Details of Virus RNA
| Strain Information | Strain Name |
Encephalomyocarditis virus
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Cardiovirus a
|
||||||||
| RNA Binding Site |
5'UTR - 3'UTR
|
||||||||
| Virus Information | Virus Name |
Encephalomyocarditis virus (EMCV)
|
|||||||
| Taxonomy ID | 12104 | ||||||||
Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.32097501 | . |
| 13 kDa differentiation-associated protein | Q9UI09 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.36628076 | . |
| 14 kDa phosphohistidine phosphatase | Q9NRX4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.14489378 | . |
| 14-3-3 protein beta/alpha | P31946 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.423411422 | . |
| 14-3-3 protein epsilon | P62258 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.479472748 | . |
| 14-3-3 protein eta | Q04917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.136901209 | . |
| 14-3-3 protein gamma | P61981 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.578972511 | . |
| 14-3-3 protein sigma | P31947 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.035331438 | . |
| 14-3-3 protein theta | P27348 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.371598721 | . |
| 14-3-3 protein zeta/delta | P63104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -23.07593334 | . |
| 140 kDa Ser/Arg-rich domain protein | O15042 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -25.20635236 | . |
| 17-beta-hydroxysteroid dehydrogenase type 2 | P37059 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.632212668 | . |
| 2',5'-phosphodiesterase 12 | Q6L8Q7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.15385202 | . |
| 2-oxoisovalerate dehydrogenase subunit beta | P21953 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.562234344 | . |
| 26S proteasome non-ATPase regulatory subunit 11 | O00231 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.02392955 | . |
| 26S proteasome non-ATPase regulatory subunit 12 | O00232 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.62416999 | . |
| 26S proteasome non-ATPase regulatory subunit 13 | Q9UNM6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.19358446 | . |
| 26S proteasome non-ATPase regulatory subunit 14 | O00487 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.58875004 | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.62837783 | . |
| 26S proteasome non-ATPase regulatory subunit 3 | O43242 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.930540601 | . |
| 26S proteasome non-ATPase regulatory subunit 4 | P55036 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.61110375 | . |
| 26S proteasome non-ATPase regulatory subunit 5 | Q16401 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.278399189 | . |
| 26S proteasome non-ATPase regulatory subunit 6 | Q15008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.95213956 | . |
| 26S proteasome non-ATPase regulatory subunit 7 | P51665 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.25820093 | . |
| 26S proteasome regulatory subunit 10B | P62333 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.284404479 | . |
| 26S proteasome regulatory subunit 4 | P62191 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.97423829 | . |
| 26S proteasome regulatory subunit 6A | P17980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -23.08452621 | . |
| 26S proteasome regulatory subunit 6B | P43686 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.96772504 | . |
| 26S proteasome regulatory subunit 7 | P35998 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.84044716 | . |
| 26S proteasome regulatory subunit 8 | P62195 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.42266645 | . |
| 28S ribosomal protein S26 | Q9BYN8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.941504212 | . |
| 28S ribosomal protein S29 | P51398 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.954259285 | