382886e-05 | . |
| GLUT-1 | P11166 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.37075009907851e-05 | . |
| GLUT-1 | P11166 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000103952892486995 | . |
| Glutamate dehydrogenase 1 | P00367 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Glutamate dehydrogenase 1 | P00367 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Glutamate dehydrogenase 1 | P00367 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Glutamine and serine-rich protein 1 | Q2KHR3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0152042252805673 | . |
| Glutamine and serine-rich protein 1 | Q2KHR3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0050344165891397 | . |
| Glutamine and serine-rich protein 1 | Q2KHR3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000880407230241371 | . |
| Glutamine--tRNA ligase | P47897 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00110881323863263 | . |
| Glutamine--tRNA ligase | P47897 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00053963062708952 | . |
| Glutamine--tRNA ligase | P47897 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000206447970556115 | . |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 4.86653788828674e-05 | FC > 5 |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 2.17023544838545e-05 | FC > 5 |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 1.1085375574284e-05 | FC > 5 |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000286886502153927 | FC > 5 |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00025859543052483 | FC > 5 |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000235066177378662 | FC > 5 |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000286886502153927 | . |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00025859543052483 | . |
| Glyceraldehyde-3-phosphate dehydrogenase | P04406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000235066177378662 | . |
| Glycerol-3-phosphate acyltransferase 4 | Q86UL3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Glycerol-3-phosphate acyltransferase 4 | Q86UL3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Glycinamide ribonucleotide synthetase | P22102 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000674309099834951 | . |
| Glycinamide ribonucleotide synthetase | P22102 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000535971748602912 | . |
| Glycinamide ribonucleotide synthetase | P22102 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000180743214265607 | . |
| Glycine--tRNA ligase | P41250 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Glycine--tRNA ligase | P41250 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Glycine--tRNA ligase | P41250 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Glycogen debranching enzyme | P35573 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Glycogen debranching enzyme | P35573 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Glycogen debranching enzyme | P35573 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Glycogen phosphorylase | P11216 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Glycogen phosphorylase | P06737 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Glycogen phosphorylase | P11216 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Glycogen phosphorylase | P06737 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Glycogen phosphorylase | P11216 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Glycogen phosphorylase | P06737 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Glycogenin-1 | P46976 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.600878546621052 | . |
| Glycogenin-1 | P46976 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.404359700289336 | . |
| Glycogenin-1 | P46976 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0210186452571326 | . |
| Glycylpeptide N-tetradecanoyltransferase 1 | P30419 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Glycylpeptide N-tetradecanoyltransferase 1 | P30419 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Glycylpeptide N-tetradecanoyltransferase 1 | P30419 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| GMP synthase [glutamine-hydrolyzing] | P49915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| GMP synthase [glutamine-hydrolyzing] | P49915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| GMP synthase [glutamine-hydrolyzing] | P49915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Golgin subfamily B member 1 | Q14789 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Golgin subfamily B member 1 | Q14789 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Golgin subfamily B member 1 | Q14789 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| GPI transamidase component PIG-T | Q969N2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| GPI transamidase component PIG-T | Q969N2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| GPI transamidase component PIG-T | Q969N2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| GPI-anchor transamidase | Q92643 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00873070764288375 | . |
| GPI-anchor transamidase | Q92643 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000483807801947086 | . |
| GPI-anchor transamidase | Q92643 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000250550724822202 | . |
| GRB10-interacting GYF protein 2 | Q6Y7W6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| GRB10-interacting GYF protein 2 | Q6Y7W6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| GRB10-interacting GYF protein 2 | Q6Y7W6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| GRIN1 | Q7Z2K8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| GRIN1 | Q7Z2K8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| GRIN1 | Q7Z2K8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Growth hormone-inducible transmembrane protein | Q9H3K2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00650706344037911 | . |
| Growth hormone-inducible transmembrane protein | Q9H3K2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0012808204184277 | . |
| Growth hormone-inducible transmembrane protein | Q9H3K2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000969676055333107 | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 8.00122982333966e-05 | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.11169519428595e-05 | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000112513547229938 | . |
| GTP-binding protein 1 | O00178 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.713313044381165 | . |
| GTP-binding protein 1 | O00178 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.128988680473459 | . |
| GTP-binding protein 1 | O00178 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| GTP-binding protein 4 | Q9BZE4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| GTP-binding protein 4 | Q9BZE4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| GTP-binding protein 4 | Q9BZE4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| GTP-binding protein Rheb | Q15382 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| GTP-binding protein Rheb | Q15382 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| GTP-binding protein Rheb | Q15382 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| GTPase-activating protein ZNF289 | Q8N6H7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.27786635105922e-05 | . |
| GTPase-activating protein ZNF289 | Q8N6H7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000219008724311206 | . |
| GTPase-activating protein ZNF289 | Q8N6H7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000148892155713614 | . |
| Guanine nucleotide-binding protein-like 1 | P36915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Guanine nucleotide-binding protein-like 1 | P36915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Guanine nucleotide-binding protein-like 1 | P36915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Guanine nucleotide-binding protein-like 3 | Q9BVP2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Guanine nucleotide-binding protein-like 3 | Q9BVP2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Guanine nucleotide-binding protein-like 3 | Q9BVP2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| H/ACA ribonucleoprotein complex subunit DKC1 | O60832 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| H/ACA ribonucleoprotein complex subunit DKC1 | O60832 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| H/ACA ribonucleoprotein complex subunit DKC1 | O60832 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| HBS1-like protein | Q9Y450 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.420545375141859 | . |
| HBS1-like protein | Q9Y450 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.169807358309106 | . |
| HBS1-like protein | Q9Y450 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0640586563755807 | . |
| HEAT repeat-containing protein 1 | Q9H583 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000293389126066043 | . |
| HEAT repeat-containing protein 1 | Q9H583 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000291521433960023 | . |
| HEAT repeat-containing protein 1 | Q9H583 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00015681083038946 | . |
| HEAT repeat-containing protein 5B | Q9P2D3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| HEAT repeat-containing protein 5B | Q9P2D3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| HEAT repeat-containing protein 5B | Q9P2D3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| HEAT repeat-containing protein 6 | Q6AI08 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| HEAT repeat-containing protein 6 | Q6AI08 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| HEAT repeat-containing protein 6 | Q6AI08 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0178760485607897 | . |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 5.06942515630168e-05 | FC > 5 |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.0354529174559815 | FC > 5 |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000436694522415725 | FC > 5 |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.000218496774416769 | FC > 5 |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000213949884928564 | FC > 5 |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000165798630338292 | FC > 5 |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0354529174559815 | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000218496774416769 | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000165798630338292 | . |
| Heat shock protein 105 kDa | Q92598 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Heat shock protein 105 kDa | Q92598 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Heat shock protein HSP 90-beta | P08238 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000255823905241925 | . |
| Heat shock protein HSP 90-beta | P08238 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000144710399333444 | . |
| Heat shock protein HSP 90-beta | P08238 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000105805401278393 | . |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0015046215673317 | . |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000443579135585633 | . |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000408597803700832 | . |
| Helicase with zinc finger domain 2 | Q9BYK8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Helicase with zinc finger domain 2 | Q9BYK8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Helicase with zinc finger domain 2 | Q9BYK8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Helicase-like transcription factor | Q14527 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Helicase-like transcription factor | Q14527 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Helicase-like transcription factor | Q14527 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Heterochromatin protein 1-binding protein 3 | Q5SSJ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Heterochromatin protein 1-binding protein 3 | Q5SSJ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Heterochromatin protein 1-binding protein 3 | Q5SSJ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 3.74244901925987e-05 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 1.37990166929173e-05 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 1.37740979918306e-05 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000273736300330395 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00020386267093921 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000180211830083457 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000273736300330395 | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00020386267093921 | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000180211830083457 | . |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 9.51290926567408e-05 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 4.61750784048297e-06 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 1.32323506818706e-05 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000465934104274687 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000341267324446467 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.000277767185008513 | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.51290926567408e-05 | . |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000341267324446467 | . |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000277767185008513 | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | . | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | . | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | . | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | . | FC > 5 |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000251590094295947 | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00012284561136526 | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000118914008500487 | . |
| Heterogeneous nuclear ribonucleoprotein L-like | Q8WVV9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.149842228332088 | . |
| Heterogeneous nuclear ribonucleoprotein L-like | Q8WVV9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0175677663110055 | . |
| Heterogeneous nuclear ribonucleoprotein L-like | Q8WVV9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00241119995055472 | . |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Heterogeneous nuclear ribonucleoprotein R | O43390 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Heterogeneous nuclear ribonucleoprotein R | O43390 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Heterogeneous nuclear ribonucleoprotein R | O43390 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 4.79064750665364e-05 | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.53116145853339e-05 | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.30853451073576e-05 | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00197232163591111 | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000624407934847342 | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000367364709288543 | . |
| Hexokinase-1 | P19367 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00316234759434395 | . |
| Hexokinase-1 | P19367 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00213515573564873 | . |
| Hexokinase-1 | P19367 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00201089883752356 | . |
| Histone acetyltransferase 1 | O14929 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Histone acetyltransferase 1 | O14929 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Histone acetyltransferase p300 | Q09472 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Histone deacetylase 7 | Q8WUI4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Histone deacetylase 7 | Q8WUI4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Histone deacetylase 7 | Q8WUI4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Histone deacetylase complex subunit SAP130 | Q9H0E3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000344522036456557 | . |
| Histone deacetylase complex subunit SAP130 | Q9H0E3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00021275760389808 | . |
| Histone deacetylase complex subunit SAP130 | Q9H0E3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000143162677522751 | . |
| Histone H1.0 | P07305 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Histone H1.0 | P07305 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Histone H1.0 | P07305 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Histone H1.4 | P10412 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Histone H1.4 | P10412 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Histone H1.4 | P10412 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Histone-arginine methyltransferase CARM1 | Q86X55 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Histone-arginine methyltransferase CARM1 | Q86X55 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Histone-arginine methyltransferase CARM1 | Q86X55 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Histone-lysine N-methyltransferase 2A | Q03164 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Histone-lysine N-methyltransferase 2A | Q03164 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Histone-lysine N-methyltransferase 2A | Q03164 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| HIV-1 Rev-binding protein | P52594 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| HIV-1 Rev-binding protein | P52594 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| HIV-1 Rev-binding protein | P52594 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| HIV-1 Vpr-binding ankyrin repeat protein | Q8IWZ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| HIV-1 Vpr-binding ankyrin repeat protein | Q8IWZ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| HIV-1 Vpr-binding ankyrin repeat protein | Q8IWZ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Host cell factor 1 | P51610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.94949633397166e-05 | . |
| Host cell factor 1 | P51610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.56343898899234e-05 | . |
| Host cell factor 1 | P51610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.92788711317585e-05 | . |
| HPK/GCK-like kinase HGK | O95819 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| HPK/GCK-like kinase HGK | O95819 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| HPK/GCK-like kinase HGK | O95819 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Human cervical cancer suppressor gene 4 protein | Q9NYL2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.781144421520697 | . |
| Human cervical cancer suppressor gene 4 protein | Q9NYL2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.254594229958938 | . |
| Human cervical cancer suppressor gene 4 protein | Q9NYL2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0100831134272943 | . |
| Human gene expressed in odontoblasts | Q9Y2H6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Human gene expressed in odontoblasts | Q9Y2H6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Human gene expressed in odontoblasts | Q9Y2H6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Huntingtin | P42858 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Huntingtin | P42858 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Huntingtin | P42858 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| hWALp3 | Q9UIF9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| hWALp3 | Q9UIF9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| hWALp3 | Q9UIF9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ICBP90-binding protein 1 | Q6BDS2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ICBP90-binding protein 1 | Q6BDS2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ICBP90-binding protein 1 | Q6BDS2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| IGF2 mRNA-binding protein 2 | Q9Y6M1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| ILKAP | Q9H0C8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| ILKAP | Q9H0C8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| ILKAP | Q9H0C8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Inactive tyrosine-protein kinase PEAK1 | Q9H792 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Inactive tyrosine-protein kinase PEAK1 | Q9H792 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Inactive tyrosine-protein kinase PEAK1 | Q9H792 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Inner centromere protein | Q9NQS7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Inner centromere protein | Q9NQS7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Inner centromere protein | Q9NQS7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Inner nuclear membrane protein Man1 | Q9Y2U8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0284740626669203 | . |
| Inner nuclear membrane protein Man1 | Q9Y2U8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0237515003091468 | . |
| Inner nuclear membrane protein Man1 | Q9Y2U8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Inositol polyphosphate 5-phosphatase OCRL | Q01968 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Inositol polyphosphate 5-phosphatase OCRL | Q01968 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Inositol polyphosphate 5-phosphatase OCRL | Q01968 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Inositol polyphosphate phosphatase-like protein 1 | O15357 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00499336889138797 | . |
| Inositol polyphosphate phosphatase-like protein 1 | O15357 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00215397966767062 | . |
| Inositol polyphosphate phosphatase-like protein 1 | O15357 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000664541844027312 | . |
| Integrator complex subunit 1 | Q8N201 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Integrator complex subunit 1 | Q8N201 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Integrator complex subunit 1 | Q8N201 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Integrator complex subunit 11 | Q5TA45 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Integrator complex subunit 11 | Q5TA45 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Integrator complex subunit 11 | Q5TA45 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Integrator complex subunit 12 | Q96CB8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.39408701854694e-05 | . |
| Integrator complex subunit 12 | Q96CB8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.17494572011258e-05 | . |
| Integrator complex subunit 12 | Q96CB8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000701118761773645 | . |
| Integrator complex subunit 13 | Q9NVM9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Integrator complex subunit 4 | Q96HW7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Integrator complex subunit 6 | Q9UL03 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Integrator complex subunit 6 | Q9UL03 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Integrator complex subunit 6 | Q9UL03 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Integrator complex subunit 9 | Q9NV88 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Integrator complex subunit 9 | Q9NV88 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Integrator complex subunit 9 | Q9NV88 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Interferon-inducible protein 4 | P55265 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.85276423450182e-05 | . |
| Interferon-inducible protein 4 | P55265 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.19191346565994e-05 | . |
| Interferon-inducible protein 4 | P55265 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000460434660689678 | . |
| Interferon-inducible RNA-dependent protein kinase | P19525 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0109955086492424 | . |
| Interferon-inducible RNA-dependent protein kinase | P19525 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00917918824433828 | . |
| Interferon-inducible RNA-dependent protein kinase | P19525 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000450573174950293 | . |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00033914231669835 | . |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000134796493164294 | . |
| Interleukin-18 | Q14116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Interleukin-18 | Q14116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Interleukin-18 | Q14116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Intermembrane lipid transfer protein VPS13C | Q709C8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Intermembrane lipid transfer protein VPS13C | Q709C8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Intermembrane lipid transfer protein VPS13C | Q709C8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Intersectin-1 | Q15811 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Intersectin-1 | Q15811 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Intersectin-1 | Q15811 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Intersectin-2 | Q9NZM3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Intersectin-2 | Q9NZM3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Inverted formin-2 | Q27J81 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0455233009090802 | . |
| Inverted formin-2 | Q27J81 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0264633616704786 | . |
| Inverted formin-2 | Q27J81 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0219050109090419 | . |
| IQ motif and SEC7 domain-containing protein 1 | Q6DN90 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| IQ motif and SEC7 domain-containing protein 1 | Q6DN90 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| IQ motif and SEC7 domain-containing protein 1 | Q6DN90 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Isoleucine--tRNA ligase | P41252 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.64231567859271e-05 | . |
| Isoleucine--tRNA ligase | P41252 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.65716112294659e-05 | . |
| Isoleucine--tRNA ligase | P41252 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.60340566963363e-05 | . |
| Isoleucine--tRNA ligase | Q9NSE4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Isoleucine--tRNA ligase | Q9NSE4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Isoleucine--tRNA ligase | Q9NSE4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| JNK-interacting protein 4 | O60271 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| JNK-interacting protein 4 | O60271 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Jumonji domain-containing protein 1C | Q15652 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Junction plakoglobin | P14923 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.197184251026089 | FC > 5 |
| Junction plakoglobin | P14923 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.082621688389942 | FC > 5 |
| Junction plakoglobin | P14923 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.0449226118527119 | FC > 5 |
| Junction plakoglobin | P14923 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.0123354388748238 | FC > 5 |
| Junction plakoglobin | P14923 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000413205993114869 | FC > 5 |
| Junction plakoglobin | P14923 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.197184251026089 | . |
| Junction plakoglobin | P14923 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.082621688389942 | . |
| Junction plakoglobin | P14923 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0449226118527119 | . |
| Junction plakoglobin | P14923 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | . | FC > 5 |
| Kanadaptin | Q9BWU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kanadaptin | Q9BWU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kanadaptin | Q9BWU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| KAT8 regulatory NSL complex subunit 1 | Q7Z3B3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| KAT8 regulatory NSL complex subunit 1 | Q7Z3B3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Keratin | P04264 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.94191383425701 | . |
| Keratin | P04264 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.119325795449927 | . |
| Keratin | P04264 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0226221266215821 | . |
| Keratinocyte proline-rich protein | Q5T749 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.648801848723719 | . |
| Keratinocyte proline-rich protein | Q5T749 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.205129964522929 | . |
| Keratinocyte proline-rich protein | Q5T749 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0211334919362573 | . |
| Kinase D-interacting substrate of 220 kDa | Q9ULH0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0106732582801918 | . |
| Kinase D-interacting substrate of 220 kDa | Q9ULH0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00483530788518133 | . |
| Kinase D-interacting substrate of 220 kDa | Q9ULH0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0038812792943468 | . |
| Kinase homologous to SPS1/STE20 | Q9Y4K4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinase homologous to SPS1/STE20 | Q9Y4K4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinase homologous to SPS1/STE20 | Q9Y4K4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Kinectin | Q86UP2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinectin | Q86UP2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinectin | Q86UP2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Kinesin-1 heavy chain | P33176 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 2.04881951139337e-05 | . |
| Kinesin-1 heavy chain | P33176 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000763577008932085 | . |
| Kinesin-1 heavy chain | P33176 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000232262402221052 | . |
| Kinesin-like protein KIF11 | P52732 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinesin-like protein KIF11 | P52732 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinesin-like protein KIF11 | P52732 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Kinesin-like protein KIF13A | Q9H1H9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0437054064203781 | . |
| Kinesin-like protein KIF13A | Q9H1H9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0356970041163053 | . |
| Kinesin-like protein KIF13A | Q9H1H9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0270742243314926 | . |
| Kinesin-like protein KIF13B | Q9NQT8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinesin-like protein KIF13B | Q9NQT8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinesin-like protein KIF13B | Q9NQT8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Kinesin-like protein KIF1B | O60333 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinesin-like protein KIF1B | O60333 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinesin-like protein KIF1B | O60333 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Kinesin-like protein KIF1C | O43896 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinesin-like protein KIF1C | O43896 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinesin-like protein KIF1C | O43896 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Kinesin-like protein KIF20A | O95235 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinesin-like protein KIF20B | Q96Q89 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.15905520347239 | . |
| Kinesin-like protein KIF21A | Q7Z4S6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinesin-like protein KIF21A | Q7Z4S6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinesin-like protein KIF21A | Q7Z4S6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Kinesin-like protein KIF23 | Q02241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000134041533600167 | . |
| Kinesin-like protein KIF23 | Q02241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000117756867011044 | . |
| Kinesin-like protein KIF23 | Q02241 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000109480651333148 | . |
| Kinesin-like protein KIF2C | Q99661 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinesin-like protein KIF2C | Q99661 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinesin-like protein KIF2C | Q99661 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Kinesin-like protein KIF3A | Q9Y496 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinesin-like protein KIF3A | Q9Y496 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinesin-like protein KIF3A | Q9Y496 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Kinesin-like protein KIF3B | O15066 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0641367769219996 | . |
| Kinesin-like protein KIF3B | O15066 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0574610695975038 | . |
| Kinesin-like protein KIF3B | O15066 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.020370092649136 | . |
| Kinesin-like protein KIFC1 | Q9BW19 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinesin-like protein KIFC1 | Q9BW19 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinesin-like protein KIFC1 | Q9BW19 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Kinetochore-associated protein 1 | P50748 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Kinetochore-associated protein 1 | P50748 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Kinetochore-associated protein 1 | P50748 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| L-lactate dehydrogenase A chain | P00338 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.50689033564363e-05 | . |
| L-lactate dehydrogenase A chain | P00338 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.73540564619623e-05 | . |
| L-lactate dehydrogenase A chain | P00338 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000271562742147453 | . |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 6.88107380056313e-06 | FC > 5 |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 3.2284722626082e-06 | FC > 5 |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000484514319325651 | FC > 5 |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.000329296215427353 | FC > 5 |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000124507733541661 | FC > 5 |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000122389996711876 | FC > 5 |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000484514319325651 | . |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000329296215427353 | . |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000124507733541661 | . |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.13038704989762e-05 | . |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 6.75796197147552e-05 | . |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.76044885574135e-05 | . |
| La-related protein 7 | Q4G0J3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| La-related protein 7 | Q4G0J3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Lamin-B1 | P20700 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000165408073786082 | . |
| Lamin-B1 | P20700 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000149812012416547 | . |
| Lamin-B1 | P20700 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000148809124448076 | . |
| Leucine zipper protein 1 | Q86V48 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000796346051159258 | . |
| Leucine zipper protein 1 | Q86V48 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000382667282428019 | . |
| Leucine zipper protein 1 | Q86V48 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000309529743676749 | . |
| Leucine--tRNA ligase | Q9P2J5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.15238153556618e-05 | . |
| Leucine--tRNA ligase | Q9P2J5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.80872831372441e-05 | . |
| Leucine--tRNA ligase | Q9P2J5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.56544185881684e-05 | . |
| Leucine--tRNA ligase | Q15031 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Leucine--tRNA ligase | Q15031 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Leukotriene A-4 hydrolase | P09960 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Leukotriene A-4 hydrolase | P09960 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Leukotriene A-4 hydrolase | P09960 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| LIM and calponin homology domains-containing protein 1 | Q9UPQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0652539908433414 | . |
| LIM and calponin homology domains-containing protein 1 | Q9UPQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00492967417891894 | . |
| LIM and calponin homology domains-containing protein 1 | Q9UPQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00366649593101446 | . |
| LIM domain and actin-binding protein 1 | Q9UHB6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 9.49741126406932e-05 | . |
| LIM domain and actin-binding protein 1 | Q9UHB6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00018241043890506 | . |
| LIM domain and actin-binding protein 1 | Q9UHB6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000109418736176817 | . |
| LIM domain only protein 7 | Q8WWI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000232455339169577 | . |
| LIM domain only protein 7 | Q8WWI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000222596472492178 | . |
| LIM domain only protein 7 | Q8WWI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000215348084738528 | . |
| Lipase maturation factor 2 | Q9BU23 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0109803726455719 | . |
| Lipase maturation factor 2 | Q9BU23 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0091536382824453 | . |
| Lipase maturation factor 2 | Q9BU23 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0078721284308715 | . |
| Lipid scramblase CLPTM1L | Q96KA5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00767328299422581 | . |
| Lipid scramblase CLPTM1L | Q96KA5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00717127430983518 | . |
| Lipid scramblase CLPTM1L | Q96KA5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00372312555943996 | . |
| Lipoma-preferred partner | Q93052 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Lipoma-preferred partner | Q93052 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Lipoma-preferred partner | Q93052 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Liprin-alpha-1 | Q13136 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0234620985497054 | . |
| Liprin-alpha-1 | Q13136 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Liprin-alpha-1 | Q13136 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Lissencephaly-1 protein | P43034 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0114249471145818 | . |
| Lissencephaly-1 protein | P43034 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0105564618918981 | . |
| Lissencephaly-1 protein | P43034 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00109008270685873 | . |
| Long-chain fatty acid transport protein 4 | Q6P1M0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Lysine-rich nucleolar protein 1 | Q1ED39 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Lysine-rich nucleolar protein 1 | Q1ED39 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Lysine-specific demethylase 3B | Q7LBC6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Lysine-specific demethylase 3B | Q7LBC6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Lysine-specific demethylase 3B | Q7LBC6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Lysine-specific demethylase 9 | Q5VWQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Lysine-specific demethylase 9 | Q5VWQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Lysine-specific demethylase PHF2 | O75151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Lysine-specific histone demethylase 1A | O60341 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0125158236637009 | . |
| Lysine-specific histone demethylase 1A | O60341 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0019855976975834 | . |
| Lysine-specific histone demethylase 1A | O60341 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000627652221799649 | . |
| Lysophospholipid acyltransferase 5 | Q6P1A2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00549372618463075 | . |
| Lysophospholipid acyltransferase 5 | Q6P1A2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00338993359668415 | . |
| Lysophospholipid acyltransferase 5 | Q6P1A2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000719914354324543 | . |
| Lysophospholipid acyltransferase 7 | Q96N66 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.48181908169795e-05 | . |
| Lysophospholipid acyltransferase 7 | Q96N66 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.08652549337794e-05 | . |
| Lysophospholipid acyltransferase 7 | Q96N66 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000672376568655299 | . |
| Lysozyme C | P61626 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.779236640495953 | . |
| Lysozyme C | P61626 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.329677524371947 | . |
| Lysozyme C | P61626 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0980781958101731 | . |
| Lysyl hydroxylase 1 | Q02809 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Lysyl hydroxylase 1 | Q02809 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Lysyl hydroxylase 1 | Q02809 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Lysyl hydroxylase 3 | O60568 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Lysyl hydroxylase 3 | O60568 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Lysyl hydroxylase 3 | O60568 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| M-phase phosphoprotein 8 | Q99549 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| M-phase phosphoprotein 8 | Q99549 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| M-phase phosphoprotein 8 | Q99549 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| M2 antigen complex 70 kDa subunit | P10515 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| M2 antigen complex 70 kDa subunit | P10515 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Major vault protein | Q14764 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 8.4969548635605e-05 | . |
| Major vault protein | Q14764 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.65599261622704e-05 | . |
| Major vault protein | Q14764 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.93304504349264e-05 | . |
| Malate dehydrogenase | P40926 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Malate dehydrogenase | P40926 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Malate dehydrogenase | P40926 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Malectin | Q14165 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.119066031730939 | . |
| Malectin | Q14165 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0634773433328883 | . |
| Malectin | Q14165 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0612803092769792 | . |
| Mannose-P-dolichol utilization defect 1 protein | O75352 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Mannose-P-dolichol utilization defect 1 protein | O75352 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Mannosyl-oligosaccharide glucosidase | Q13724 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0146446992321907 | . |
| Mannosyl-oligosaccharide glucosidase | Q13724 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00166141285733107 | . |
| Mannosyl-oligosaccharide glucosidase | Q13724 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00103738115840892 | . |
| MAP three kinase 1 | Q9Y6R4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| MAP three kinase 1 | Q9Y6R4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| MAP three kinase 1 | Q9Y6R4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| MAP7 domain-containing protein 1 | Q3KQU3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| MAP7 domain-containing protein 1 | Q3KQU3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| MAP7 domain-containing protein 1 | Q3KQU3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| MAP7 domain-containing protein 3 | Q8IWC1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Mediator of DNA damage checkpoint protein 1 | Q14676 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000658114228561845 | . |
| Mediator of DNA damage checkpoint protein 1 | Q14676 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000267407249252431 | . |
| Mediator of DNA damage checkpoint protein 1 | Q14676 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000242311569145645 | . |
| Melanoma-associated antigen D2 | Q9UNF1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Merlin | P35240 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0291621978210196 | . |
| Merlin | P35240 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0161485010015006 | . |
| Merlin | P35240 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00721623403737048 | . |
| Metal transporter CNNM3 | Q8NE01 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Metastasis-associated protein MTA2 | O94776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Metastasis-associated protein MTA2 | O94776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Metastasis-associated protein MTA2 | O94776 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Methionine synthase | Q99707 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Methionine synthase | Q99707 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Methionine--tRNA ligase | P56192 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Methionine--tRNA ligase | P56192 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Methionine--tRNA ligase | P56192 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Methylcrotonoyl-CoA carboxylase subunit alpha | Q96RQ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Methylcrotonoyl-CoA carboxylase subunit alpha | Q96RQ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Methylcrotonoyl-CoA carboxylase subunit alpha | Q96RQ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| MHC class I region proline-rich protein CAT53 | Q96QC0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00654575030646761 | . |
| MHC class I region proline-rich protein CAT53 | Q96QC0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00191626543470868 | . |
| MHC class I region proline-rich protein CAT53 | Q96QC0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000252903169373875 | . |
| MICAL-like protein 2 | Q8IY33 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| MICAL-like protein 2 | Q8IY33 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| MICAL-like protein 2 | Q8IY33 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Microtubule-actin cross-linking factor 1 | Q9UPN3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0148689768356359 | . |
| Microtubule-actin cross-linking factor 1 | Q9UPN3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0103031505804318 | . |
| Microtubule-actin cross-linking factor 1 | Q9UPN3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00149064240177797 | . |
| Microtubule-associated protein 1A | P78559 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0846648933013338 | . |
| Microtubule-associated protein 1A | P78559 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0395907359676138 | . |
| Microtubule-associated protein 1A | P78559 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00553228217559106 | . |
| Microtubule-associated protein 1B | P46821 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Microtubule-associated protein 1B | P46821 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Microtubule-associated protein 1B | P46821 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Microtubule-associated protein 1S | Q66K74 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.333980149768432 | . |
| Microtubule-associated protein 1S | Q66K74 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Microtubule-associated protein 1S | Q66K74 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Microtubule-associated protein 4 | P27816 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.59592343990801e-05 | . |
| Microtubule-associated protein 4 | P27816 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 9.53450637861339e-05 | . |
| Microtubule-associated protein 4 | P27816 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.87580352563839e-05 | . |
| Midasin | Q9NU22 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.643894304885178 | . |
| Midasin | Q9NU22 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.28519786832059 | . |
| Midasin | Q9NU22 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.171737233047994 | . |
| Minor histocompatibility antigen H13 | Q8TCT9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Minor histocompatibility antigen H13 | Q8TCT9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Minor histocompatibility antigen H13 | Q8TCT9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Mis18-binding protein 1 | Q6P0N0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Mis18-binding protein 1 | Q6P0N0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Misshapen-like kinase 1 | Q8N4C8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Mitochondrial carrier homolog 1 | Q9NZJ7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Mitochondrial carrier homolog 1 | Q9NZJ7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Mitochondrial carrier homolog 1 | Q9NZJ7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Mitotic checkpoint protein BUB3 | O43684 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.90371132653348e-05 | . |
| Mitotic checkpoint protein BUB3 | O43684 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.42300722355986e-05 | . |
| Mitotic checkpoint protein BUB3 | O43684 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000145886750355776 | . |
| Mitotic interactor and substrate of PLK1 | Q8IVT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Mitotic interactor and substrate of PLK1 | Q8IVT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Mitotic interactor and substrate of PLK1 | Q8IVT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Moesin | P26038 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 9.38031965649445e-05 | . |
| Moesin | P26038 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.68720451997595e-05 | . |
| Moesin | P26038 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000117077993874051 | . |
| Monocarboxylate transporter 1 | P53985 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Monocarboxylate transporter 1 | P53985 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Monocarboxylate transporter 1 | P53985 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| mRNA-decapping enzyme 1A | Q9NPI6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| mRNA-decapping enzyme 1A | Q9NPI6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| mRNA-decapping enzyme 1A | Q9NPI6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| mRNA-decapping enzyme 1B | Q8IZD4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.78075358517179e-05 | . |
| mRNA-decapping enzyme 1B | Q8IZD4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.6622053278114e-05 | . |
| mRNA-decapping enzyme 1B | Q8IZD4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000315826497242477 | . |
| Msx2-interacting protein | Q96T58 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Multiple PDZ domain protein | O75970 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Multiple PDZ domain protein | O75970 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Myb-binding protein 1A | Q9BQG0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00448248773319539 | . |
| Myb-binding protein 1A | Q9BQG0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00158102753318218 | . |
| Myb-binding protein 1A | Q9BQG0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000541962606931134 | . |
| MYDGF | Q969H8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| MYDGF | Q969H8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| MYDGF | Q969H8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 6.43833608860933e-05 | FC > 5 |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 2.21333435212152e-05 | FC > 5 |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000371473079007588 | FC > 5 |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.000203728867809696 | FC > 5 |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000143884245998984 | FC > 5 |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000115656140531588 | FC > 5 |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000371473079007588 | . |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000203728867809696 | . |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000143884245998984 | . |
| Myoferlin | Q9NZM1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Myoferlin | Q9NZM1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Myoferlin | Q9NZM1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Myosin-10 | P35580 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 9.40840692751681e-05 | . |
| Myosin-10 | P35580 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000286755298604627 | . |
| Myosin-10 | P35580 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00022225599146889 | . |
| Myosin-11 | P35749 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Myosin-14 | Q7Z406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.22848903337017e-05 | . |
| Myosin-14 | Q7Z406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 2.67676393529644e-05 | . |
| Myosin-14 | Q7Z406 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.92989105949296e-05 | . |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 5.25812037862448e-06 | FC > 5 |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 4.8504544296317e-05 | FC > 5 |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 3.73171743417362e-05 | FC > 5 |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 2.9050904458482e-05 | FC > 5 |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 1.93941594087938e-06 | FC > 5 |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 1.82131454208211e-05 | FC > 5 |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.8504544296317e-05 | . |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.73171743417362e-05 | . |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.82131454208211e-05 | . |
| Myosin-IIIa | Q8NEV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Myosin-IIIa | Q8NEV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Myosin-IIIa | Q8NEV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Myotubularin-related protein 5 | O95248 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Myotubularin-related protein 5 | O95248 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Myotubularin-related protein 5 | O95248 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| N-acetyl-beta-glucosaminyl | Q96IV0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0151428951160233 | . |
| N-acetyl-beta-glucosaminyl | Q96IV0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0105814421499953 | . |
| NAD(P) transhydrogenase | Q13423 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00126770767731455 | . |
| NAD(P) transhydrogenase | Q13423 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000741293680735712 | . |
| NAD(P) transhydrogenase | Q13423 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000518040402098512 | . |
| NAD(P)H dehydrogenase [quinone] 1 | P15559 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| NADH-cytochrome b5 reductase 3 | P00387 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| NADH-ubiquinone oxidoreductase chain 1 | P03886 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| NADH-ubiquinone oxidoreductase chain 1 | P03886 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| NADH-ubiquinone oxidoreductase chain 4 | P03905 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.131171074258336 | . |
| NADH-ubiquinone oxidoreductase chain 4 | P03905 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00804939248484031 | . |
| NADH-ubiquinone oxidoreductase chain 4 | P03905 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.002833760516799 | . |
| NADH-ubiquinone oxidoreductase chain 5 | P03915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| NADH-ubiquinone oxidoreductase chain 5 | P03915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| NADH-ubiquinone oxidoreductase chain 5 | P03915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nardilysin | O43847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.298647077028432 | . |
| Nardilysin | O43847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.146361130239629 | . |
| Nardilysin | O43847 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| NBAS subunit of NRZ tethering complex | A2RRP1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| NBAS subunit of NRZ tethering complex | A2RRP1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nck-associated protein 1 | Q9Y2A7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nck-associated protein 1 | Q9Y2A7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nesprin-1 | Q8NF91 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nesprin-1 | Q8NF91 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nesprin-1 | Q8NF91 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nesprin-2 | Q8WXH0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nesprin-2 | Q8WXH0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nesprin-2 | Q8WXH0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Neurobeachin-like protein 2 | Q6ZNJ1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Neurofibromin | P21359 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Neurofibromin | P21359 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Neurofibromin | P21359 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Neuron navigator 1 | Q8NEY1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Neuropathy target esterase | Q8IY17 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Neuropathy target esterase | Q8IY17 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Neuropathy target esterase | Q8IY17 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Neutral alpha-glucosidase AB | Q14697 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 7.75242552429544e-05 | . |
| Neutral alpha-glucosidase AB | Q14697 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000310580175509357 | . |
| Neutral alpha-glucosidase AB | Q14697 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000194785726464862 | . |
| NF-kappa-B-repressing factor | O15226 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| NF-kappa-B-repressing factor | O15226 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| NF-kappa-B-repressing factor | O15226 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| NFX1-type zinc finger-containing protein 1 | Q9P2E3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| NFX1-type zinc finger-containing protein 1 | Q9P2E3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| NHL repeat-containing protein 2 | Q8NBF2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| NHL repeat-containing protein 2 | Q8NBF2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| NHL repeat-containing protein 2 | Q8NBF2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| NHS-like protein 1 | Q5SYE7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nibrin | O60934 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000940733433932888 | . |
| Nibrin | O60934 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000467609574426256 | . |
| Nibrin | O60934 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000420739350177654 | . |
| Nipped-B-like protein | Q6KC79 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nipped-B-like protein | Q6KC79 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nipped-B-like protein | Q6KC79 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00590415374444514 | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00217116321879077 | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000200062593675656 | . |
| Nonsense-mediated mRNA decay factor SMG8 | Q8ND04 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.681629968986693 | . |
| Nonsense-mediated mRNA decay factor SMG8 | Q8ND04 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.382385609956007 | . |
| Nonsense-mediated mRNA decay factor SMG8 | Q8ND04 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Not56-like protein | Q92685 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Not56-like protein | Q92685 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Not56-like protein | Q92685 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Notchless protein homolog 1 | Q9NVX2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.380324578490163 | . |
| Novel SH2-containing protein 2 | O75815 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear envelope pore membrane protein POM 121C | A8CG34 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear envelope pore membrane protein POM 121C | A8CG34 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nuclear envelope pore membrane protein POM 121C | A8CG34 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear factor 1 B-type | O00712 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear factor 1 B-type | O00712 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nuclear factor 1 B-type | O00712 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear factor NF-kappa-B p100 subunit | Q00653 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear factor of activated T-cells 5 | O94916 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear mitotic apparatus protein 1 | Q14980 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00133233857595211 | . |
| Nuclear mitotic apparatus protein 1 | Q14980 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000730360886376566 | . |
| Nuclear mitotic apparatus protein 1 | Q14980 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000663581911994663 | . |
| Nuclear pore complex protein Nup133 | Q8WUM0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear pore complex protein Nup133 | Q8WUM0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nuclear pore complex protein Nup133 | Q8WUM0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear pore complex protein Nup153 | P49790 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear pore complex protein Nup153 | P49790 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nuclear pore complex protein Nup153 | P49790 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear pore complex protein Nup155 | O75694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000611415721258217 | . |
| Nuclear pore complex protein Nup155 | O75694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000271507134298182 | . |
| Nuclear pore complex protein Nup155 | O75694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000212771106014149 | . |
| Nuclear pore complex protein Nup160 | Q12769 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear pore complex protein Nup160 | Q12769 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nuclear pore complex protein Nup160 | Q12769 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear pore complex protein Nup205 | Q92621 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.7930375924717e-05 | . |
| Nuclear pore complex protein Nup205 | Q92621 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000379456837188915 | . |
| Nuclear pore complex protein Nup205 | Q92621 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000294267100204433 | . |
| Nuclear pore complex protein Nup214 | P35658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000320523773951312 | . |
| Nuclear pore complex protein Nup214 | P35658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0002922448238247 | . |
| Nuclear pore complex protein Nup214 | P35658 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00019473376104024 | . |
| Nuclear pore complex protein Nup50 | Q9UKX7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.857104405884851 | . |
| Nuclear pore complex protein Nup50 | Q9UKX7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.855303883054673 | . |
| Nuclear pore complex protein Nup50 | Q9UKX7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.542034654574264 | . |
| Nuclear pore complex protein Nup88 | Q99567 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.244150131952363 | . |
| Nuclear pore complex protein Nup88 | Q99567 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear pore complex protein Nup93 | Q8N1F7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear pore complex protein Nup93 | Q8N1F7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nuclear pore complex protein Nup93 | Q8N1F7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear pore complex protein Nup98-Nup96 | P52948 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.87590918004159e-05 | . |
| Nuclear pore complex protein Nup98-Nup96 | P52948 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000167095042674088 | . |
| Nuclear pore complex protein Nup98-Nup96 | P52948 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000132230513344287 | . |
| Nuclear pore membrane glycoprotein 210 | Q8TEM1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0337827112712778 | . |
| Nuclear pore membrane glycoprotein 210 | Q8TEM1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0105108284021172 | . |
| Nuclear pore membrane glycoprotein 210 | Q8TEM1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00171218090223354 | . |
| Nuclear protein localization protein 4 homolog | Q8TAT6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.186643743628605 | . |
| Nuclear protein localization protein 4 homolog | Q8TAT6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.07395444243225 | . |
| Nuclear protein localization protein 4 homolog | Q8TAT6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0564204674964379 | . |
| Nuclear receptor coactivator 2 | Q15596 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear receptor coactivator 2 | Q15596 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear receptor coactivator 5 | Q9HCD5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear receptor coactivator 5 | Q9HCD5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nuclear receptor coactivator 5 | Q9HCD5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear receptor coactivator 6 | Q14686 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear receptor coactivator 6 | Q14686 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nuclear receptor coactivator 6 | Q14686 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear receptor corepressor 1 | O75376 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear receptor corepressor 1 | O75376 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nuclear receptor corepressor 2 | Q9Y618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.35333586714748e-05 | . |
| Nuclear receptor corepressor 2 | Q9Y618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.23334434851969e-05 | . |
| Nuclear receptor corepressor 2 | Q9Y618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000277073392649547 | . |
| Nuclear RNA export factor 1 | Q9UBU9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nuclear RNA export factor 1 | Q9UBU9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nuclear RNA export factor 1 | Q9UBU9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nucleolar and coiled-body phosphoprotein 1 | Q14978 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.51055354640415e-05 | . |
| Nucleolar and coiled-body phosphoprotein 1 | Q14978 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.42274210157336e-05 | . |
| Nucleolar and coiled-body phosphoprotein 1 | Q14978 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.35550917915831e-05 | . |
| Nucleolar complex protein 3 homolog | Q8WTT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nucleolar complex protein 3 homolog | Q8WTT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nucleolar complex protein 3 homolog | Q8WTT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nucleolar GTP-binding protein 2 | Q13823 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nucleolar GTP-binding protein 2 | Q13823 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nucleolar GTP-binding protein 2 | Q13823 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nucleolar pre-ribosomal-associated protein 1 | O60287 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nucleolar pre-ribosomal-associated protein 1 | O60287 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nucleolar pre-ribosomal-associated protein 1 | O60287 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nucleolar protein 1 | P46087 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.35470929278112e-05 | . |
| Nucleolar protein 1 | P46087 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.56734480187918e-05 | . |
| Nucleolar protein 1 | P46087 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000184829416083741 | . |
| Nucleolar protein 10 | Q9BSC4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.78350596061458e-05 | . |
| Nucleolar protein 10 | Q9BSC4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.72527239824422e-05 | . |
| Nucleolar protein 10 | Q9BSC4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.97579338305255e-05 | . |
| Nucleolar protein 11 | Q9H8H0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nucleolar protein 11 | Q9H8H0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nucleolar protein 11 | Q9H8H0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nucleolar protein 14 | P78316 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.244770344086823 | . |
| Nucleolar protein 14 | P78316 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.111994712653124 | . |
| Nucleolar protein 14 | P78316 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.104093562351602 | . |
| Nucleolar protein 56 | O00567 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nucleolar protein 56 | O00567 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nucleolar protein 56 | O00567 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nucleolar protein 6 | Q9H6R4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00431035315143938 | . |
| Nucleolar protein 6 | Q9H6R4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00359881344209537 | . |
| Nucleolar protein 6 | Q9H6R4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000184252162620735 | . |
| Nucleolar protein 8 | Q76FK4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nucleolar protein 8 | Q76FK4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nucleolar protein 8 | Q76FK4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.13101846068182e-06 | . |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 7.63659845365633e-05 | . |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000357310027422726 | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.20541042774999e-05 | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.80389189379682e-05 | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000363695413112084 | . |
| Nucleolus and neural progenitor protein | Q6NW34 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0176570295408303 | . |
| Nucleolus and neural progenitor protein | Q6NW34 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000721379139548156 | . |
| Nucleolus and neural progenitor protein | Q6NW34 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000435418484216736 | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00121517469205271 | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000537925517173063 | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000246369492456674 | . |
| Nucleoporin NDC1 | Q9BTX1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nucleoporin NDC1 | Q9BTX1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Nucleoporin NDC1 | Q9BTX1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Nucleoporin NUP188 | Q5SRE5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0459220219722085 | . |
| Nucleoporin NUP188 | Q5SRE5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0369073497436862 | . |
| Nucleoporin NUP188 | Q5SRE5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0267915308239226 | . |
| Nucleoporin SEH1 | Q96EE3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.829671318671723 | . |
| Nucleoporin SEH1 | Q96EE3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.070237814673423 | . |
| Nucleoporin SEH1 | Q96EE3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0380381440751986 | . |
| Nucleoprotein TPR | P12270 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.17673083568818e-05 | . |
| Nucleoprotein TPR | P12270 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.0549419311818e-05 | . |
| Nucleoprotein TPR | P12270 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00020991284557876 | . |
| Nucleosome-remodeling factor subunit BPTF | Q12830 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Nucleosome-remodeling factor subunit BPTF | Q12830 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| OGDH-E1 | Q02218 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| OGDH-E1 | Q02218 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| OGDH-E1 | Q02218 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Oligosaccharyl transferase subunit STT3A | P46977 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00103793420840894 | . |
| Oligosaccharyl transferase subunit STT3A | P46977 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000760265286536615 | . |
| Oligosaccharyl transferase subunit STT3A | P46977 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000532237701223657 | . |
| Oligosaccharyl transferase subunit STT3B | Q8TCJ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000402556607769589 | . |
| Oligosaccharyl transferase subunit STT3B | Q8TCJ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000106830934580341 | . |
| Oligosaccharyl transferase subunit STT3B | Q8TCJ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000106060057490043 | . |
| Osa homolog 2 | Q8NFD5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00514344719405908 | . |
| Osa homolog 2 | Q8NFD5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00310290007417526 | . |
| Osa homolog 2 | Q8NFD5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00183415375128439 | . |
| Oxidative stress-associated Src activator | Q9NZB2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Oxidative stress-associated Src activator | Q9NZB2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Oxidative stress-associated Src activator | Q9NZB2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Oxysterol-binding protein 1 | P22059 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Oxysterol-binding protein 1 | P22059 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Oxysterol-binding protein 1 | P22059 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Oxysterol-binding protein-related protein 10 | Q9BXB5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Oxysterol-binding protein-related protein 10 | Q9BXB5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Oxysterol-binding protein-related protein 10 | Q9BXB5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Oxysterol-binding protein-related protein 11 | Q9BXB4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Oxysterol-binding protein-related protein 11 | Q9BXB4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Oxysterol-binding protein-related protein 5 | Q9H0X9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Oxysterol-binding protein-related protein 5 | Q9H0X9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Oxysterol-binding protein-related protein 5 | Q9H0X9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Oxysterol-binding protein-related protein 8 | Q9BZF1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.58474335038409e-05 | . |
| Oxysterol-binding protein-related protein 8 | Q9BZF1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.72548739724351e-05 | . |
| Oxysterol-binding protein-related protein 8 | Q9BZF1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.55468037938334e-05 | . |
| Oxysterol-binding protein-related protein 9 | Q96SU4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.96116981854799e-05 | . |
| Oxysterol-binding protein-related protein 9 | Q96SU4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.8085208740731e-05 | . |
| Oxysterol-binding protein-related protein 9 | Q96SU4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 2.74285231298926e-05 | . |
| p113 | P52630 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| p113 | P52630 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| p113 | P52630 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PAICS | P22234 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00437366107960356 | . |
| PAICS | P22234 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0021240955754166 | . |
| PAICS | P22234 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000394023513853776 | . |
| Paired amphipathic helix protein Sin3a | Q96ST3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 7.98304398735306e-05 | . |
| Paired amphipathic helix protein Sin3a | Q96ST3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000737461583018803 | . |
| Paired amphipathic helix protein Sin3a | Q96ST3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000288116372492701 | . |
| PAK/PLC-interacting protein 1 | Q9NWT1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PAK/PLC-interacting protein 1 | Q9NWT1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PAK/PLC-interacting protein 1 | Q9NWT1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Palladin | Q8WX93 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.72519777738837e-05 | . |
| Palladin | Q8WX93 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000200250522265225 | . |
| Palladin | Q8WX93 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00012532573710571 | . |
| Palmitoyltransferase ZDHHC5 | Q9C0B5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000427110804275807 | . |
| Palmitoyltransferase ZDHHC5 | Q9C0B5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000199065071577187 | . |
| Palmitoyltransferase ZDHHC5 | Q9C0B5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000149622787320208 | . |
| PAPS transporter 1 | Q8TB61 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PAPS transporter 1 | Q8TB61 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PAPS transporter 1 | Q8TB61 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PAPSS 2 | O95340 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PAPSS 2 | O95340 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PAPSS 2 | O95340 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Parafibromin | Q6P1J9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00341438993947717 | . |
| Parafibromin | Q6P1J9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00157422199626507 | . |
| Parafibromin | Q6P1J9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000557260458844317 | . |
| Paralemmin-2 | Q8IXS6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Paralemmin-2 | Q8IXS6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Paralemmin-2 | Q8IXS6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Partitioning defective 3 homolog | Q8TEW0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.66788795129891e-05 | . |
| Partitioning defective 3 homolog | Q8TEW0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.48445454726935e-05 | . |
| Partitioning defective 3 homolog | Q8TEW0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.01709564605514e-05 | . |
| PDPr | Q8NCN5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00337508204608298 | . |
| PDPr | Q8NCN5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000231158578912788 | . |
| PDPr | Q8NCN5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000203998698814431 | . |
| PDZ and LIM domain protein 5 | Q96HC4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00248733885539616 | . |
| PDZ and LIM domain protein 5 | Q96HC4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00212483091612331 | . |
| PDZ and LIM domain protein 5 | Q96HC4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000415651793937859 | . |
| PDZ and LIM domain protein 7 | Q9NR12 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000644165743322522 | . |
| PDZ and LIM domain protein 7 | Q9NR12 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000484920863459858 | . |
| PDZ and LIM domain protein 7 | Q9NR12 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000244366575452827 | . |
| PEPCK-M | Q16822 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PEPCK-M | Q16822 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PEPCK-M | Q16822 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Peptidyl-glycine alpha-amidating monooxygenase | P19021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Peptidyl-glycine alpha-amidating monooxygenase | P19021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Peptidyl-prolyl cis-trans isomerase A | P62937 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase B | P23284 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Peptidyl-prolyl cis-trans isomerase B | P23284 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Peptidyl-prolyl cis-trans isomerase B | P23284 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase G | Q13427 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Peptidyl-prolyl cis-trans isomerase G | Q13427 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Peptidyl-prolyl cis-trans isomerase G | Q13427 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Peptidyl-prolyl cis-trans isomerase-like 4 | Q8WUA2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Peptidyl-prolyl cis-trans isomerase-like 4 | Q8WUA2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Peptidyl-prolyl cis-trans isomerase-like 4 | Q8WUA2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Pericentrin | O95613 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.679205422692848 | . |
| Pericentrin | O95613 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.603960806107323 | . |
| Pericentrin | O95613 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.543304451010084 | . |
| Pericentriolar material 1 protein | Q15154 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Pericentriolar material 1 protein | Q15154 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Periodic tryptophan protein 2 homolog | Q15269 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Periodic tryptophan protein 2 homolog | Q15269 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Periodic tryptophan protein 2 homolog | Q15269 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Peripheral plasma membrane protein CASK | O14936 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Peripheral plasma membrane protein CASK | O14936 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Perlecan (PLC) | P98160 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Peroxidasin homolog | Q92626 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Peroxidasin homolog | Q92626 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Peroxidasin homolog | Q92626 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Peroxiredoxin-1 | Q06830 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.12329035048409 | . |
| Peroxiredoxin-1 | Q06830 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0934366901252856 | . |
| Peroxiredoxin-1 | Q06830 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00410064294485949 | . |
| Peroxiredoxin-2 | P32119 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.992151437784148 | . |
| Peroxiredoxin-2 | P32119 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0609615670796769 | . |
| Peroxiredoxin-2 | P32119 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000538058438964218 | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000393793602071121 | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00017181816533301 | . |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.24304836495578e-05 | . |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000358315484322705 | . |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000173158033005168 | . |
| Pescadillo homolog | O00541 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Pescadillo homolog | O00541 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Pescadillo homolog | O00541 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PEX7-binding protein 2 | A3KMH1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PEX7-binding protein 2 | A3KMH1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PEX7-binding protein 2 | A3KMH1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PH domain-containing family A member 5 | Q9HAU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PH domain-containing family A member 5 | Q9HAU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PH domain-containing family A member 5 | Q9HAU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PH domain-containing family G member 3 | A1L390 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0227392321333591 | . |
| PH domain-containing family G member 3 | A1L390 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00491747697919188 | . |
| PH domain-containing family G member 3 | A1L390 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00293921609053833 | . |
| PH domain-containing family H member 1 | Q9ULM0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PH domain-containing family H member 1 | Q9ULM0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PH domain-containing family H member 1 | Q9ULM0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PH-interacting protein | Q8WWQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PH-interacting protein | Q8WWQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PH-interacting protein | Q8WWQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PHD finger protein 3 | Q92576 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PHD finger protein 3 | Q92576 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Phosphatase and actin regulator 4 | Q8IZ21 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0166581132954466 | . |
| Phosphatase and actin regulator 4 | Q8IZ21 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Phosphatase and actin regulator 4 | Q8IZ21 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Phosphate carrier protein | Q00325 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.229507984738429 | . |
| Phosphate carrier protein | Q00325 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.113433103800758 | . |
| Phosphate carrier protein | Q00325 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0702341592915816 | . |
| Phosphatidate phosphatase LPIN1 | Q14693 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Phosphatidate phosphatase LPIN1 | Q14693 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Phosphatidate phosphatase LPIN1 | Q14693 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Phosphatidylinositol 4-kinase alpha | P42356 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Phosphatidylinositol 4-kinase alpha | P42356 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Phosphatidylinositol 4-kinase alpha | P42356 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Phosphatidylinositol-3-phosphatase SAC1 | Q9NTJ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Phosphatidylinositol-3-phosphatase SAC1 | Q9NTJ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Phosphatidylserine synthase 1 | P48651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00361036024771455 | . |
| Phosphatidylserine synthase 1 | P48651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00339663221813859 | . |
| Phosphatidylserine synthase 1 | P48651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000198022817795877 | . |
| Phosphofurin acidic cluster sorting protein 1 | Q6VY07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Phosphofurin acidic cluster sorting protein 1 | Q6VY07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Phosphofurin acidic cluster sorting protein 1 | Q6VY07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Phosphoglucomutase-1 | P36871 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0156930990428627 | . |
| Phosphoglucomutase-1 | P36871 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Phosphoglucomutase-1 | P36871 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0866737386086644 | . |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0300480425118484 | . |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000557362422481122 | . |
| Phosphoinositide 3-kinase regulatory subunit 4 | Q99570 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Phosphoinositide 3-kinase regulatory subunit 4 | Q99570 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Phosphoinositide 3-kinase regulatory subunit 4 | Q99570 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Phospholipase A-2-activating protein | Q9Y263 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000169539542846745 | . |
| Phospholipase A-2-activating protein | Q9Y263 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000154214960715151 | . |
| Phospholipase A-2-activating protein | Q9Y263 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000115649637021698 | . |
| Phospholipase C-beta-3 | Q01970 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Phospholipase C-beta-3 | Q01970 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Phospholipase C-beta-3 | Q01970 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Phospholipase C-delta-3 | Q8N3E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0192662174436555 | . |
| Phospholipase C-delta-3 | Q8N3E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0112288419262362 | . |
| Phospholipase C-delta-3 | Q8N3E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000114600879551722 | . |
| Phospholipase C-II | P19174 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0590680899981436 | . |
| Phospholipase C-II | P19174 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0465317995661615 | . |
| Phospholipase C-II | P19174 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00154551109133323 | . |
| Phosphoribosylformylglycinamidine synthase | O15067 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0510671371184616 | . |
| Phosphoribosylformylglycinamidine synthase | O15067 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00831070288820487 | . |
| Phosphoribosylformylglycinamidine synthase | O15067 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00233792503982331 | . |
| Phosphorylase b kinase regulatory subunit beta | Q93100 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Phosphorylase b kinase regulatory subunit beta | Q93100 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PI3K-C2-alpha | O00443 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PI3K-C2-alpha | O00443 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PI3K-C2-alpha | O00443 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PIP2-dependent ARF1 GAP | Q9ULH1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PIP2-dependent ARF1 GAP | Q9ULH1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PIP2-dependent ARF1 GAP | Q9ULH1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Plasma membrane calcium-transporting ATPase 1 | P20020 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.357493750093767 | . |
| Plasma membrane calcium-transporting ATPase 1 | P20020 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Plasma membrane calcium-transporting ATPase 1 | P20020 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Plasma membrane calcium-transporting ATPase 4 | P23634 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Plasma membrane calcium-transporting ATPase 4 | P23634 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Plasma membrane calcium-transporting ATPase 4 | P23634 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Pleckstrin-2 | Q9NYT0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Pleckstrin-2 | Q9NYT0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Pleckstrin-2 | Q9NYT0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Plectin | Q15149 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.86274426725122e-05 | . |
| Plectin | Q15149 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.90724043301363e-05 | . |
| Plectin | Q15149 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000154078643169926 | . |
| Pleiotropic regulator 1 | O43660 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.33378343759524e-05 | . |
| Pleiotropic regulator 1 | O43660 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.6770759793019e-05 | . |
| Pleiotropic regulator 1 | O43660 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000151350228753992 | . |
| Pogo transposable element with ZNF domain | Q7Z3K3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.013296098625892 | . |
| Pogo transposable element with ZNF domain | Q7Z3K3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00768151576516562 | . |
| Pogo transposable element with ZNF domain | Q7Z3K3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 8.91144963758496e-05 | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.21930211056148e-05 | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000118322338471263 | . |
| Poly [ADP-ribose] polymerase 2 | Q9UGN5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Poly(rC)-binding protein 1 | Q15365 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00341512585716559 | . |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Polyadenylate-binding protein 4 | Q13310 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00345351764394159 | . |
| Polyadenylate-binding protein 4 | Q13310 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00135456599221648 | . |
| Polyadenylate-binding protein 4 | Q13310 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000716185205338555 | . |
| Polycomb protein SUZ12 | Q15022 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Polycomb protein SUZ12 | Q15022 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Polycomb protein SUZ12 | Q15022 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Polymerase delta-interacting protein 3 | Q9BY77 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Polymerase delta-interacting protein 3 | Q9BY77 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Polymeric immunoglobulin receptor | P01833 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Polynucleotide 5'-hydroxyl-kinase NOL9 | Q5SY16 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Polynucleotide 5'-hydroxyl-kinase NOL9 | Q5SY16 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Polynucleotide 5'-hydroxyl-kinase NOL9 | Q5SY16 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Polypeptide N-acetylgalactosaminyltransferase 2 | Q10471 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0192270206357986 | . |
| Polypeptide N-acetylgalactosaminyltransferase 2 | Q10471 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0162894040001297 | . |
| Polypeptide N-acetylgalactosaminyltransferase 2 | Q10471 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00403931672875092 | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.22880850515177e-05 | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000489321467931896 | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000188702437891076 | . |
| Polyunsaturated fatty acid 5-lipoxygenase | P09917 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Polyunsaturated fatty acid 5-lipoxygenase | P09917 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| POMGnT1 | Q8WZA1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PP2A subunit B isoform B55-alpha | P63151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PP2A subunit B isoform B55-alpha | P63151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PP2A subunit B isoform B55-alpha | P63151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PRA1 family protein 3 | O75915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0724158640793231 | . |
| PRA1 family protein 3 | O75915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00116304056220229 | . |
| PRA1 family protein 3 | O75915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000175244953469881 | . |
| pre-mRNA 3' end processing protein WDR33 | Q9C0J8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00217013612186162 | . |
| pre-mRNA 3' end processing protein WDR33 | Q9C0J8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000956701525045784 | . |
| pre-mRNA 3' end processing protein WDR33 | Q9C0J8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0009017053953533 | . |
| Pre-mRNA cleavage complex 2 protein Pcf11 | O94913 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Pre-mRNA cleavage complex 2 protein Pcf11 | O94913 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Pre-mRNA cleavage complex 2 protein Pcf11 | O94913 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.136771356937577 | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00457027588425657 | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Pre-mRNA-processing factor 6 | O94906 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Pre-mRNA-processing factor 6 | O94906 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Pre-mRNA-processing factor 6 | O94906 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 6.82307762840599e-05 | FC > 5 |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 1.97683798291017e-05 | FC > 5 |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000288370425936001 | FC > 5 |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.00017834443349998 | FC > 5 |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000151760324856781 | FC > 5 |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.000147050550292683 | FC > 5 |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00017834443349998 | . |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000151760324856781 | . |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000147050550292683 | . |
| Pre-rRNA-processing protein TSR1 homolog | Q2NL82 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.039842942412615 | . |
| Pre-rRNA-processing protein TSR1 homolog | Q2NL82 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0359146806215163 | . |
| Pre-rRNA-processing protein TSR1 homolog | Q2NL82 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00736721994175277 | . |
| Prelamin-A/C | P02545 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0144595344840824 | . |
| Prelamin-A/C | P02545 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.012702190339656 | . |
| Prelamin-A/C | P02545 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00158946316323719 | . |
| Probable ATP-dependent RNA helicase DDX10 | Q13206 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0159250965672488 | . |
| Probable ATP-dependent RNA helicase DDX10 | Q13206 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00993448523613518 | . |
| Probable ATP-dependent RNA helicase DDX10 | Q13206 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Probable ATP-dependent RNA helicase DDX20 | Q9UHI6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Probable ATP-dependent RNA helicase DDX20 | Q9UHI6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Probable ATP-dependent RNA helicase DDX20 | Q9UHI6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Probable ATP-dependent RNA helicase DDX23 | Q9BUQ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0229109388696562 | . |
| Probable ATP-dependent RNA helicase DDX23 | Q9BUQ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0227500739177813 | . |
| Probable ATP-dependent RNA helicase DDX23 | Q9BUQ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Probable ATP-dependent RNA helicase DDX27 | Q96GQ7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00321430211843501 | . |
| Probable ATP-dependent RNA helicase DDX27 | Q96GQ7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000372067997732472 | . |
| Probable ATP-dependent RNA helicase DDX27 | Q96GQ7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000329453072876746 | . |
| Probable ATP-dependent RNA helicase DDX31 | Q9H8H2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0100901021368964 | . |
| Probable ATP-dependent RNA helicase DDX31 | Q9H8H2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00142181886602272 | . |
| Probable ATP-dependent RNA helicase DDX31 | Q9H8H2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000720625200709297 | . |
| Probable ATP-dependent RNA helicase DDX46 | Q7L014 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.155273919343404 | . |
| Probable ATP-dependent RNA helicase DDX46 | Q7L014 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0698223674038174 | . |
| Probable ATP-dependent RNA helicase DDX46 | Q7L014 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0639065838104298 | . |
| Probable ATP-dependent RNA helicase DDX5 | P17844 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Probable ATP-dependent RNA helicase DDX5 | P17844 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Probable ATP-dependent RNA helicase DDX5 | P17844 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Probable ATP-dependent RNA helicase DDX52 | Q9Y2R4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Probable ATP-dependent RNA helicase DDX52 | Q9Y2R4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Probable ATP-dependent RNA helicase DDX52 | Q9Y2R4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Probable ATP-dependent RNA helicase DHX34 | Q14147 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Probable ATP-dependent RNA helicase DHX34 | Q14147 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Probable ATP-dependent RNA helicase DHX34 | Q14147 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Probable ATP-dependent RNA helicase DHX37 | Q8IY37 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Probable ATP-dependent RNA helicase DHX37 | Q8IY37 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Probable ATP-dependent RNA helicase DHX37 | Q8IY37 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Probable C-mannosyltransferase DPY19L1 | Q2PZI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0247925456685137 | . |
| Probable C-mannosyltransferase DPY19L1 | Q2PZI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0147318248340791 | . |
| Probable C-mannosyltransferase DPY19L1 | Q2PZI1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Probable E3 ubiquitin-protein ligase HERC4 | Q5GLZ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Probable E3 ubiquitin-protein ligase HERC4 | Q5GLZ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Probable E3 ubiquitin-protein ligase HERC4 | Q5GLZ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Probable E3 ubiquitin-protein ligase IRF2BPL | Q9H1B7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Probable global transcription activator SNF2L1 | P28370 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0262764706955913 | . |
| Probable global transcription activator SNF2L1 | P28370 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0231474650263388 | . |
| Probable global transcription activator SNF2L1 | P28370 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.013987621636478 | . |
| Probable global transcription activator SNF2L2 | P51531 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.86846606324008e-05 | . |
| Probable global transcription activator SNF2L2 | P51531 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000613493214088017 | . |
| Probable global transcription activator SNF2L2 | P51531 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000129657052083031 | . |
| Probable helicase with zinc finger domain | P42694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Probable helicase with zinc finger domain | P42694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Probable helicase with zinc finger domain | P42694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Probable RNA-binding protein 19 | Q9Y4C8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00645338803072064 | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000592960136914755 | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000124390911040261 | . |
| Prolactin-inducible protein | P12273 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0449319579820094 | . |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0175439111144623 | . |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.009745946943668 | . |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Prolyl endopeptidase | P48147 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0118774623437529 | . |
| Prolyl endopeptidase | P48147 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00808163805681449 | . |
| Prolyl endopeptidase | P48147 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00598327164417391 | . |
| Prolyl endopeptidase-like | Q4J6C6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Prolyl endopeptidase-like | Q4J6C6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Proteasome activator complex subunit 4 | Q14997 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0340629260165837 | . |
| Proteasome activator complex subunit 4 | Q14997 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.012665906903472 | . |
| Proteasome activator complex subunit 4 | Q14997 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Proteasome adapter and scaffold protein ECM29 | Q5VYK3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 6.17415161383803e-05 | . |
| Proteasome adapter and scaffold protein ECM29 | Q5VYK3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.83408372231225e-05 | . |
| Proteasome adapter and scaffold protein ECM29 | Q5VYK3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000284064041749673 | . |
| Proteasome subunit beta type-5 | P28074 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Proteasome subunit beta type-5 | P28074 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein 4.1 | P11171 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein AHNAK2 | Q8IVF2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000768283493768023 | . |
| Protein AHNAK2 | Q8IVF2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000349892394304875 | . |
| Protein AHNAK2 | Q8IVF2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000317905115102599 | . |
| Protein arginine N-methyltransferase 5 | O14744 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.22711913845295 | . |
| Protein arginine N-methyltransferase 5 | O14744 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0742199000658135 | . |
| Protein arginine N-methyltransferase 5 | O14744 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0144165119675569 | . |
| Protein argonaute-2 | Q9UKV8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein argonaute-2 | Q9UKV8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein argonaute-2 | Q9UKV8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein C2f | Q92979 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein capicua homolog | Q96RK0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein capicua homolog | Q96RK0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein capicua homolog | Q96RK0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein ELYS | Q8WYP5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0560912580798514 | . |
| Protein ELYS | Q8WYP5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000925526019753476 | . |
| Protein ELYS | Q8WYP5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000815442975540467 | . |
| Protein ERGIC-53 | P49257 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00184416440279255 | . |
| Protein ERGIC-53 | P49257 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00123872320390578 | . |
| Protein ERGIC-53 | P49257 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000435005094578718 | . |
| Protein FAM83H | Q6ZRV2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein FAM83H | Q6ZRV2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein FAM83H | Q6ZRV2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein flightless-1 homolog | Q13045 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0204207184945704 | . |
| Protein flightless-1 homolog | Q13045 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0187851814298302 | . |
| Protein flightless-1 homolog | Q13045 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0151237980870119 | . |
| Protein ftsJ homolog 3 | Q8IY81 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0193727718865896 | . |
| Protein ftsJ homolog 3 | Q8IY81 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00306131743690876 | . |
| Protein ftsJ homolog 3 | Q8IY81 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000633028282246035 | . |
| Protein furry homolog-like | O94915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.47231494808098e-05 | . |
| Protein furry homolog-like | O94915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00647633301453276 | . |
| Protein furry homolog-like | O94915 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00109134707891296 | . |
| Protein Haymaker | O96008 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0011218424806627 | . |
| Protein Haymaker | O96008 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000200879889748002 | . |
| Protein Haymaker | O96008 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000109385784437902 | . |
| Protein kinase C alpha type | P17252 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein kinase C alpha type | P17252 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein kinase C alpha type | P17252 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein kinase C iota type | P41743 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein kinase C iota type | P41743 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein LL5-alpha | Q86UU1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00250264172737766 | . |
| Protein LL5-alpha | Q86UU1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00118674971003353 | . |
| Protein LL5-alpha | Q86UU1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000424741462001688 | . |
| Protein LL5-beta | Q86SQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000532478276933547 | . |
| Protein LL5-beta | Q86SQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000310930937086283 | . |
| Protein LL5-beta | Q86SQ0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000245498697309632 | . |
| Protein MON2 homolog | Q7Z3U7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein MON2 homolog | Q7Z3U7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein MON2 homolog | Q7Z3U7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein mono-ADP-ribosyltransferase PARP14 | Q460N5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.836820033912103 | . |
| Protein mono-ADP-ribosyltransferase PARP14 | Q460N5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.474185742547219 | . |
| Protein mono-ADP-ribosyltransferase PARP14 | Q460N5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0220389620048578 | . |
| Protein mono-ADP-ribosyltransferase PARP4 | Q9UKK3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein mono-ADP-ribosyltransferase PARP4 | Q9UKK3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein mono-ADP-ribosyltransferase PARP4 | Q9UKK3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein mono-ADP-ribosyltransferase PARP9 | Q8IXQ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein mono-ADP-ribosyltransferase PARP9 | Q8IXQ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein NEDD1 | Q8NHV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.021615254419382 | . |
| Protein NEDD1 | Q8NHV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0185831854701402 | . |
| Protein NEDD1 | Q8NHV4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00197133772700596 | . |
| Protein O-mannosyl-transferase TMTC3 | Q6ZXV5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein O-mannosyl-transferase TMTC3 | Q6ZXV5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein O-mannosyl-transferase TMTC3 | Q6ZXV5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein odr-4 homolog | Q5SWX8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein PAT1 homolog 1 | Q86TB9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein PAT1 homolog 1 | Q86TB9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein phosphatase 1 regulatory subunit 12A | O14974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein phosphatase 1 regulatory subunit 12A | O14974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein polybromo-1 | Q86U86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0119232614387758 | . |
| Protein polybromo-1 | Q86U86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00673308910856991 | . |
| Protein polybromo-1 | Q86U86 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00509083623407726 | . |
| Protein PRRC2A | P48634 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein PRRC2A | P48634 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein PRRC2A | P48634 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein PRRC2B | Q5JSZ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.130476972255993 | . |
| Protein PRRC2B | Q5JSZ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.118315868286292 | . |
| Protein PRRC2B | Q5JSZ5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.117971618034313 | . |
| Protein PRRC2C | Q9Y520 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000244195724546824 | . |
| Protein PRRC2C | Q9Y520 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000224172188805477 | . |
| Protein PRRC2C | Q9Y520 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000204069008864661 | . |
| Protein RCC2 | Q9P258 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.50065780487823e-05 | . |
| Protein RCC2 | Q9P258 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.69954163208995e-05 | . |
| Protein RCC2 | Q9P258 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.28457724582665e-05 | . |
| Protein RER1 | O15258 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00861643526581328 | . |
| Protein RER1 | O15258 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00576716766484607 | . |
| Protein RER1 | O15258 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000643326746026696 | . |
| Protein RFT1 homolog | Q96AA3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.576942304715026 | . |
| Protein RFT1 homolog | Q96AA3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.274055340509897 | . |
| Protein RFT1 homolog | Q96AA3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.162503002614261 | . |
| Protein RRP5 homolog | Q14690 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.28619975680312e-05 | . |
| Protein RRP5 homolog | Q14690 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000279394111036193 | . |
| Protein RRP5 homolog | Q14690 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000191640441892856 | . |
| Protein S100-A7 | P31151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein S100-A7 | P31151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein S100-A7 | P31151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein S100-A8 | P05109 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.496517748253285 | . |
| Protein S100-A8 | P05109 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.135239153120102 | . |
| Protein S100-A8 | P05109 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein S100-A9 | P06702 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.763261737943042 | . |
| Protein S100-A9 | P06702 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0955781758729472 | . |
| Protein S100-A9 | P06702 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0927502021725629 | . |
| Protein SCAF11 | Q99590 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein SCAF11 | Q99590 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein SCAF11 | Q99590 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein scribble homolog | Q14160 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0199316684764093 | . |
| Protein scribble homolog | Q14160 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00757600161902766 | . |
| Protein scribble homolog | Q14160 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00460348301948221 | . |
| Protein SDA1 homolog | Q9NVU7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein SDA1 homolog | Q9NVU7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein SDA1 homolog | Q9NVU7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein Shroom3 | Q8TF72 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.35689732533725 | . |
| Protein Shroom3 | Q8TF72 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0392585397934804 | . |
| Protein SON | P18583 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein SON | P18583 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein SON | P18583 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein SPT2 homolog | Q68D10 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein SPT2 homolog | Q68D10 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein SPT2 homolog | Q68D10 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein strawberry notch homolog 1 | A3KN83 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein strawberry notch homolog 1 | A3KN83 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein strawberry notch homolog 1 | A3KN83 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein TANC1 | Q9C0D5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein TANC1 | Q9C0D5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein TANC1 | Q9C0D5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein TANC2 | Q9HCD6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein TRAM1 | Q15629 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein TRAM1 | Q15629 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein TRAM1 | Q15629 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein transport protein Sec16A | O15027 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00107560130612076 | . |
| Protein transport protein Sec16A | O15027 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000716912940190927 | . |
| Protein transport protein Sec16A | O15027 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00020067319862752 | . |
| Protein transport protein Sec23A | Q15436 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000210429338890884 | . |
| Protein transport protein Sec23A | Q15436 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000173215499046272 | . |
| Protein transport protein Sec23A | Q15436 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000143061802886953 | . |
| Protein transport protein Sec23B | Q15437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein transport protein Sec23B | Q15437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein transport protein Sec23B | Q15437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein transport protein Sec24A | O95486 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein transport protein Sec24A | O95486 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein transport protein Sec24A | O95486 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein transport protein Sec24B | O95487 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00828877850925746 | . |
| Protein transport protein Sec24B | O95487 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00237599690546937 | . |
| Protein transport protein Sec24B | O95487 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000185201074557659 | . |
| Protein transport protein Sec24C | P53992 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.58350338208284e-05 | . |
| Protein transport protein Sec24C | P53992 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.62863494240138e-05 | . |
| Protein transport protein Sec24C | P53992 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000128448112226055 | . |
| Protein transport protein Sec24D | O94855 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein transport protein Sec24D | O94855 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein transport protein Sec24D | O94855 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein transport protein Sec31A | O94979 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.47021878677276e-05 | . |
| Protein transport protein Sec31A | O94979 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.43448891296783e-05 | . |
| Protein transport protein Sec31A | O94979 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000128279079276733 | . |
| Protein tyrosine phosphatase TD14 | Q9H3S7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.348045271757396 | . |
| Protein tyrosine phosphatase TD14 | Q9H3S7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.179851031311352 | . |
| Protein tyrosine phosphatase TD14 | Q9H3S7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0512086630029212 | . |
| Protein virilizer homolog | Q69YN4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.123410459546833 | . |
| Protein virilizer homolog | Q69YN4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00357901054814153 | . |
| Protein virilizer homolog | Q69YN4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00191232612249644 | . |
| Protein YIF1B | Q5BJH7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein YIPF5 | Q969M3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein YIPF5 | Q969M3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein YIPF5 | Q969M3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein-glutamine gamma-glutamyltransferase 2 | P21980 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.133514856259926 | . |
| Protein-glutamine gamma-glutamyltransferase 2 | P21980 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0617614146127306 | . |
| Protein-glutamine gamma-glutamyltransferase 2 | P21980 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0537876257329611 | . |
| Protein-glutamine gamma-glutamyltransferase E | Q08188 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein-glutamine gamma-glutamyltransferase E | Q08188 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein-glutamine gamma-glutamyltransferase E | Q08188 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein-glutamine methyltransferase | A6NHQ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Protein-tyrosine phosphatase 1D | Q06124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Protein-tyrosine phosphatase 1D | Q06124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Protein-tyrosine phosphatase 1D | Q06124 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| PTP-PEST | Q05209 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| PTP-PEST | Q05209 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| PTP-PEST | Q05209 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Putative ATP-dependent RNA helicase DHX57 | Q6P158 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Putative ATP-dependent RNA helicase DHX57 | Q6P158 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Putative ATP-dependent RNA helicase DHX57 | Q6P158 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Putative RNA-binding protein 15B | Q8NDT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Putative RNA-binding protein 15B | Q8NDT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Putative RNA-binding protein 15B | Q8NDT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Pyruvate carboxylase | P11498 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.135913851045491 | . |
| Pyruvate carboxylase | P11498 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0490431579366268 | . |
| Pyruvate carboxylase | P11498 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0433682930856851 | . |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 6.90597722271965e-05 | FC > 5 |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 6.83620611472974e-06 | FC > 5 |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 3.97795016995344e-06 | FC > 5 |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 3.8927133605526e-05 | FC > 5 |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 3.55442902910367e-05 | FC > 5 |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 2.78021530608493e-05 | FC > 5 |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 6.90597722271965e-05 | . |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.55442902910367e-05 | . |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.78021530608493e-05 | . |
| Rab GDP dissociation inhibitor beta | P50395 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.37270176234507e-05 | . |
| Rab GDP dissociation inhibitor beta | P50395 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.19866394622603e-05 | . |
| Rab GDP dissociation inhibitor beta | P50395 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000115709553441215 | . |
| Rab GTPase-activating protein 1 | Q9Y3P9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rab GTPase-activating protein 1 | Q9Y3P9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Rab GTPase-activating protein 1 | Q9Y3P9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rab-like protein 6 | Q3YEC7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rab-like protein 6 | Q3YEC7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Rab-like protein 6 | Q3YEC7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rab11 family-interacting protein 1 | Q6WKZ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rab11 family-interacting protein 1 | Q6WKZ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Rab11 family-interacting protein 1 | Q6WKZ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rab11 family-interacting protein 5 | Q9BXF6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0317303675110861 | . |
| Rab11 family-interacting protein 5 | Q9BXF6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00830038859579633 | . |
| Rab11 family-interacting protein 5 | Q9BXF6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rabankyrin-5 | Q9P2R3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rabankyrin-5 | Q9P2R3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Rabankyrin-5 | Q9P2R3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ran-binding protein 9 | Q96S59 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rapamycin-insensitive companion of mTOR | Q6R327 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rapamycin-insensitive companion of mTOR | Q6R327 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Rapamycin-insensitive companion of mTOR | Q6R327 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RAPH1 | Q70E73 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RAPH1 | Q70E73 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RAPH1 | Q70E73 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ras GTPase-activating protein 1 | P20936 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ras GTPase-activating protein 1 | P20936 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ras GTPase-activating protein 1 | P20936 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ras GTPase-activating protein nGAP | Q9UJF2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ras GTPase-activating protein nGAP | Q9UJF2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ras GTPase-activating protein nGAP | Q9UJF2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ras GTPase-activating-like protein IQGAP1 | P46940 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 6.39249344728909e-05 | . |
| Ras GTPase-activating-like protein IQGAP1 | P46940 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.2818681495025e-05 | . |
| Ras GTPase-activating-like protein IQGAP1 | P46940 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000327114947772482 | . |
| Ras GTPase-activating-like protein IQGAP3 | Q86VI3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00973302511985921 | . |
| Ras GTPase-activating-like protein IQGAP3 | Q86VI3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000546607874846081 | . |
| Ras GTPase-activating-like protein IQGAP3 | Q86VI3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000475808278711268 | . |
| Ras-related C3 botulinum toxin substrate 1 | P63000 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ras-related C3 botulinum toxin substrate 1 | P63000 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ras-related C3 botulinum toxin substrate 1 | P63000 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ras-related protein Rab-10 | P61026 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.84764590892768e-05 | . |
| Ras-related protein Rab-10 | P61026 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.90784615291961e-05 | . |
| Ras-related protein Rab-10 | P61026 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.81878137476639e-05 | . |
| Ras-related protein Rab-14 | P61106 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.201856908018352 | . |
| Ras-related protein Rab-14 | P61106 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0186492769287088 | . |
| Ras-related protein Rab-14 | P61106 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0130808804633287 | . |
| Ras-related protein Rab-1A | P62820 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ras-related protein Rab-1A | P62820 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ras-related protein Rab-1A | P62820 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ras-related protein Rab-1B | Q9H0U4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ras-related protein Rab-1B | Q9H0U4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ras-related protein Rab-1B | Q9H0U4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ras-related protein Rab-21 | Q9UL25 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0148688646929296 | . |
| Ras-related protein Rab-21 | Q9UL25 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00942890762968124 | . |
| Ras-related protein Rab-21 | Q9UL25 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00529319904837941 | . |
| Ras-related protein Rab-2A | P61019 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0145575503775402 | . |
| Ras-related protein Rab-2A | P61019 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00162695345598394 | . |
| Ras-related protein Rab-2A | P61019 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00102070786248417 | . |
| Ras-related protein Rab-35 | Q15286 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ras-related protein Rab-35 | Q15286 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ras-related protein Rab-35 | Q15286 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ras-related protein Rab-7a | P51149 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ras-related protein Rab-7a | P51149 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ras-related protein Rab-8A | P61006 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ras-related protein Rab-8A | P61006 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ras-related protein Rab-8B | Q92930 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ras-related protein Rab-8B | Q92930 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ras-related protein Rab-8B | Q92930 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 5.5312501977579e-06 | FC > 5 |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 4.59447055799679e-05 | FC > 5 |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 4.41953228747325e-05 | FC > 5 |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 3.39011090488141e-05 | FC > 5 |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 1.3502703081113e-05 | FC > 5 |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.000131610324501563 | FC > 5 |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.41953228747325e-05 | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 3.39011090488141e-05 | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000131610324501563 | . |
| Receptor-type tyrosine-protein phosphatase F | P10586 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Receptor-type tyrosine-protein phosphatase F | P10586 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Regulation of nuclear pre-mRNA domain-containing protein 2 | Q5VT52 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Regulation of nuclear pre-mRNA domain-containing protein 2 | Q5VT52 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Regulation of nuclear pre-mRNA domain-containing protein 2 | Q5VT52 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Regulator of chromosome condensation | P18754 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00140980949860279 | . |
| Regulator of chromosome condensation | P18754 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000624586627870362 | . |
| Regulator of chromosome condensation | P18754 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000602768622264659 | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.36936826552375e-05 | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000108118139750376 | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000101359754996225 | . |
| Regulatory-associated protein of mTOR | Q8N122 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Regulatory-associated protein of mTOR | Q8N122 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Regulatory-associated protein of mTOR | Q8N122 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RelA-associated inhibitor | Q8WUF5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RelA-associated inhibitor | Q8WUF5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Remodeling and spacing factor 1 | Q96T23 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Remodeling and spacing factor 1 | Q96T23 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Remodeling and spacing factor 1 | Q96T23 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Replication factor C subunit 1 | P35251 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.90341296785958e-05 | . |
| Replication factor C subunit 1 | P35251 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000124705848534096 | . |
| Replication factor C subunit 1 | P35251 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000120029502772979 | . |
| Reticulon-4 | Q9NQC3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Reticulon-4 | Q9NQC3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Reticulon-4 | Q9NQC3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Retinoblastoma-associated protein | P06400 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0510338779360245 | . |
| Retinoblastoma-associated protein | P06400 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0273226330161557 | . |
| Retinoblastoma-associated protein | P06400 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00279411396197359 | . |
| Retroviral-like aspartic protease 1 | Q53RT3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Retroviral-like aspartic protease 1 | Q53RT3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Retroviral-like aspartic protease 1 | Q53RT3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RGAP-iso | Q9H2M9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RGAP-iso | Q9H2M9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RGAP-iso | Q9H2M9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rho GTPase-activating protein 12 | Q8IWW6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rho GTPase-activating protein 12 | Q8IWW6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Rho GTPase-activating protein 12 | Q8IWW6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rho GTPase-activating protein 21 | Q5T5U3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rho GTPase-activating protein 21 | Q5T5U3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Rho GTPase-activating protein 21 | Q5T5U3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rho GTPase-activating protein 29 | Q52LW3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00699385534252739 | . |
| Rho GTPase-activating protein 29 | Q52LW3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00412959167086385 | . |
| Rho GTPase-activating protein 29 | Q52LW3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00238438395144149 | . |
| Rho GTPase-activating protein 35 | Q9NRY4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rho GTPase-activating protein 35 | Q9NRY4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rho GTPase-activating protein 5 | Q13017 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rho GTPase-activating protein 5 | Q13017 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Rho GTPase-activating protein 5 | Q13017 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rho guanine nucleotide exchange factor 1 | Q92888 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rho guanine nucleotide exchange factor 1 | Q92888 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rho guanine nucleotide exchange factor 11 | O15085 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rho guanine nucleotide exchange factor 11 | O15085 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Rho guanine nucleotide exchange factor 11 | O15085 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rho guanine nucleotide exchange factor 12 | Q9NZN5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rho guanine nucleotide exchange factor 17 | Q96PE2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00203671733848996 | . |
| Rho guanine nucleotide exchange factor 17 | Q96PE2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00106753612234824 | . |
| Rho guanine nucleotide exchange factor 17 | Q96PE2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000815288570265782 | . |
| Rho guanine nucleotide exchange factor 2 | Q92974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0501019986286672 | . |
| Rho guanine nucleotide exchange factor 2 | Q92974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00530869381947715 | . |
| Rho guanine nucleotide exchange factor 2 | Q92974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00274786442986964 | . |
| Rho guanine nucleotide exchange factor 40 | Q8TER5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rho guanine nucleotide exchange factor 40 | Q8TER5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Rho guanine nucleotide exchange factor 40 | Q8TER5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Rho-associated protein kinase 2 | O75116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Rho-associated protein kinase 2 | O75116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RIBIIR | P04844 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RIBIIR | P04844 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RIBIIR | P04844 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ribonucleases P/MRP protein subunit POP1 | Q99575 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00566695206852511 | . |
| Ribonucleases P/MRP protein subunit POP1 | Q99575 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00397536221449864 | . |
| Ribonucleases P/MRP protein subunit POP1 | Q99575 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000655454352494006 | . |
| Ribonucleoprotein PTB-binding 1 | Q8IY67 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ribonucleoprotein PTB-binding 1 | Q8IY67 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000233141443334889 | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000160072015701782 | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000153734666507236 | . |
| Ribosomal L1 domain-containing protein 1 | O76021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0148682173526925 | . |
| Ribosomal L1 domain-containing protein 1 | O76021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00146777902303758 | . |
| Ribosomal L1 domain-containing protein 1 | O76021 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000408949368301774 | . |
| Ribosomal RNA processing protein 1 homolog B | Q14684 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ribosomal RNA processing protein 1 homolog B | Q14684 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ribosomal RNA processing protein 1 homolog B | Q14684 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ribosomal RNA-processing protein 7 homolog A | Q9Y3A4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ribosomal RNA-processing protein 7 homolog A | Q9Y3A4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ribosome biogenesis protein BMS1 homolog | Q14692 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.99657213295445e-05 | . |
| Ribosome biogenesis protein BMS1 homolog | Q14692 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.16069690057679e-05 | . |
| Ribosome biogenesis protein BMS1 homolog | Q14692 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000516788795940524 | . |
| Ribosome biogenesis protein BOP1 | Q14137 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0184945230495865 | . |
| Ribosome biogenesis protein BOP1 | Q14137 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00684004880188796 | . |
| Ribosome biogenesis protein BOP1 | Q14137 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00176907957962386 | . |
| Ribosome biogenesis protein BRX1 homolog | Q8TDN6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ribosome biogenesis protein BRX1 homolog | Q8TDN6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ribosome biogenesis protein BRX1 homolog | Q8TDN6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ribosome biogenesis protein NOP53 | Q9NZM5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ribosome biogenesis protein NOP53 | Q9NZM5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ribosome biogenesis protein NOP53 | Q9NZM5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ribosome biogenesis protein NSA2 homolog | O95478 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ribosome biogenesis protein NSA2 homolog | O95478 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ribosome biogenesis protein NSA2 homolog | O95478 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ribosome biogenesis protein WDR12 | Q9GZL7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ribosome biogenesis protein WDR12 | Q9GZL7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ribosome biogenesis protein WDR12 | Q9GZL7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ribosome biogenesis regulatory protein homolog | Q15050 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ribosome biogenesis regulatory protein homolog | Q15050 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ribosome production factor 2 homolog | Q9H7B2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ribosome production factor 2 homolog | Q9H7B2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ribosome production factor 2 homolog | Q9H7B2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ribosome quality control complex subunit NEMF | O60524 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000483257402669529 | . |
| Ribosome quality control complex subunit NEMF | O60524 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000310916634013691 | . |
| Ribosome quality control complex subunit NEMF | O60524 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000181192529364067 | . |
| Ribosome-binding protein 1 | Q9P2E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.2890851829608e-05 | . |
| Ribosome-binding protein 1 | Q9P2E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000172783492962015 | . |
| Ribosome-binding protein 1 | Q9P2E9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000127615745537954 | . |
| RING-type E3 ubiquitin-protein ligase PPIL2 | Q13356 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RING-type E3 ubiquitin-protein ligase PPIL2 | Q13356 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RING-type E3 ubiquitin-protein ligase PPIL2 | Q13356 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RNA binding motif protein | Q96E39 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RNA binding motif protein | Q96E39 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RNA binding motif protein | Q96E39 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RNA cytidine acetyltransferase | Q9H0A0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000318366160194311 | . |
| RNA cytidine acetyltransferase | Q9H0A0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000253357865073301 | . |
| RNA cytidine acetyltransferase | Q9H0A0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000168303674922934 | . |
| RNA cytosine C(5)-methyltransferase NSUN2 | Q08J23 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RNA cytosine C(5)-methyltransferase NSUN2 | Q08J23 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RNA helicase aquarius | O60306 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0470522710072376 | . |
| RNA helicase aquarius | O60306 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0306153159226153 | . |
| RNA helicase aquarius | O60306 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RNA polymerase II-associated protein 1 | Q9BWH6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RNA polymerase II-associated protein 1 | Q9BWH6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RNA polymerase II-associated protein 1 | Q9BWH6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.71710096222289e-05 | . |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00047686508023451 | . |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000266068433842336 | . |
| RNA-binding protein 12B | Q8IXT5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000648827685510771 | . |
| RNA-binding protein 12B | Q8IXT5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00032540519337597 | . |
| RNA-binding protein 12B | Q8IXT5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000248617298579668 | . |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RNA-binding protein 15 | Q96T37 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000134866963240058 | . |
| RNA-binding protein 15 | Q96T37 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000129089405232793 | . |
| RNA-binding protein 15 | Q96T37 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000124485188945373 | . |
| RNA-binding protein 25 | P49756 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.019138693829553 | . |
| RNA-binding protein 25 | P49756 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000709453449901416 | . |
| RNA-binding protein 25 | P49756 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000252617434243477 | . |
| RNA-binding protein 26 | Q5T8P6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00027723743156352 | . |
| RNA-binding protein 26 | Q5T8P6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000155801641160007 | . |
| RNA-binding protein 26 | Q5T8P6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000132167001097967 | . |
| RNA-binding protein 27 | Q9P2N5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00204209317574782 | . |
| RNA-binding protein 27 | Q9P2N5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00161700696071199 | . |
| RNA-binding protein 27 | Q9P2N5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00151098533137876 | . |
| RNA-binding protein 28 | Q9NW13 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.70854034864541e-05 | . |
| RNA-binding protein 28 | Q9NW13 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000134329276272383 | . |
| RNA-binding protein 28 | Q9NW13 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000113537326120372 | . |
| RNA-binding protein 33 | Q96EV2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0316143236690149 | . |
| RNA-binding protein 33 | Q96EV2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00387100859215403 | . |
| RNA-binding protein 33 | Q96EV2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00278549831244118 | . |
| RNA-binding protein 34 | P42696 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0663112951278757 | . |
| RNA-binding protein 34 | P42696 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0383963851547018 | . |
| RNA-binding protein 34 | P42696 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00844367239302334 | . |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RNA-binding protein 6 | P78332 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RNA-binding protein 6 | P78332 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RNA-binding protein 6 | P78332 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 7.47920875773798e-05 | FC > 5 |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 2.0170822096433e-05 | FC > 5 |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 0.0941627363034745 | FC > 5 |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 0.041608684400766 | FC > 5 |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 0.0366122754584396 | FC > 5 |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.000651318572281715 | FC > 5 |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0941627363034745 | . |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.041608684400766 | . |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0366122754584396 | . |
| RNA-binding protein FXR2 | P51116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| RNA-binding protein FXR2 | P51116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RNA-binding protein FXR2 | P51116 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RNA-binding protein NOB1 | Q9ULX3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| RNA-binding protein NOB1 | Q9ULX3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Roundabout homolog 1 | Q9Y6N7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Roundabout homolog 1 | Q9Y6N7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Roundabout homolog 1 | Q9Y6N7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00745887242050956 | . |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0032290042995984 | . |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00152098327097669 | . |
| rRNA 2'-O-methyltransferase fibrillarin | P22087 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.138263174397678 | . |
| rRNA 2'-O-methyltransferase fibrillarin | P22087 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0092095918497457 | . |
| rRNA 2'-O-methyltransferase fibrillarin | P22087 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00111831545442202 | . |
| RRP12-like protein | Q5JTH9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00068167634725573 | . |
| RRP12-like protein | Q5JTH9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000404250586531224 | . |
| RRP12-like protein | Q5JTH9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000226805049439105 | . |
| Runt-related transcription factor 1 | Q01196 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Runt-related transcription factor 1 | Q01196 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Runt-related transcription factor 1 | Q01196 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0117632262296605 | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00158229072947519 | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00126538206950274 | . |
| S1 RNA-binding domain-containing protein 1 | Q8N5C6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| S1 RNA-binding domain-containing protein 1 | Q8N5C6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| S1 RNA-binding domain-containing protein 1 | Q8N5C6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sacsin | Q9NZJ4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SAFB-like transcription modulator | Q9NWH9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0188874498700978 | . |
| SAFB-like transcription modulator | Q9NWH9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00110623965907176 | . |
| SAFB-like transcription modulator | Q9NWH9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000599021486259345 | . |
| Salivary acidic proline-rich phosphoprotein 1/2 | P02810 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Scaffold attachment factor B2 | Q14151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000564873113326479 | . |
| Scaffold attachment factor B2 | Q14151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000464895472578616 | . |
| Scaffold attachment factor B2 | Q14151 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000308226451745767 | . |
| Scaffold-attachment factor A2 | Q1KMD3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Scaffold-attachment factor A2 | Q1KMD3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Schlafen family member 5 | Q08AF3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Schlafen family member 5 | Q08AF3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Schlafen family member 5 | Q08AF3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| SEC23-interacting protein | Q9Y6Y8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SEC23-interacting protein | Q9Y6Y8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SEC23-interacting protein | Q9Y6Y8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sec61 alpha-1 | P61619 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Sec61 alpha-1 | P61619 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Sec61 alpha-1 | P61619 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Secretory carrier-associated membrane protein 3 | O14828 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Secretory carrier-associated membrane protein 3 | O14828 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Secretory carrier-associated membrane protein 3 | O14828 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Selenocysteine-specific elongation factor | P57772 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Selenocysteine-specific elongation factor | P57772 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Selenocysteine-specific elongation factor | P57772 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sentrin-specific protease 1 | Q9P0U3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Sentrin-specific protease 1 | Q9P0U3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Sentrin-specific protease 1 | Q9P0U3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sentrin-specific protease 3 | Q9H4L4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Sentrin-specific protease 3 | Q9H4L4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Sentrin-specific protease 3 | Q9H4L4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Septin-11 | Q9NVA2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Septin-11 | Q9NVA2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Septin-11 | Q9NVA2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Septin-2 | Q15019 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.024405331301111 | . |
| Septin-2 | Q15019 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0185940419365763 | . |
| Septin-2 | Q15019 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00422984937586274 | . |
| Septin-7 | Q16181 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Septin-7 | Q16181 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Septin-9 | Q9UHD8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.26817564030797e-05 | . |
| Septin-9 | Q9UHD8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000223029489308594 | . |
| Septin-9 | Q9UHD8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000109496896963313 | . |
| SERCA2 | P16615 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0319114851500941 | . |
| SERCA2 | P16615 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000660355806534946 | . |
| SERCA2 | P16615 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00057386572517482 | . |
| Serine protease FAM111B | Q6SJ93 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine protease FAM111B | Q6SJ93 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine-protein kinase ATM | Q13315 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine-protein kinase ATM | Q13315 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine-protein kinase ATM | Q13315 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/arginine repetitive matrix protein 1 | Q8IYB3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00238765886017634 | . |
| Serine/arginine repetitive matrix protein 1 | Q8IYB3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0018180402091355 | . |
| Serine/arginine repetitive matrix protein 1 | Q8IYB3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000227255569380685 | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000549748696350739 | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000376631137561228 | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000319841723660365 | . |
| Serine/arginine-rich splicing factor 4 | Q08170 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/arginine-rich splicing factor 4 | Q08170 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/arginine-rich splicing factor 4 | Q08170 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/arginine-rich splicing factor 6 | Q13247 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/arginine-rich splicing factor 6 | Q13247 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/arginine-rich splicing factor 6 | Q13247 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase 10 | O94804 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/threonine-protein kinase 10 | O94804 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/threonine-protein kinase 10 | O94804 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase D2 | Q9BZL6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase greatwall | Q96GX5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/threonine-protein kinase greatwall | Q96GX5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/threonine-protein kinase greatwall | Q96GX5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase MARK2 | Q7KZI7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/threonine-protein kinase MARK2 | Q7KZI7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/threonine-protein kinase MARK2 | Q7KZI7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase MRCK beta | Q9Y5S2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/threonine-protein kinase MRCK beta | Q9Y5S2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/threonine-protein kinase MRCK beta | Q9Y5S2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase mTOR | P42345 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0100350909099628 | . |
| Serine/threonine-protein kinase mTOR | P42345 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00526149940547896 | . |
| Serine/threonine-protein kinase mTOR | P42345 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase N2 | Q16513 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/threonine-protein kinase N2 | Q16513 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/threonine-protein kinase N2 | Q16513 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase PAK 4 | O96013 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/threonine-protein kinase PAK 4 | O96013 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/threonine-protein kinase PAK 4 | O96013 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase PRP4 homolog | Q13523 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00931494907506333 | . |
| Serine/threonine-protein kinase PRP4 homolog | Q13523 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00656535350945149 | . |
| Serine/threonine-protein kinase PRP4 homolog | Q13523 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00567136487412144 | . |
| Serine/threonine-protein kinase SMG1 | Q96Q15 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/threonine-protein kinase SMG1 | Q96Q15 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase TBK1 | Q9UHD2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/threonine-protein kinase TBK1 | Q9UHD2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/threonine-protein kinase TBK1 | Q9UHD2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serine/threonine-protein kinase WNK1 | Q9H4A3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serine/threonine-protein kinase WNK1 | Q9H4A3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serine/threonine-protein kinase WNK1 | Q9H4A3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serpin B12 | Q96P63 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serpin B12 | Q96P63 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serpin B12 | Q96P63 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serpin B3 | P29508 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Serpin B3 | P29508 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Serpin B3 | P29508 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Serpin H1 | P50454 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.58067703876749e-05 | . |
| Serpin H1 | P50454 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000157574232576387 | . |
| Serpin H1 | P50454 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00014952602289197 | . |
| SH2 domain-containing protein 3A | Q9BRG2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SH3 and PX domain-containing protein 2A | Q5TCZ1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SH3 and PX domain-containing protein 2A | Q5TCZ1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SH3 and PX domain-containing protein 2A | Q5TCZ1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| SH3 and PX domain-containing protein 2B | A1X283 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000345475507530133 | . |
| SH3 and PX domain-containing protein 2B | A1X283 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00020168821050557 | . |
| SH3 and PX domain-containing protein 2B | A1X283 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000119314985440564 | . |
| SH3 domain-binding protein 4 | Q9P0V3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SH3 domain-binding protein 4 | Q9P0V3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SH3 domain-binding protein 4 | Q9P0V3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| SH3KBP1-binding protein 1 | Q8TBC3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SH3KBP1-binding protein 1 | Q8TBC3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SH3KBP1-binding protein 1 | Q8TBC3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sickle tail protein homolog | Q5T5P2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.52798342131905e-05 | . |
| Sickle tail protein homolog | Q5T5P2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00127155090368385 | . |
| Sickle tail protein homolog | Q5T5P2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00013520927526642 | . |
| Signal recognition particle subunit SRP68 | Q9UHB9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Signal recognition particle subunit SRP72 | O76094 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Signal recognition particle subunit SRP72 | O76094 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sipa-1 | Q96FS4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0142765493426056 | . |
| Sipa-1 | Q96FS4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0023856583461 | . |
| Sipa-1 | Q96FS4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000109019844078903 | . |
| SIPA1-like protein 1 | O43166 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SIPA1-like protein 1 | O43166 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SIPA1-like protein 1 | O43166 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| SK4 | O15554 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SKI2 subunit of superkiller complex protein | Q15477 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SKI2 subunit of superkiller complex protein | Q15477 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SKI2 subunit of superkiller complex protein | Q15477 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| SKI3 subunit of superkiller complex protein | Q6PGP7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SKI3 subunit of superkiller complex protein | Q6PGP7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SKI3 subunit of superkiller complex protein | Q6PGP7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| SLAIN motif-containing protein 2 | Q9P270 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SLAIN motif-containing protein 2 | Q9P270 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SLAIN motif-containing protein 2 | Q9P270 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Smad nuclear-interacting protein 1 | Q8TAD8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Smad nuclear-interacting protein 1 | Q8TAD8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Smad nuclear-interacting protein 1 | Q8TAD8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Small nuclear ribonucleoprotein Sm D1 | P62314 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.00984188531531e-05 | . |
| Small nuclear ribonucleoprotein Sm D1 | P62314 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00234733011661823 | . |
| Small nuclear ribonucleoprotein Sm D1 | P62314 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000534670353324285 | . |
| Small subunit processome component 20 homolog | O75691 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00994862496068932 | . |
| Small subunit processome component 20 homolog | O75691 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000536974178615961 | . |
| Small subunit processome component 20 homolog | O75691 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000375200729934107 | . |
| Small ubiquitin-related modifier 1 | P63165 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Small ubiquitin-related modifier 1 | P63165 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Small ubiquitin-related modifier 1 | P63165 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Small ubiquitin-related modifier 2 | P61956 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| SMC hinge domain-containing protein 1 | A6NHR9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.058667669214538 | . |
| SMC hinge domain-containing protein 1 | A6NHR9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0521527554738247 | . |
| SMC hinge domain-containing protein 1 | A6NHR9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00977279292469146 | . |
| SMC protein 1A | Q14683 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00335818724057274 | . |
| SMC protein 1A | Q14683 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.003029349177866 | . |
| SMC protein 1A | Q14683 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00179446443867013 | . |
| Smoothelin | P53814 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00360083534497393 | . |
| Smoothelin | P53814 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000606106039977368 | . |
| Smoothelin | P53814 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000164400321886031 | . |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sodium bicarbonate cotransporter 3 | Q9Y6M7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Sodium bicarbonate cotransporter 3 | Q9Y6M7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Sodium bicarbonate cotransporter 3 | Q9Y6M7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Sodium pump subunit alpha-1 | P05023 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Solute carrier family 12 member 2 | P55011 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Solute carrier family 12 member 2 | P55011 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Solute carrier family 12 member 2 | P55011 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Solute carrier family 35 member E1 | Q96K37 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Solute carrier family 35 member E1 | Q96K37 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Solute carrier family 35 member E1 | Q96K37 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Solute carrier family 35 member F2 | Q8IXU6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Solute carrier family 35 member F2 | Q8IXU6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Solute carrier family 35 member F2 | Q8IXU6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Son of sevenless homolog 1 | Q07889 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Son of sevenless homolog 1 | Q07889 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Son of sevenless homolog 1 | Q07889 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sorbin and SH3 domain-containing protein 1 | Q9BX66 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Sorbin and SH3 domain-containing protein 1 | Q9BX66 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Sorbin and SH3 domain-containing protein 1 | Q9BX66 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sorting nexin-17 | Q15036 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Sorting nexin-17 | Q15036 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Sorting nexin-17 | Q15036 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Spectrin alpha chain | Q13813 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Spectrin alpha chain | Q13813 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Spectrin beta chain | Q01082 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.424770639080947 | . |
| Spectrin beta chain | Q01082 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.246576565785987 | . |
| Spectrin beta chain | Q01082 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.102717563465126 | . |
| Spermatid perinuclear RNA-binding protein | Q96SI9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Spermatid perinuclear RNA-binding protein | Q96SI9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sphingomyelin phosphodiesterase 4 | Q9NXE4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Sphingomyelin phosphodiesterase 4 | Q9NXE4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Sphingomyelin phosphodiesterase 4 | Q9NXE4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sphingosine-1-phosphate lyase 1 | O95470 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Spliceosome-associated cyclophilin | Q96BP3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0005350853092366 | . |
| Spliceosome-associated cyclophilin | Q96BP3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000388002512402503 | . |
| Spliceosome-associated cyclophilin | Q96BP3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000293700063816975 | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Splicing factor 1 | Q15637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Splicing factor 1 | Q15637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Splicing factor 1 | Q15637 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Splicing factor 3B subunit 1 | O75533 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.537252496758137 | . |
| Splicing factor 3B subunit 1 | O75533 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.526665918351603 | . |
| Splicing factor 3B subunit 1 | O75533 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.01698590569983e-05 | . |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.91025733385256e-05 | . |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.66463445901395e-05 | . |
| Squalene monooxygenase | Q14534 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Squalene monooxygenase | Q14534 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Squalene monooxygenase | Q14534 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| SR-alpha | P08240 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00111858054574265 | . |
| SR-alpha | P08240 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00039620925708263 | . |
| SR-alpha | P08240 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000242908929071839 | . |
| SR-related and CTD-associated factor 4 | O95104 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SR-related and CTD-associated factor 4 | O95104 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SR-related and CTD-associated factor 4 | O95104 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| SR-related and CTD-associated factor 8 | Q9UPN6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SR-related and CTD-associated factor 8 | Q9UPN6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SR-related and CTD-associated factor 8 | Q9UPN6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| StAR-related lipid transfer protein 13 | Q9Y3M8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| StAR-related lipid transfer protein 13 | Q9Y3M8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| StAR-related lipid transfer protein 13 | Q9Y3M8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Sterile alpha motif domain-containing protein 9 | Q5K651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0860400183599703 | . |
| Sterile alpha motif domain-containing protein 9 | Q5K651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0465630952343316 | . |
| Sterile alpha motif domain-containing protein 9 | Q5K651 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0216257797856355 | . |
| Sterol O-acyltransferase 1 | P35610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Sterol O-acyltransferase 1 | P35610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Sterol O-acyltransferase 1 | P35610 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Stress-70 protein | P38646 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Stress-70 protein | P38646 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Stromal membrane-associated protein 1 | Q8IYB5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Stromal membrane-associated protein 1 | Q8IYB5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Structural maintenance of chromosomes protein 2 | O95347 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00354793494536887 | . |
| Structural maintenance of chromosomes protein 2 | O95347 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000155521534357564 | . |
| Structural maintenance of chromosomes protein 2 | O95347 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00015269057114721 | . |
| Structural maintenance of chromosomes protein 4 | Q9NTJ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 9.19060208216679e-05 | . |
| Structural maintenance of chromosomes protein 4 | Q9NTJ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000126367306925443 | . |
| Structural maintenance of chromosomes protein 4 | Q9NTJ3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00010706834805003 | . |
| Sucrose nonfermenting protein 2 homolog | O60264 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.484624086987537 | . |
| Sucrose nonfermenting protein 2 homolog | O60264 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.102719726848426 | . |
| Sucrose nonfermenting protein 2 homolog | O60264 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SUMO-activating enzyme subunit 2 | Q9UBT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.69865990811262e-05 | . |
| SUMO-activating enzyme subunit 2 | Q9UBT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00190585612465743 | . |
| SUMO-activating enzyme subunit 2 | Q9UBT2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000172593876059987 | . |
| SUN domain-containing protein 1 | O94901 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| SUN domain-containing protein 1 | O94901 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| SUN domain-containing protein 1 | O94901 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Supervillin | O95425 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0235627207561495 | . |
| Supervillin | O95425 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00246696373839263 | . |
| Supervillin | O95425 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00132655791087942 | . |
| Suppressor of SWI4 1 homolog | Q9NQ55 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Suppressor of SWI4 1 homolog | Q9NQ55 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Suppressor of SWI4 1 homolog | Q9NQ55 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Surfeit locus protein 4 | O15260 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.41232222353971e-05 | . |
| Surfeit locus protein 4 | O15260 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 4.29861670425888e-05 | . |
| Surfeit locus protein 4 | O15260 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.0812768681055e-05 | . |
| Synaptobrevin homolog YKT6 | O15498 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0321810882596054 | . |
| Synaptobrevin homolog YKT6 | O15498 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00278740376931656 | . |
| Synaptobrevin homolog YKT6 | O15498 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00112046315357908 | . |
| Synaptojanin-1 | O43426 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Synaptojanin-1 | O43426 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Synaptojanin-1 | O43426 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Synaptojanin-2 | O15056 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.576253106561494 | . |
| Synaptojanin-2 | O15056 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.338345373411542 | . |
| Synaptojanin-2 | O15056 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Synaptopodin | Q8N3V7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.85568776021217e-05 | . |
| Synaptopodin | Q8N3V7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.52724067599491e-05 | . |
| Synaptopodin | Q8N3V7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000134857958274539 | . |
| Synergin gamma | Q9UMZ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.321496646972777 | . |
| Synergin gamma | Q9UMZ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.278027102702483 | . |
| Syntaxin-binding protein 3 | O00186 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Syntaxin-binding protein 3 | O00186 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Syntaxin-binding protein 3 | O00186 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| T-complex protein 1 subunit delta | P50991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| T-complex protein 1 subunit delta | P50991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| T-complex protein 1 subunit delta | P50991 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| T-complex protein 1 subunit gamma | P49368 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| T-complex protein 1 subunit gamma | P49368 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| T-complex protein 1 subunit gamma | P49368 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| T-complex protein 1 subunit zeta | P40227 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| T-complex protein 1 subunit zeta | P40227 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| T-complex protein 1 subunit zeta | P40227 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| TAK1-binding protein 2 | Q9NYJ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| TAK1-binding protein 2 | Q9NYJ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| TAK1-binding protein 2 | Q9NYJ8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Talin-1 | Q9Y490 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 7.01728314537529e-05 | . |
| Talin-1 | Q9Y490 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.21536941943749e-05 | . |
| Talin-1 | Q9Y490 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00011086690056383 | . |
| Talin-2 | Q9Y4G6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Talin-2 | Q9Y4G6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Talin-2 | Q9Y4G6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| TAR DNA-binding protein 43 | Q13148 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.95781151972069e-05 | . |
| TAR DNA-binding protein 43 | Q13148 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.47961927302423e-05 | . |
| TAR DNA-binding protein 43 | Q13148 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000258908072708856 | . |
| Targeting protein for Xklp2 | Q9ULW0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000239280992637568 | . |
| Targeting protein for Xklp2 | Q9ULW0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000196553691926306 | . |
| Targeting protein for Xklp2 | Q9ULW0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000111011468545699 | . |
| TATA-binding protein-associated factor 172 | O14981 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| TATA-binding protein-associated factor 172 | O14981 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| TATA-binding protein-associated factor 172 | O14981 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Tau-protein kinase PRKAA1 | Q13131 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Tau-protein kinase PRKAA1 | Q13131 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Tau-protein kinase PRKAA1 | Q13131 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| TBC1 domain family member 1 | Q86TI0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.18216065296122e-05 | . |
| TBC1 domain family member 1 | Q86TI0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.27919110877996e-05 | . |
| TBC1 domain family member 1 | Q86TI0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000875185616144476 | . |
| TBC1 domain family member 10B | Q4KMP7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| TBC1 domain family member 10B | Q4KMP7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| TBC1 domain family member 10B | Q4KMP7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| TBC1 domain family member 4 | O60343 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| TBC1 domain family member 4 | O60343 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| TBC1 domain family member 4 | O60343 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Telomerase protein component 1 | Q99973 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Telomere-associated protein RIF1 | Q5UIP0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0505928015078999 | . |
| Telomere-associated protein RIF1 | Q5UIP0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0216312936112472 | . |
| Telomere-associated protein RIF1 | Q5UIP0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Tenascin | P24821 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.659269212139898 | . |
| Tenascin | P24821 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.548672497958352 | . |
| Tenascin | P24821 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.496389995352095 | . |
| Tensin-1 | Q9HBL0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0122848520175842 | . |
| Tensin-1 | Q9HBL0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0066007767171271 | . |
| Tensin-1 | Q9HBL0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00417431933983098 | . |
| Tensin-3 | Q68CZ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.169044450439846 | . |
| Tensin-3 | Q68CZ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0521725428602746 | . |
| Tensin-3 | Q68CZ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Terminal uridylyltransferase 7 | Q5VYS8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Terminal uridylyltransferase 7 | Q5VYS8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Terminal uridylyltransferase 7 | Q5VYS8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Testis-expressed protein 10 | Q9NXF1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Testis-expressed protein 10 | Q9NXF1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Tetracycline transporter-like protein | Q14728 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Tetracycline transporter-like protein | Q14728 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Tetracycline transporter-like protein | Q14728 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| TFIIH subunit XPB | P19447 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| TFIIH subunit XPB | P19447 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| TFIIH subunit XPB | P19447 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00153865007572099 | . |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000486075436472467 | . |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| THO complex subunit 2 | Q8NI27 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 6.4306166163904e-06 | . |
| THO complex subunit 2 | Q8NI27 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000348391834941072 | . |
| THO complex subunit 2 | Q8NI27 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000104812576715403 | . |
| Threonine--tRNA ligase 1 | P26639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00270915665149476 | . |
| Threonine--tRNA ligase 1 | P26639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00150324094016401 | . |
| Threonine--tRNA ligase 1 | P26639 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000160673273907092 | . |
| Thyroid hormone receptor-associated protein 3 | Q9Y2W1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.00685088771169e-05 | . |
| Thyroid hormone receptor-associated protein 3 | Q9Y2W1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000470148143609744 | . |
| Thyroid hormone receptor-associated protein 3 | Q9Y2W1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000120314693562567 | . |
| Thyroid receptor-interacting protein 6 | Q15654 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Thyroid receptor-interacting protein 6 | Q15654 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Thyroid receptor-interacting protein 6 | Q15654 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Tight junction protein ZO-1 | Q07157 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.09020932333175e-05 | . |
| Tight junction protein ZO-1 | Q07157 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.03471232103231e-05 | . |
| Tight junction protein ZO-1 | Q07157 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000100323028434253 | . |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.62454152759189e-05 | . |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.99933146607474e-05 | . |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 7.57672006237186e-05 | . |
| Titin | Q8WZ42 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Titin | Q8WZ42 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| TLC domain-containing protein 4 | Q96MV1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| TLC domain-containing protein 4 | Q96MV1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| TP53-binding protein 1 | Q12888 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| TP53-binding protein 1 | Q12888 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| TP53-binding protein 1 | Q12888 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| TRAF2 and NCK-interacting protein kinase | Q9UKE5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transcription activator BRG1 | P51532 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.68383408294954e-05 | . |
| Transcription activator BRG1 | P51532 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.11915704868683e-05 | . |
| Transcription activator BRG1 | P51532 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000130655027435934 | . |
| Transcription elongation factor SPT5 | O00267 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transcription elongation factor SPT6 | Q7KZ85 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transcription elongation factor SPT6 | Q7KZ85 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Transcription elongation factor SPT6 | Q7KZ85 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transcription factor 20 | Q9UGU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transcription factor 20 | Q9UGU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Transcription factor 20 | Q9UGU0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transcription factor ISGF-3 components p91/p84 | P42224 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transcription factor ISGF-3 components p91/p84 | P42224 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Transcription factor ISGF-3 components p91/p84 | P42224 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transcription factor p65 | Q04206 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.30254812904301e-05 | . |
| Transcription factor p65 | Q04206 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000249176554464078 | . |
| Transcription factor p65 | Q04206 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000125809176284766 | . |
| Transcription initiation factor TFIID subunit 2 | Q6P1X5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transcription termination factor 1 | Q15361 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0252896000299255 | . |
| Transcription termination factor 1 | Q15361 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transcription termination factor 1 | Q15361 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Transcription termination factor 2 | Q9UNY4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.521757930944366 | . |
| Transcription termination factor 2 | Q9UNY4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.10020637287139 | . |
| Transcription termination factor 2 | Q9UNY4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0275479983445222 | . |
| Transducin beta chain 1 | P62873 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transducin beta chain 1 | P62873 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Transducin beta chain 1 | P62873 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transducin beta-like protein 2 | Q9Y4P3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transducin beta-like protein 2 | Q9Y4P3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transducin beta-like protein 3 | Q12788 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00181422952019444 | . |
| Transducin beta-like protein 3 | Q12788 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0015765754486713 | . |
| Transducin beta-like protein 3 | Q12788 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0015418624228359 | . |
| Transferrin receptor protein 1 | P02786 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000540143531112257 | . |
| Transferrin receptor protein 1 | P02786 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000442451772317836 | . |
| Transferrin receptor protein 1 | P02786 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000216265213251757 | . |
| Transformation-related gene 3 protein | Q9Y512 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0274035418267868 | . |
| Transformation-related gene 3 protein | Q9Y512 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00381654391377916 | . |
| Transformation-related gene 3 protein | Q9Y512 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00171397172277511 | . |
| Transformer-2 protein homolog alpha | Q13595 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transformer-2 protein homolog beta | P62995 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transformer-2 protein homolog beta | P62995 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Transformer-2 protein homolog beta | P62995 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transforming growth factor beta-2 proprotein | P61812 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 1.92378955939562e-05 | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.50059219925333e-05 | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000209403711321358 | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00030399391948174 | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000228894513899733 | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000152857033433395 | . |
| Transmembrane 9 superfamily member 3 | Q9HD45 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transmembrane 9 superfamily member 3 | Q9HD45 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Transmembrane 9 superfamily member 3 | Q9HD45 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transmembrane 9 superfamily member 4 | Q92544 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.011422287865336 | . |
| Transmembrane 9 superfamily member 4 | Q92544 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00173620825048922 | . |
| Transmembrane 9 superfamily member 4 | Q92544 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000794308330707115 | . |
| Transmembrane protein 165 | Q9HC07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transmembrane protein 165 | Q9HC07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Transmembrane protein 165 | Q9HC07 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transmembrane protein 205 | Q6UW68 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Transmembrane protein 205 | Q6UW68 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Transmembrane protein 205 | Q6UW68 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Transmembrane protein 245 | Q9H330 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Treacle protein | Q13428 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 5.91634768323486e-05 | . |
| Treacle protein | Q13428 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.99740599934946e-05 | . |
| Treacle protein | Q13428 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000319274101184642 | . |
| Trinucleotide repeat-containing gene 6B protein | Q9UPQ9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00746782878239007 | . |
| Trinucleotide repeat-containing gene 6B protein | Q9UPQ9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00507006368611547 | . |
| Trinucleotide repeat-containing gene 6B protein | Q9UPQ9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00313706691324054 | . |
| Trip4 complex subunit p200 | Q8N3C0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.707150606011553 | . |
| Trip4 complex subunit p200 | Q8N3C0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.408992979238849 | . |
| Trip4 complex subunit p200 | Q8N3C0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0335377370013238 | . |
| Tripeptidyl-peptidase 2 | P29144 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.471527124491594 | . |
| Tripeptidyl-peptidase 2 | P29144 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.255357565897042 | . |
| Tripeptidyl-peptidase 2 | P29144 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0469060542569218 | . |
| Triple functional domain protein | O75962 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Triple functional domain protein | O75962 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Triple functional domain protein | O75962 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Tuberin | P49815 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 0.000599129643674537 | FC > 5 |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 0.000535869071573206 | FC > 5 |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 0.000494714203812102 | FC > 5 |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | . | FC > 5 |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | . | FC > 5 |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | . | FC > 5 |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Tudor domain-containing protein 3 | Q9H7E2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Tudor domain-containing protein 3 | Q9H7E2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Tudor domain-containing protein 7 | Q8NHU6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Tudor domain-containing protein 7 | Q8NHU6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Tumor protein p53-inducible protein 11 | O14683 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Tumor protein p53-inducible protein 11 | O14683 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Tyrosine--tRNA ligase | P54577 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0141845910421763 | . |
| Tyrosine--tRNA ligase | P54577 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00114472251186267 | . |
| Tyrosine--tRNA ligase | P54577 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000168634237882742 | . |
| Tyrosine-protein kinase ABL1 | P00519 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Tyrosine-protein kinase ABL1 | P00519 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Tyrosine-protein kinase ABL1 | P00519 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Tyrosine-protein kinase ABL2 | P42684 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.109919893431872 | . |
| Tyrosine-protein kinase ABL2 | P42684 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Tyrosine-protein kinase ABL2 | P42684 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Tyrosine-protein kinase BAZ1B | Q9UIG0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Tyrosine-protein kinase BAZ1B | Q9UIG0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Tyrosine-protein kinase BAZ1B | Q9UIG0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Tyrosine-protein kinase JAK1 | P23458 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Tyrosine-protein kinase JAK1 | P23458 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Tyrosine-protein kinase JAK1 | P23458 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| U3 small nucleolar RNA-associated protein 15 homolog | Q8TED0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000416049659103616 | . |
| U3 small nucleolar RNA-associated protein 15 homolog | Q8TED0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000209820915157994 | . |
| U3 small nucleolar RNA-associated protein 15 homolog | Q8TED0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000208906785961425 | . |
| U3 small nucleolar RNA-interacting protein 2 | O43818 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0140591735811039 | . |
| U3 small nucleolar RNA-interacting protein 2 | O43818 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00808210704880967 | . |
| U3 small nucleolar RNA-interacting protein 2 | O43818 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000834676545562333 | . |
| U4/U6 small nuclear ribonucleoprotein Prp3 | O43395 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.92948662160061e-05 | . |
| U4/U6 small nuclear ribonucleoprotein Prp3 | O43395 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 6.99840841280175e-05 | . |
| U4/U6 small nuclear ribonucleoprotein Prp3 | O43395 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 5.89743435775645e-05 | . |
| U4/U6.U5 tri-snRNP-associated protein 1 | O43290 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| U4/U6.U5 tri-snRNP-associated protein 1 | O43290 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| U4/U6.U5 tri-snRNP-associated protein 2 | Q53GS9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| U4/U6.U5 tri-snRNP-associated protein 2 | Q53GS9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| U4/U6.U5 tri-snRNP-associated protein 2 | Q53GS9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| UAP56-interacting factor | Q96QD9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| UAP56-interacting factor | Q96QD9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubinuclein-1 | Q9NPG3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 8.87116149977563e-05 | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00129730166770324 | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000140934026560614 | . |
| Ubiquitin carboxyl-terminal hydrolase 14 | P54578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 14 | P54578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 14 | P54578 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 16 | Q9Y5T5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 16 | Q9Y5T5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 16 | Q9Y5T5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 19 | O94966 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 19 | O94966 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 19 | O94966 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 24 | Q9UPU5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 24 | Q9UPU5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 24 | Q9UPU5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 34 | Q70CQ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 34 | Q70CQ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 34 | Q70CQ2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 48 | Q86UV5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 48 | Q86UV5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 48 | Q86UV5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 5 | P45974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.75408997904803e-05 | . |
| Ubiquitin carboxyl-terminal hydrolase 5 | P45974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.27864490457776e-05 | . |
| Ubiquitin carboxyl-terminal hydrolase 5 | P45974 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000140785607390714 | . |
| Ubiquitin carboxyl-terminal hydrolase 7 | Q93009 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0457792364390168 | . |
| Ubiquitin carboxyl-terminal hydrolase 7 | Q93009 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.026828948302248 | . |
| Ubiquitin carboxyl-terminal hydrolase 7 | Q93009 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0257562202992724 | . |
| Ubiquitin carboxyl-terminal hydrolase 8 | P40818 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 8 | P40818 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase 8 | P40818 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubiquitin carboxyl-terminal hydrolase BAP1 | Q92560 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.358801112679919 | . |
| Ubiquitin fusion degradation protein 1 | Q92890 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin fusion degradation protein 1 | Q92890 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubiquitin-associated protein 2 | Q5T6F2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin-associated protein 2 | Q5T6F2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ubiquitin-associated protein 2 | Q5T6F2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubiquitin-associated protein 2-like | Q14157 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0112053982381045 | . |
| Ubiquitin-associated protein 2-like | Q14157 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0078281862386982 | . |
| Ubiquitin-associated protein 2-like | Q14157 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000518534266602017 | . |
| Ubiquitin-like modifier-activating enzyme 1 | P22314 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 4.73402346939847e-05 | . |
| Ubiquitin-like modifier-activating enzyme 1 | P22314 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.16904133792824e-05 | . |
| Ubiquitin-like modifier-activating enzyme 1 | P22314 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.15946515308184e-05 | . |
| Ubiquitin-like modifier-activating enzyme 6 | A0AVT1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0318066784913632 | . |
| Ubiquitin-like modifier-activating enzyme 6 | A0AVT1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00107174644018231 | . |
| Ubiquitin-like modifier-activating enzyme 6 | A0AVT1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000121951301538803 | . |
| Ubiquitin-like protein ISG15 | P05161 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ubiquitin-like protein ISG15 | P05161 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Ubiquitin-protein ligase O | Q9C0C9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Ubiquitin-protein ligase O | Q9C0C9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Ubiquitin-protein ligase O | Q9C0C9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| UDP-glucose 6-dehydrogenase | O60701 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0106565686461851 | . |
| UDP-glucose 6-dehydrogenase | O60701 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00918900556797281 | . |
| UDP-glucose 6-dehydrogenase | O60701 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00481052979571834 | . |
| UDP-glucose:glycoprotein glucosyltransferase 1 | Q9NYU2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000222212312495626 | . |
| UDP-glucose:glycoprotein glucosyltransferase 1 | Q9NYU2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000162350349383456 | . |
| UDP-glucose:glycoprotein glucosyltransferase 1 | Q9NYU2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000101747392826172 | . |
| Uncharacterized protein FLJ45252 | Q6ZSR9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00056303824063167 | . |
| Uncharacterized protein FLJ45252 | Q6ZSR9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000406501491798579 | . |
| Uncharacterized protein FLJ45252 | Q6ZSR9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000542764116864908 | . |
| Uncharacterized protein KIAA1671 | Q9BY89 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0153652909956402 | . |
| Uncharacterized protein KIAA1671 | Q9BY89 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00201720176879071 | . |
| Uncharacterized protein KIAA1671 | Q9BY89 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000420892481994074 | . |
| Unconventional myosin-Ib | O43795 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 9.9387713410714e-05 | . |
| Unconventional myosin-Ib | O43795 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 6.31714261960716e-05 | . |
| Unconventional myosin-Ib | O43795 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.95706167872785e-05 | . |
| Unconventional myosin-Ic | O00159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h | P-value = 6.46723369898873e-05 | FC > 5 |
| Unconventional myosin-Ic | O00159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h, +IFN | P-value = 4.59659086640931e-06 | FC > 5 |
| Unconventional myosin-Ic | O00159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 1 h | P-value = 3.79209737191017e-05 | FC > 5 |
| Unconventional myosin-Ic | O00159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h | P-value = 3.56649881605923e-05 | FC > 5 |
| Unconventional myosin-Ic | O00159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 3 h, +IFN | P-value = 3.36752692791543e-06 | FC > 5 |
| Unconventional myosin-Ic | O00159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | U2OS Cells (Human osteosarcoma cell) | . | Bone | 0.2 h, +IFN | P-value = 1.50443243714909e-05 | FC > 5 |
| Unconventional myosin-Ic | O00159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.46723369898873e-05 | . |
| Unconventional myosin-Ic | O00159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 3.79209737191017e-05 | . |
| Unconventional myosin-Ic | O00159 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.56649881605923e-05 | . |
| Unconventional myosin-Id | O94832 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 7.09699300028754e-05 | . |
| Unconventional myosin-Id | O94832 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00015452174887095 | . |
| Unconventional myosin-Id | O94832 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000115424899957021 | . |
| Unconventional myosin-Ie | Q12965 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0326554404557107 | . |
| Unconventional myosin-Ie | Q12965 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0223696617317546 | . |
| Unconventional myosin-Ie | Q12965 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Unconventional myosin-IXb | Q13459 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Unconventional myosin-IXb | Q13459 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Unconventional myosin-IXb | Q13459 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Unconventional myosin-Va | Q9Y4I1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Unconventional myosin-Va | Q9Y4I1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Unconventional myosin-Va | Q9Y4I1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Unconventional myosin-VI | Q9UM54 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.16994146964733e-05 | . |
| Unconventional myosin-VI | Q9UM54 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 7.51021236694152e-05 | . |
| Unconventional myosin-VI | Q9UM54 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 3.80278210696198e-05 | . |
| Unconventional myosin-XIX | Q96H55 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Unconventional myosin-XVIIIa | Q92614 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Unconventional myosin-XVIIIa | Q92614 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Unconventional myosin-XVIIIa | Q92614 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Unconventional myosin-XVIIIb | Q8IUG5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Unconventional myosin-XVIIIb | Q8IUG5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Unconventional myosin-XVIIIb | Q8IUG5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Unhealthy ribosome biogenesis protein 2 homolog | Q14146 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Unhealthy ribosome biogenesis protein 2 homolog | Q14146 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Unhealthy ribosome biogenesis protein 2 homolog | Q14146 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Up-regulator of cell proliferation | Q8TCY9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Up-regulator of cell proliferation | Q8TCY9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| UTP--glucose-1-phosphate uridylyltransferase | Q16851 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.230888394735543 | . |
| UTP--glucose-1-phosphate uridylyltransferase | Q16851 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.146302496868748 | . |
| UTP--glucose-1-phosphate uridylyltransferase | Q16851 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0604926275531119 | . |
| Utrophin | P46939 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Utrophin | P46939 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Utrophin | P46939 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Valine--tRNA ligase | P26640 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 5.49833948487572e-05 | . |
| Valine--tRNA ligase | P26640 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.7447933461648e-05 | . |
| Valine--tRNA ligase | P26640 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.48964223533507e-05 | . |
| Vasodilator-stimulated phosphoprotein | P50552 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00151008214555691 | . |
| Vasodilator-stimulated phosphoprotein | P50552 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00103425423175514 | . |
| Vasodilator-stimulated phosphoprotein | P50552 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000879431470092822 | . |
| VDAC-1 | P21796 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| VDAC-2 | P45880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000488090916962189 | . |
| VDAC-2 | P45880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000288469256776754 | . |
| VDAC-2 | P45880 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000187573729236251 | . |
| Very long-chain specific acyl-CoA dehydrogenase | P49748 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Very long-chain specific acyl-CoA dehydrogenase | P49748 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Very long-chain specific acyl-CoA dehydrogenase | P49748 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Very-long-chain enoyl-CoA reductase | Q9NZ01 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.12611466103231e-05 | . |
| Very-long-chain enoyl-CoA reductase | Q9NZ01 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 2.62374771143808e-05 | . |
| Very-long-chain enoyl-CoA reductase | Q9NZ01 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 1.0614904736731e-05 | . |
| Vesicle transport protein GOT1B | Q9Y3E0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 4.75880282839438e-05 | . |
| Vesicle transport protein GOT1B | Q9Y3E0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000667206868279756 | . |
| Vesicle transport protein GOT1B | Q9Y3E0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000141983565743779 | . |
| Vesicle-fusing ATPase | P46459 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00255126773041853 | . |
| Vesicle-fusing ATPase | P46459 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000801217255996117 | . |
| Vesicle-fusing ATPase | P46459 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000431311676158582 | . |
| Vigilin | Q00341 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 9.4783521758637e-05 | . |
| Vigilin | Q00341 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.23451018961297e-05 | . |
| Vigilin | Q00341 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 6.14009405792342e-05 | . |
| Vimentin | P08670 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Vimentin | P08670 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| WASH complex subunit 2A | Q641Q2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0409511389862304 | . |
| WASH complex subunit 2A | Q641Q2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0132515402067406 | . |
| WASH complex subunit 2A | Q641Q2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0044739469346907 | . |
| WASH complex subunit 2C | Q9Y4E1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0954736529810208 | . |
| WASH complex subunit 2C | Q9Y4E1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0314475128575189 | . |
| WASH complex subunit 2C | Q9Y4E1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0151887233021603 | . |
| WASH complex subunit 4 | Q2M389 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| WD repeat and HMG-box DNA-binding protein 1 | O75717 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| WD repeat and HMG-box DNA-binding protein 1 | O75717 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| WD repeat and HMG-box DNA-binding protein 1 | O75717 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| WD repeat-containing protein 1 | O75083 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0106954861421149 | . |
| WD repeat-containing protein 1 | O75083 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00018101176437014 | . |
| WD repeat-containing protein 1 | O75083 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000147646456982845 | . |
| WD repeat-containing protein 11 | Q9BZH6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| WD repeat-containing protein 11 | Q9BZH6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| WD repeat-containing protein 11 | Q9BZH6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| WD repeat-containing protein 13 | Q9H1Z4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0833051594608148 | . |
| WD repeat-containing protein 13 | Q9H1Z4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0123664172503316 | . |
| WD repeat-containing protein 13 | Q9H1Z4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00272496141921574 | . |
| WD repeat-containing protein 3 | Q9UNX4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0012622482039196 | . |
| WD repeat-containing protein 3 | Q9UNX4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00118477622821772 | . |
| WD repeat-containing protein 3 | Q9UNX4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000606734507439526 | . |
| WD repeat-containing protein 36 | Q8NI36 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 4.17556014655152e-05 | . |
| WD repeat-containing protein 36 | Q8NI36 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.91305165618739e-05 | . |
| WD repeat-containing protein 36 | Q8NI36 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000112288448022112 | . |
| WD repeat-containing protein 43 | Q15061 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| WD repeat-containing protein 43 | Q15061 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| WD repeat-containing protein 43 | Q15061 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| WD repeat-containing protein 46 | O15213 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| WD repeat-containing protein 46 | O15213 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| WD repeat-containing protein 46 | O15213 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| WD repeat-containing protein 50 | Q9Y5J1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| WD repeat-containing protein 50 | Q9Y5J1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| WD repeat-containing protein 50 | Q9Y5J1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| WD repeat-containing protein 6 | Q9NNW5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| WD repeat-containing protein 6 | Q9NNW5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| WD repeat-containing protein 6 | Q9NNW5 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| WD repeat-containing protein 70 | Q9NW82 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| WD repeat-containing protein 70 | Q9NW82 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| WD repeat-containing protein 70 | Q9NW82 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| WD repeat-containing protein 75 | Q8IWA0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 7.8321829380931e-05 | . |
| WD repeat-containing protein 75 | Q8IWA0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000180590819907681 | . |
| WD repeat-containing protein 75 | Q8IWA0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000101135795156084 | . |
| WD repeat-containing protein 91 | A4D1P6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.747711325575434 | . |
| WD repeat-containing protein 91 | A4D1P6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.036385112980557 | . |
| WD repeat-containing protein 91 | A4D1P6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.036331293428456 | . |
| WD40 repeat-containing protein SMU1 | Q2TAY7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 2.6680396141942e-05 | . |
| WD40 repeat-containing protein SMU1 | Q2TAY7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00985866536105466 | . |
| WD40 repeat-containing protein SMU1 | Q2TAY7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000523355382472673 | . |
| Wings apart-like protein homolog | Q7Z5K2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Wings apart-like protein homolog | Q7Z5K2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Wings apart-like protein homolog | Q7Z5K2 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Wolframin | O76024 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000934081809643976 | . |
| Wolframin | O76024 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000495019358259534 | . |
| Wolframin | O76024 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000129639315668245 | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00332705360642828 | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000568219736892593 | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000216018754846562 | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0173884468414422 | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00647601146848117 | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000214009456991973 | . |
| Xaa-Pro dipeptidase | P12955 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00592274490542728 | . |
| Xaa-Pro dipeptidase | P12955 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.00338344482414871 | . |
| Xaa-Pro dipeptidase | P12955 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.00256848860449429 | . |
| YLP motif-containing protein 1 | P49750 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000371029917815744 | . |
| YLP motif-containing protein 1 | P49750 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.00028841586116535 | . |
| YLP motif-containing protein 1 | P49750 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000270530781244566 | . |
| YTH domain-containing family protein 1 | Q9BYJ9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| YTH domain-containing family protein 1 | Q9BYJ9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| YTH domain-containing family protein 2 | Q9Y5A9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.33970080411709e-05 | . |
| YTH domain-containing family protein 2 | Q9Y5A9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000154946974737978 | . |
| YTH domain-containing family protein 2 | Q9Y5A9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000120686541682338 | . |
| YTH domain-containing family protein 3 | Q7Z739 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 8.21782041720162e-05 | . |
| YTH domain-containing family protein 3 | Q7Z739 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.07389233119973e-05 | . |
| YTH domain-containing family protein 3 | Q7Z739 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.01866045176332e-05 | . |
| Zinc finger CCCH domain-containing protein 11A | O75152 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000291037982018442 | . |
| Zinc finger CCCH domain-containing protein 11A | O75152 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000137557277795453 | . |
| Zinc finger CCCH domain-containing protein 11A | O75152 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000104508076976133 | . |
| Zinc finger CCCH domain-containing protein 13 | Q5T200 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.336045928700473 | . |
| Zinc finger CCCH domain-containing protein 13 | Q5T200 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.105965751427223 | . |
| Zinc finger CCCH domain-containing protein 13 | Q5T200 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.0549203081516649 | . |
| Zinc finger CCCH domain-containing protein 14 | Q6PJT7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Zinc finger CCCH domain-containing protein 14 | Q6PJT7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Zinc finger CCCH domain-containing protein 14 | Q6PJT7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Zinc finger CCCH domain-containing protein 4 | Q9UPT8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Zinc finger CCCH domain-containing protein 4 | Q9UPT8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Zinc finger CCCH domain-containing protein 4 | Q9UPT8 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Zinc finger CCCH domain-containing protein 7A | Q8IWR0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.0552107439341621 | . |
| Zinc finger CCCH domain-containing protein 7A | Q8IWR0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Zinc finger CCCH domain-containing protein 7A | Q8IWR0 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.000749986738276719 | . |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000345123820696116 | . |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.000289672519405844 | . |
| Zinc finger MIZ domain-containing protein 2 | Q8NF64 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Zinc finger MIZ domain-containing protein 2 | Q8NF64 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Zinc finger protein 185 | O15231 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.799537270003643 | . |
| Zinc finger protein 185 | O15231 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.70511242413673 | . |
| Zinc finger protein 185 | O15231 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.446627652481102 | . |
| Zinc finger protein 207 | O43670 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Zinc finger protein 281 | Q9Y2X9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Zinc finger protein 281 | Q9Y2X9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Zinc finger protein 281 | Q9Y2X9 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Zinc finger protein 318 | Q5VUA4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Zinc finger protein 318 | Q5VUA4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Zinc finger protein 318 | Q5VUA4 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Zinc finger protein 508 | Q6IQ32 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Zinc finger protein 508 | Q6IQ32 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Zinc finger protein 512 | Q96ME7 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Zinc finger protein 638 | Q14966 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Zinc finger protein 638 | Q14966 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Zinc finger protein 638 | Q14966 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Zinc finger protein 828 | Q96JM3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Zinc finger protein 828 | Q96JM3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Zinc finger protein 828 | Q96JM3 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 8.63931736804696e-05 | . |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 8.56223275862888e-05 | . |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.000175381034453595 | . |
| Zinc phosphodiesterase ELAC protein 2 | Q9BQ52 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| Zinc phosphodiesterase ELAC protein 2 | Q9BQ52 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
| Zinc phosphodiesterase ELAC protein 2 | Q9BQ52 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | . | . |
| [F-actin]-monooxygenase MICAL2 | O94851 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 0.2 h | P = 0.214736870224793 | . |
| [F-actin]-monooxygenase MICAL2 | O94851 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | P = 0.190752499906735 | . |
| [F-actin]-monooxygenase MICAL2 | O94851 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | P = 0.0267325920092835 | . |
| [F-actin]-monooxygenase MICAL3 | Q7RTP6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 3 h | . | . |
| [F-actin]-monooxygenase MICAL3 | Q7RTP6 | Homo sapiens | Pro Info | VIRal Cross-Linking And Solid-phase Purification (VIR-CLASP) | BHK-21 Cells (Small hamster kidney fibroblast) | . | Kidney | 1 h | . | . |
Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| GO Term | GO Category | GO ID | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|---|
| RNA Binding | Molecular Function |
GO:0003723
|
2.79E-185 | 8.850393089 | 3818.653389 |
| Cadherin Binding | Molecular Function |
GO:0045296
|
8.67E-42 | 7.292122731 | 731.904616 |
| mRNA Binding | Molecular Function |
GO:0003729
|
7.82E-28 | 5.94767194 | 403.4355997 |
| Actin Binding | Molecular Function |
GO:0003779
|
1.96E-13 | 4.924220305 | 169.3387181 |
| Purine Ribonucleoside Triphosphate Binding | Molecular Function |
GO:0035639
|
1.80E-11 | 2.860331542 | 84.79260125 |
| ATP Binding | Molecular Function |
GO:0005524
|
5.65E-11 | 3.525346062 | 99.83098511 |
| Adenyl Ribonucleotide Binding | Molecular Function |
GO:0032559
|
8.88E-11 | 3.325577201 | 92.15675651 |
| Microtubule Binding | Molecular Function |
GO:0008017
|
2.08E-10 | 3.680690453 | 98.38307557 |
| mRNA 5'-UTR Binding | Molecular Function |
GO:0048027
|
1.99E-09 | 20.16237471 | 490.9452681 |
| Tubulin Binding | Molecular Function |
GO:0015631
|
3.54E-09 | 3.021332809 | 71.51279715 |
| Kinase Binding | Molecular Function |
GO:0019900
|
8.95E-08 | 2.461561984 | 50.07938861 |
| Double-Stranded RNA Binding | Molecular Function |
GO:0003725
|
1.72E-07 | 6.418452535 | 125.8195225 |
| Ribosome Binding | Molecular Function |
GO:0043022
|
1.75E-07 | 5.364919355 | 104.6478668 |
| DNA Binding | Molecular Function |
GO:0003677
|
2.72E-07 | 1.986150192 | 37.71927735 |
| rRNA Binding | Molecular Function |
GO:0019843
|
7.23E-07 | 7.684530245 | 137.8993821 |
| GTPase Binding | Molecular Function |
GO:0051020
|
8.70E-07 | 3.050048184 | 53.79383935 |
| mRNA 3'-UTR Binding | Molecular Function |
GO:0003730
|
8.70E-07 | 4.749744898 | 83.76020667 |
| snoRNA Binding | Molecular Function |
GO:0030515
|
9.86E-07 | 10.38876049 | 181.3070157 |
| aminoacyl-tRNA Ligase Activity | Molecular Function |
GO:0004812
|
1.31E-06 | 8.760148838 | 149.926442 |
| Ubiquitin-Like Protein Ligase Binding | Molecular Function |
GO:0044389
|
1.81E-06 | 2.686999845 | 44.97412402 |
| Intracellular Non-Membrane-Bounded Organelle | Cellular Component |
GO:0043232
|
1.66E-69 | 4.697375049 | 771.2689715 |
| Intracellular Membrane-Bounded Organelle | Cellular Component |
GO:0043231
|
3.75E-54 | 2.559968957 | 328.0421999 |
| Nuclear Lumen | Cellular Component |
GO:0031981
|
1.24E-53 | 4.956307355 | 627.1737049 |
| Nucleolus | Cellular Component |
GO:0005730
|
8.53E-52 | 4.873635029 | 594.6879579 |
| Nucleus | Cellular Component |
GO:0005634
|
1.06E-49 | 2.517707993 | 294.5183822 |
| Cell-Substrate Junction | Cellular Component |
GO:0030055
|
2.44E-36 | 5.678141727 | 488.4594756 |
| Focal Adhesion | Cellular Component |
GO:0005925
|
9.03E-36 | 5.682976959 | 480.575366 |
| Small-Subunit Processome | Cellular Component |
GO:0032040
|
2.36E-29 | 19.92007931 | 1387.510445 |
| Cytoskeleton | Cellular Component |
GO:0005856
|
1.08E-25 | 3.701458538 | 226.1939169 |
| Actin Cytoskeleton | Cellular Component |
GO:0015629
|
1.14E-18 | 4.200883065 | 188.3075901 |
| Chromosome | Cellular Component |
GO:0005694
|
3.49E-16 | 5.722958398 | 223.2611874 |
| Microtubule Cytoskeleton | Cellular Component |
GO:0015630
|
1.13E-14 | 3.606366559 | 127.8223293 |
| Polymeric Cytoskeletal Fiber | Cellular Component |
GO:0099513
|
9.48E-14 | 3.945481233 | 131.1433484 |
| Cytosolic Large Ribosomal Subunit | Cellular Component |
GO:0022625
|
6.27E-13 | 11.49014778 | 358.5629981 |
| Large Ribosomal Subunit | Cellular Component |
GO:0015934
|
6.27E-13 | 11.49014778 | 358.5629981 |
| Nuclear Chromosome | Cellular Component |
GO:0000228
|
3.55E-12 | 6.710142317 | 197.3384186 |
| Ribosome | Cellular Component |
GO:0005840
|
3.60E-12 | 9.400617401 | 275.7463545 |
| Microtubule | Cellular Component |
GO:0005874
|
1.57E-11 | 4.292416803 | 119.3564041 |
| Cytoplasmic Stress Granule | Cellular Component |
GO:0010494
|
1.12E-10 | 7.104412527 | 183.1901589 |
| Ficolin-1-Rich Granule | Cellular Component |
GO:0101002
|
3.37E-09 | 3.791249233 | 84.6549217 |
| Ribosome Biogenesis | Biological Process |
GO:0042254
|
7.23E-37 | 12.01744186 | 1098.738771 |
| Gene Expression | Biological Process |
GO:0010467
|
5.77E-30 | 6.177624879 | 462.3483446 |
| rRNA Processing | Biological Process |
GO:0006364
|
3.70E-28 | 13.91583872 | 977.9447617 |
| Ribonucleoprotein Complex Biogenesis | Biological Process |
GO:0022613
|
1.84E-26 | 11.24996446 | 743.4460486 |
| ncRNA Processing | Biological Process |
GO:0034470
|
2.93E-25 | 12.54882155 | 791.7075667 |
| Translation | Biological Process |
GO:0006412
|
3.77E-22 | 5.844262765 | 325.8175484 |
| rRNA Metabolic Process | Biological Process |
GO:0016072
|
4.72E-22 | 12.03462992 | 666.3664898 |
| Ribosomal Small Subunit Biogenesis | Biological Process |
GO:0042274
|
1.79E-20 | 12.09798832 | 624.2957648 |
| Macromolecule Biosynthetic Process | Biological Process |
GO:0009059
|
7.84E-20 | 6.349864401 | 317.532494 |
| Cytoplasmic Translation | Biological Process |
GO:0002181
|
1.21E-18 | 10.11343284 | 476.9635267 |
| mRNA Splicing, Via Spliceosome | Biological Process |
GO:0000398
|
1.91E-17 | 5.335581545 | 236.4296806 |
| Regulation Of Translation | Biological Process |
GO:0006417
|
5.67E-17 | 5.381829323 | 232.1477388 |
| Peptide Biosynthetic Process | Biological Process |
GO:0043043
|
1.02E-16 | 6.223386361 | 264.2621176 |
| mRNA Processing | Biological Process |
GO:0006397
|
1.61E-16 | 5.103302888 | 214.0076951 |
| RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile | Biological Process |
GO:0000377
|
9.51E-16 | 5.500429465 | 220.5241042 |
| RNA Processing | Biological Process |
GO:0006396
|
1.01E-14 | 5.223260315 | 196.7255452 |
| protein-RNA Complex Assembly | Biological Process |
GO:0022618
|
1.18E-14 | 5.88922138 | 220.5472863 |
| DNA Metabolic Process | Biological Process |
GO:0006259
|
1.54E-13 | 3.88341958 | 135.2198608 |
| DNA Damage Response | Biological Process |
GO:0006974
|
2.70E-12 | 3.240564374 | 103.3922979 |
| Regulation Of mRNA Splicing, Via Spliceosome | Biological Process |
GO:0048024
|
3.20E-12 | 7.160292659 | 226.8683349 |
Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| RNA transport | KEGG Pathway | 2.90E-17 | 5.719180112 | 250.2390463 |
| Coronavirus disease | KEGG Pathway | 4.09E-13 | 4.247056747 | 142.3124229 |
| Ribosome biogenesis in eukaryotes | KEGG Pathway | 4.45E-13 | 6.697602066 | 221.1530161 |
| Spliceosome | KEGG Pathway | 7.27E-13 | 5.315499607 | 171.373643 |
| Ribosome | KEGG Pathway | 3.83E-12 | 4.952993106 | 150.3520152 |
| Protein processing in endoplasmic reticulum | KEGG Pathway | 2.29E-10 | 4.31033805 | 112.422861 |
| Pathogenic Escherichia coli infection | KEGG Pathway | 1.80E-08 | 3.595996537 | 77.53379226 |
| RNA degradation | KEGG Pathway | 4.33E-06 | 4.891753863 | 78.01043295 |
| Tight junction | KEGG Pathway | 5.26E-06 | 3.255666893 | 50.9004907 |
| Amyotrophic lateral sclerosis | KEGG Pathway | 1.60E-05 | 2.320345293 | 33.44626358 |
| Thyroid hormone signaling pathway | KEGG Pathway | 2.45E-05 | 3.574267657 | 49.67068205 |
| Endocytosis | KEGG Pathway | 8.21E-05 | 2.495483918 | 31.44103217 |
| Salmonella infection | KEGG Pathway | 0.000146017 | 2.449179785 | 29.25199935 |
| HIF-1 signaling pathway | KEGG Pathway | 0.000146531 | 3.440988372 | 40.83066986 |
| Aminoacyl-tRNA biosynthesis | KEGG Pathway | 0.000357508 | 4.229756718 | 46.1257377 |
| Glycolysis / Gluconeogenesis | KEGG Pathway | 0.000405938 | 4.148192664 | 44.44156334 |
| Bacterial invasion of epithelial cells | KEGG Pathway | 0.000552566 | 3.772998291 | 39.02969886 |
| Mismatch repair | KEGG Pathway | 0.001090948 | 7.643489383 | 73.4316931 |
| DNA replication | KEGG Pathway | 0.001146724 | 5.517353515 | 52.43229899 |
| Citrate cycle | KEGG Pathway | 0.001289755 | 6.144832126 | 57.35785553 |
Virus RNA Sequence Information
|
>MW473668.1 Chikungunya virus strain 181/25, complete genome
ACCAGTTTCTTACTGCTCTACTCTGCAAAGCAAGAGATTAATAACCCATCATGGATTCTGTGTACGTGGA
CATAGACGCTGACAGCGCCTTTTTGAAGGCCCTGCAACGTGCGTACCCCATGTTTGAGGTGGAACCTAGG
CAGGTCACATCGAATGACCATGCTAATGCTAGAGCGTTCTCGCATCTAGCCATAAAACTAATAGAGCAGG
AAATTGATCCCGACTCAACCATCCTGGATATAGGTAGTGCGCCAGCAAGGAGGATGATGTCGGACAGGAA
GTACCACTGCGTTTGCCCGATGCGCAGCGCAGAAGATCCCGAGAGACTCGCTAATTATGCGAGAAAGCTC
GCATCTGCCGCAGGAAAAGTCCTGGACAGAAACATTTCTGGAAAGATCGGGGACTTACAAGCGGTGATGG
CCGTGCCAGACACGGAGACGCCAACATTTTGCTTACACACAGATGTCTCATGTAGACAGAGAGCAGACGT
CGCGATATACCAAGACGTCTATGCTGTACACGCACCCACGTCGCTATACCACCAGGCGATTAAAGGAGTC
CGAGTGGCGTACTGGGTAGGGTTCGACACAACCCCGTTCATGTACAACGCTATGGCGGGTGCCTACCCCT
CATACTCGACAAATTGGGCGGATGAGCAGGTACTGAAGGCTAAGAACATAGGATTATGTTCAACAGACCT
GACGGAAGGTAGACGAGGCAAATTGTCTATCATGAGAGGGAAAAAGCTAAAACCGTGCGACCGTGTGCTG
TTCTCAGTAGGGTCAACGCTTTACCCGGAAAGCCGCACGCTACTTAAGAGCTGGCACCTACCATCGGTGT
TCCATCTAAAGGGCAAGCTTAGCTTCACATGCCGCTGTGACACAGTGGTTTCGTGTGAGGGCTACGTCGT
TAAGAGAATAACGATGAGCCCAGGCCTTTATGGAAAAACCACAGGGTATGCGGTAACCCACCACGCAGAC
GGATTCTTGTTGTGCAAGACTACCGACACGGTTGACGGCGAAAGAGTGTCATTCTCGGTGTGCACGTACG
TGCCGGCGACCATTTGTGATCAAATGACCGGCATCCTTGCTACAGAAGTCACGCCGGAGGATGCACAGAA
GCTGTTGGTGGGGCTGAACCAGAGGATAGTGGTTAACGGCAGAACGCAACGGAACACGAACACCATGAAG
AACTACCTACTTCCCGTGGTCGCCCAGGCCTTCAGTAAGTGGGCAAAGGAGTGCCGGAAGGACATGGAAG
ATGAGAAGCTTCTGGGGGTCAGAGAAAGAACACTAACCTGCTGCTGTCTATGGGCATTTAAGAAGCAGAA
AACACACACGGTCTACAAGAGGCCTGATACCCAGTCAATCCAGAAGGTTCAGGCCGAATTTGACAGCTTT
GTAGTACCGGGCCTGTGGTCGTCCGGGTTGTCAATCCCGTTGAGGACTAGAATCAAGTGGTTGTTACGCA
AGGTGCCGAAAACAGACCTGATCCCATACAGCGGGAATGCCCAAGAAGCCCAGGATGCAGAAAAAGAAGC
AGAGGAAGAACGAGAAGCAGAACTGACTCATGAGGCTCTACCACCCCTACAGGCAGCACAGGAAGATGTC
CAGGTCGAAATCGACGTGGAACAGCTTGAGGATAGAGCTGGTGCTGGAATAATAGAGACTCCGAGAGGCG
CTATCAAAGTTACTGCCCAACTAACAGACCACGTCGTGGGGGAGTACCTGGTACTTTCCCCGCAGACCGT
ACTACGCAGCCAGAAGCTCAGCCTGATCCACGCTTTAGCGGAGCAAGTGAAGACGTGTACGCACAGCGGA
CGAGCAGGGAGGTATGCGGTCGAAGCGTACGATGGCCGAGTCCTAGTGCCCTCAGGCTATGCAATTTCGC
CTGAAGACTTCCAGAGTCTAAGCGAAAGCGCAACGATGGTGTACAACGAAAGAGAGTTCGTAAACAGAAA
GTTACACCACATTGCGATGCACGGACCAGCCCTGAACACTGACGAAGAGTCGTATGAGCTGGTGAGGGCA
GAGAGGACAGAACACGAGTACGTCTACGACGTGGACCAGAGAAGATGCTGTAAGAAGGAAGAAGCTGCAG
GACTGGTACTGGTGGGCGACTTGACTAATCCGCCCTACCACGAATTCGCATACGAAGGGCTAAAAATTCG
CCCCGCCTGCCCATACAAAATTGCAGTCATAGGAGTCTTCGGGGTACCAGGATCTGGCAAGTCAGCCATT
ATCAAGAACCTAGTTACCAGGCAAGACCTGGTGACTAGCGGAAAGAAAGAAAACTGCCAAGAAATCAGCA
CCGACGTGATGAGACAGAGAGGTCTAGAGATATCTGCACGTACGGTAGATTCGCTGCTCTTGAATGGATG
CAACAGACCAGTCGACGTGTTGTACGTAGACGAGGCGTTTGCGTGCCACTCTGGAACGTTACTTGCTTTG
ATCGCCTTGGTGAGACCAAGACAGAAAGTTGTACTTTGTGGTGACCCGAAGCAGTGCGGCTTCTTCAATA
TGATGCAGATGAAAGTCAACTACAATCATAACATCTGCACCCAAGTGTACCACAAAAGTATCTCCAGGCG
GTGTACACTGCCTGTGACTGCCATTGTGTCATCGTTGCATTACGAAGGCAAAATGCGCACTACGAATGAG
TACAACATGCCGATTGTAGTGGACACTACAGGCTCAACGAAACCTGACCCTGGAGACCTCGTGTTAACGT
GCTTCAGAGGGTGGGTTAAACAACTGCAAATTGACTATCGTGGACACGAGGTCATGACAGCAGCCGCATC
CCAAGGGTTAACTAGAAAAGGAGTTTACGCAGTTAGGCAAAAAGTTAACGAAAACCCACTCTATGCATCA
ACATCAGAGCACGTCAACGTACTCCTAACGCGTACGGAAGGTAAACTGGTATGGAAGACACTCTCTGGTG
ACCCGTGGATAAAGACGCTGCAGAACCCACCGAAAGGAAACTTCAAAGCAACTATTAAGGAGTGGGAGGT
GGAGCACGCATCGATAATGGCGGGCATCTGCAGTCACCAAGTGACCTTTGACACATTCCAAAACAAAGCC
AACGTTTGCTGGGCTAAGAGCTTGGTCCCTATCCTCGAAACAGCGGGGATAAAACTAAATGATAGGCAGT
GGTCCCAGATAATTCAAGCCTTCAAAGAAGACAAAGCATACTCACCCGAAGTAGCCCTGAATGAAATATG
CACGCGCATGTATGGGGTGGATCTAGACAGTGGGCTATTCTCTAAACCGTTGGTATCTGTGTATTACGCG
GATAACCATTGGGATAATAGGCCGGGAGGAAAGATGTTCGGATTCAACCCTGAGGCAGCGTCCATTCTAG
AAAGAAAGTACCCATTTACAAAAGGAAAGTGGAACATCAACAAGCAGATCTGCGTGACTACCAGGAGGAT
AGAAGACTTCAACCCTACCACCAACATTATACCGGTCAACAGGAGACTACCACACTCATTAGTGGCCGAA
CACCGCCCAGTAAAAGGGGAAAGAATGGAATGGCTGGTTAACAAGATAAACGGACACCACGTACTCCTGG
TTAGCGGCTATAACCTTGCACTGCCTACTAAGAGAGTCACCTGGGTAGCGCCACTAGGTGTCCGCGGAGC
GGACTATACATACAACCTAGAGCTGGGTCTACCAGCAACACTTGGTAGGTATGACCTAGTGGTCATAAAC
ATCCACACACCTTTTCGCATACACCATTACCAACAGTGCGTAGATCACGCAATGAAACTGCAAATGCTAG
GGGGTGACTCACTGAGACTGCTCAAACCGGGTGGCTCTCTATTGATCAGAGCATACGGTTACGCAGATAG
AACCAGTGAACGAGTCATCTGCGTACTGGGACGCAAGTTTAGATCGTCTAGAGCATTGAAACCACCATGT
GTCACCAGTAATACTGAGATGTTTTTCCTATTTAGCAATTTTGACAATGGCAGAAGGAATTTTACAACGC
ATGTCATGAACAATCAACTGAATGCAGCCTTTGTAGGACAGGCCACCCGAGCAGGATGTGCACCATCGTA
CCGGGTAAAACGCATGGACATCGCGAAGAACGATGAAGAGTGCGTGGTTAACGCCGCCAACCCTCGCGGG
TTACCAGGTGACGGTGTTTGCAAGGCAGTATATAAAAAGTGGCCGGAGTCCTTTAAAAACAGTGCAACAC
CAGTAGGAACCGCAAAAACAGTTATGTGCGGTACGTATCCAGTAATCCACGCCGTAGGACCAAACTTCTC
AAATTATTCGGAGTCTGAAGGGGACCGGGAATTGGCGGCTGCCTATCGAGAAGTCGCAAAGGAAGTAACT
AGACTGGGAGTAAATAGCGTAGCTATACCTCTCCTCTCCACAGGTGTATACTCAGGAAGGAAAGACAGGC
TAACCCAGTCACTGAACCACCTCTTTACAGCCATGGACTCGACGGATGCAGACGTGGTCATCTACTGCCG
AGACAAGGAATGGGAGAAGAAAATATCTGAGGCCATACAGATGCGGACCCAAGTGGAGCTGCTGGATGAG
CACATCTCCATAGACTGCGATGTCATTCGCGTGCACCCTGACAGTAGCTTGGCAGGCAGAAAAGGATACA
GCACCACGGAAGGCGCACTGTATTCATATCTAGAAGGGACACGTTTTCACCAGACGGCAGTGGATATGGC
AGAGATATACACTATGTGGCCAAAGCAAACAGAGGCCAATGAGCAAGTCTGCCTATATGCCCTGGGGGAA
AGTATTGAATCAATCAGGCAGAAATGCCCGGTGGATGATGCAGACGCATCATCTCCCCCGAAAACTGTCC
CGTGTCTTTGCCGGTATGCCATGACTCCTGAACGCGTCACCCGACTTCGCATGAACCATGTCACAAATAT
AATTGTGTGTTCTTCATTTCCCCTTCCAAAGTACAAGATAGAAGGAGTGCAAAAAGTCAAATGCTCCAAG
GTAATGTTATTCGATCACAATGTGCCATCGCGCGTAAGTCCAAGGGAATACAGATCTTCCCAGGAGTCTG
TACAGGAAGTGAGTACGACAACGTCATTGACGCATAGCCAGTTTGATCTAAGCGCCGATGGCGAGACACT
GCCTGTCCCGTCAGACCTGGATGCTGACGCCCCAGCCCTAGAACCGGCCCTAGACGACGGGGCGGTACAT
ACATTACCAACCATAATCGGAAACCTTGCGGCCGTGTCTGACTGGGTAATGAGCACCGTACCTGTCGCGC
CGCCTAGAAGAAGGAGAGGGAGAAACCTGACTGTGACATGTGACGAGAGAGAAGGGAATATAACACCCAT
GGCTAGCGTCCGATTCTTTAGAGCAGAGCTGTGTCCGGCCGTACAAGAAACAGCGGAGACGCGTGACACA
GCTATTTCCCTTCAGGCACCGCCAAGTACCACCATGGAACTGAGCCATCCACCGATCTCCTTCGGAGCAC
CAAGCGAGACGTTCCCCATCACATTTGGGGACTTCGACGAAGGAGAAATCGAAAGCTTGTCTTCTGAGCT
ACTAACTTTCGGAGACTTCCTACCCGGTGAAGTGGATGATCTGACAGATAGCGACTGGTCCACGTGCCCA
GACACGGACGACGAGTTATGACTAGACAGGGCAGGTGGGTATATATTCTCGTCGGACACTGGTCCAGGCC
ATTTACAACAGAAGTCGGTACGCCAGTCAGTGCTGCCGGTAAACACCCTGGAGGAAGTCCACGAGGAGAA
GTGTTACCCACCTAAGCTGGATGAATTAAAGGAGCAACTACTACTTAAGAAACTCCAGGAGAGTGCGTCC
ATGGCCAATAGAAGCAGGTATCAGTCACGCAAAGTGGAAAATATGAAAGCAACAATCATCCAGAGACTAA
AGAGAGGCTGTAAACTGTATTTAATGGCAGAGACCCCGAAAGTCCCGACTTATCGGACCATATACCCGGC
GCCTGTGTACTCGCCTCCGATCAATGTCCGATTGTCCAACCCCGAGTCCGCAGTGGCAGCATGTAACGAG
TTCTTAGCTAGAAACTACCCAACTGTTTCATCATACCAAATCACCGACGAGTATGATGCATATCTAGACA
TGGTGGACGGGTCGGAGAGTTGCTTGGACCGAGCGACATTCAATCCGTCAAAACTTAGGAGCTACCCGAA
ACAACATGCTTATCACGCGCCTTCTATCAGAAGCGCTGTACCTTCCCCATTCCAGAACACACTACAGAAT
GTACTGGCAGCAGCCACGAAAAGGAACTGCAACGTCACACAGATGAGGGAATTACCCACTTTGGACTCAG
CAGTATTCAACGTGGAGTGTTTTAAAAAATTCGCATGTAACCGAGAATACTGGGAAGAATTTGCAGCCAG
CCCTATCAGGATAACAACTGAGAATCTAACAACCTATGTCACTAAACTAAAGGGGCCAAAAGCAGCAGCG
CTGTTTGCAAAAACCCATAATCTGCTGCCACTGCAGGATGTACCAATGGATAGGTTCACAGTAGATATGA
AAAGGGATGTGAAGGTAACTCCTGGTACAAAGCATACAGAGGAAAGACCTAAGGTGCAGGTTATACAGGC
GGCTGAACCCTTGGCAACAGCGTACCTATGTGGAATTCACAGAGAACTGGTTAGGAGATTGAACGCCGTC
CTCCTACCCAATGTGCATACACTATTTGACATGTCTGCCGAGGACTTCGATGCCATTATAGCCGCACACT
TCAAGCCAGGAGACGCTGTTTTAGAAACGGACATAGCCTCCTTTGATAAGAGCCAAGATGATTCACTTGC
GCTTACCGCCTTAATGCTGTTAGAAGATTTGGGAGTGGATCACTCCCTGTTGGACTTGATAGAGGCTGCT
TTCGGAGAGATTTCCAGCTGTCATCTGCCGACAGGTACGCGCTTCAAGTTCGGCGCTATGATGAAATCCG
GTATGTTCCTAACTCTGTTCGTCAACACGTTGTTAAATATCACCATCGCTAGCCGGGTGTTGGAAGATCG
TCTGACAAAATCCGCATGCGCGGCCTTCATCGGCGACGACAACATAATACATGGTGTCGTCTCCGATGAA
TTGATGGCAGCCAGATGCGCTACTTGGATGAACATGGAAGTGAAGATCATAGATGCAGTTGTATCCCAGA
AAGCTCCTTACTTTTGTGGAGGGTTTATACTGCATGATACTGTGACAGGAACAGCTTGCAGAGTGGCGGA
CCCGCTAAAAAGGTTATTTAAATTGGGCAAACCGTTAGCGGCAGGTGACGAACAAGATGAAGACAGAAGA
CGGGCGCTGGCTGATGAAGTAATCAGATGGCAACGAACAGGGCTAATAGATGAGCTGGAGAAAGCGGTGT
ACTCTAGGTACGAAGTGCAGGGTATATCAGTTGCGGTAATGTCCATGGCCACCTTTGCAAGCTCCAGATC
CAACTTCGAGAAGCTCAGAGGACCCGTCATAACTTTGTACGGCGGTCCTAAATAGGTACGCACTACAGCT
ACCTATTTTGCAGAAGCCGACAGCAGGTACCTAAATACCAATCAGCCATAATGGAGTTTATCCCAACCCA
AACTTTCTACAATAGGAGGTACCAGCCTCGACCTTGGACTCCGCGCCCTACTATCCAAGTTATCAGACCC
AGACCGCGTCCGCAAAGGAAAGCCGGGCAACTTGCCCAGCTGATCTCAGCAGTTAATAAACTGACAATGC
GCGCGGTACCTCAACAGAAGCCGCGCAAGAATCGGAAGAATAAGAAGCAAAAGCAAAAGCAGCAGGCGCC
ACGAAACAACATGAATCAAAAGAAGCAGCCCCCTAAAAAGAAACCGGCTCAAAAGAAAAAGAAGCCGGGC
CGTAGAGAGAGAATGTGCATGAAAATCGAAAATGATTGCATCTTCGAAGTCAAGCATGAAGGTAAGGTAA
CAGGTTACGCGTGCTTGGTAGGGGACAAAGTAATGAAGCCAGCACACGTAAAGGGGACCATCGATAATGC
GGACCTGGCCAAATTGGCCTTCAAGCGGTCATCTAAGTACGACCTTGAATGCGCGCAGATACCCGTGCAC
ATGAAGTCCGACGCTTCGAAGTTCACCCATGAGAAACCGGAGGGGTACTACAACTGGCACCACGGAGCAG
TACAGTACTCAGGAGGCCGGTTCACCATCCCTACAGGTGCGGGCAAACCAGGGGACAGCGGTAGACCGAT
CTTCGACAACAAGGGGCGCGTGGTGGCCATAGTTTTAGGAGGAGCTAATGAAGGAGCCCGTACAGCCCTC
TCGGTGGTGACCTGGAACAAAGACATCGTCACGAAAATCACCCCTGAGGGGGCCGAAGAGTGGAGTCTTG
CCATTCCAGTTATGTGCCTGCTGGCAAATACCACGTTCCCCTGCTCCCAGCCCCCTTGCACACCCTGCTG
CTACGAAAAAGAGCCGGAGAAAACCCTGCGCATGCTAGAAGACAACGTCATGAGCCCCGGGTACTATCAG
CTGCTACAAGCATCCTTAACATGTTCTCCCCGCCGCCAGCGACGCAGTATTAAGGACAACTTCAATGTCT
ATAAAGCCATAAGACCGTACCTAGCTCACTGTCCCGACTGTGGAGAAGGGCACTCGTGCCATAGTCCCGT
AGCGCTAGAACGCATCAGAAACGAAGCGACAGACGGGACGCTGAAAATCCAGGTTTCCTTGCAAATCGGA
ATAAAGACGGATGATAGCCATGATTGGACCAAGCTGCGTTACATGGACAATCATATGCCAGCAGACGCAG
AGAGGGCCAGGCTATTTGTAAGAACGTCAGCACCGTGCACGATTACTGGAACAATGGGACACTTCATCCT
GGCCCGATGTCCGAAAGGAGAAACTCTGACGGTGGGATTCACTGACGGTAGGAAGATCAGTCACTCATGT
ACGCACCCATTTCACCACGACCCTCCTGTGATAGGCCGGGAAAAATTTCATTCCCGACCGCAGCACGGTA
GAGAACTACCTTGCAGCACGTACGCGCAGAGCACCGCTGCAACTGCCGAGGAGATAGAGGTACATATGCC
CCCAGACACCCCAGATCGCACATTGATGTCACAACAGTCCGGTAATGTAAAGATCACAGTCAATAGTCAG
ACGGTGCGGTACAAGTGTAATTGCGGTGACTCAAATGAAGGACTAACCACTACAGACAAAGTGATTAATA
ACTGCAAGGTTGATCAATGCCATGCCGCGGTCACCAATCACAAAAAATGGCAGTATAATTCCCCTCTGGT
CCCGCGTAATGCTGAACTCGGGGACCGAAAAGGAAAAGTTCACATTCCGTTTCCTCTGGCAAATGTGACA
TGCAGGGTGCCTAAGGCAAGGAACCCCACCGTGACGTACGGAAAAAACCAAGTCATCATGCTGCTGTATC
CTGACCACCCAACGCTCCTGTCCTACCGGAATATGGGAGAAGAACCAAACTATCAAGAAGAGTGGGTGAC
GCATAAGAAGGAGATCAGGTTAACCGTGCCGACTGAAGGGCTCGAGGTCACGTGGGGCAACAACGAGCCG
TACAAGTATTGGCCGCAGTTATCCACAAACGGTACAGCCCACGGCCACCCGCATGAGATAATTTTGTATT
ATTATGAGCTGTACCCTACTATGACTGTGGTAGTTGTGTCAGTGGCCTCGTTCGTACTCCTGTCGATGGT
GGGTGTGGCAGTGGGGATGTGCATGTGTGCACGACGCAGATGCATTACACCGTACGAACTGACACCAGGA
GCTACCGTCCCTTTCCTGCTTAGCCTAATATGCTGCATTAGAACAGCTAAAGCGGCCACATACCAAGAGG
CTGCGGTATACCTGTGGAACGAGCAGCAGCCTTTGTTTTGGCTGCAAGCCCTTATTCCGCTGGCAGCCCT
GATTGTCCTATGCAACTGTCTGAGACTCTTACCATGCTTTTGTAAAACGTTGACTTTTTTAGCCGTAATG
AGCGTCGGTGCCCACACTGTGAGCGCGTACGAACACGTAACAGTGATCCCGAACACGGTGGGAGTACCGT
ATAAGACTCTAGTCAACAGACCGGGCTACAGCCCCATGGTACTGGAGATGGAGCTTCTGTCAGTCACTTT
GGAGCCAACGCTATCGCTTGATTACATCACGTGCGAGTATAAAACCGTCATCCCGTCTCCGTACGTGAAA
TGCTGCGGTACAGCAGAGTGCAAGGACAAGAGCCTACCTGATTACAGCTGTAAGGTCTTCACCGGCGTCT
ACCCATTCATGTGGGGCGGCGCCTACTGCTTCTGCGACACTGAAAATACGCAATTGAGCGAAGCACATGT
GGAGAAGTCCGAATCATGCAAAACAGAATTTGCATCAGCATATAGGGCTCATACCGCATCCGCATCAGCT
AAGCTCCGCGTCCTTTACCAAGGAAATAATGTTACTGTATCTGCTTATGCAAACGGCGATCATGCCGTCA
CAGTTAAGGACGCTAAATTCATTGTGGGGCCAATGTCTTCAGCCTGGACACCTTTTGACAATAAAATCGT
GGTGTACAAAGGCGACGTCTACAACATGGACTACCCGCCCTTCGGCGCAGGAAGACCAGGACAATTTGGC
GACATCCAAAGTCGCACGCCTGAGAGCGAAGACGTCTATGCTAACACACAACTGGTACTGCAGAGACCGT
CCGCGGGTACGGTGCACGTGCCGTACTCTCAGGCACCATCTGGCTTCAAGTATTGGCTAAAAGAACGAGG
GGCGTCGCTGCAGCACACAGCACCATTTGGCTGTCAAATAGCAACAAACCCGGTAAGAGCGATGAACTGC
GCCGTAGGGAACATGCCTATCTCCATCGACATACCGGACGCGGCCTTCACTAGGGTCGTCGACGCGCCAT
CTTTAACGGACATGTCGTGTGAGGTACCAGCCTGCACCCACTCCTCAGACTTTGGGGGCGTAGCCATCAT
TAAATATGCAGCCAGCAAGAAAGGCAAGTGTGCGGTGCATTCGATGACTAACGCCGTCACTATTCGGGAA
GCTGAAATAGAAGTAGAAGGGAACTCTCAGTTGCAAATCTCTTTTTCGACGGCCCTAGCCAGCGCCGAAT
TCCGCGTACAAGTCTGTTCTACACAAGTACACTGTGCAGCCGAGTGCCATCCACCGAAAGACCATATAGT
CAATTACCCGGCGTCACACACCACCCTCGGGGTCCAAGACATTTCCGTTACGGCGATGTCATGGGTGCAG
AAGATCACGGGAGGTGTGGGACTGGTTGTCGCTGTTGCAGCACTGATCCTAATCGTGGTGCTATGCGTGT
CGTTTAGCAGGCACTAACTTGACAACTAGGTACGAAGGTATATGTGTCCCCTAAGAGACACACCACATAT
AGCTAAGAATCAATAGATAAGTATAGATCAAAGGGCTGAACAACCCCTGAATAGTAACAAAATATAAAAA
TCAACAAAAATCATAAAATAGAAAACCAGAAACAGAAGTAGGTAAGAAGGTATATGTGTCCCCTAAGAGA
CACACCATATATAGCTAAGAATCAATAGATAAGTATAGATCAAAGGGCTGAATAACCCCTGAATAATAAC
AAAATATAAAAATCAATAAAAATCATAAAATAGAAAACCATAAACAGAAGTAGTTCAAAGGGCTATAAAA
CCCCTGAATAGTAACAAAACATAAAACTAATAAAAATCAAATGAATACCATAATTGGCAATCGGAAGAGA
TGTAGGTACTTAAGCTTCCTAAAAGCAGCCGAACTCGCTTTGAGATGTAGGCGTAGCACACCGAACTCTT
CCATAATTCTCCGAACCCACAGGGACGTAGGAGATGTTCAAAGTGGCTATAAAACCCTGAACAGTAATAA
AACATAAAATTAATAAGGATCAAATGAGTACCATAATTGGCAAACGGAAGAGATGTAGGTACTTAAGCTT
CCTAAAAGCAGCCGAACTCACTTTGAGATGTAGGCATAGCATACCGAACTCTTCCACAATTCTCCGTACC
CATAGGGACGTAGGAGATGTTA
Click to Show/Hide
|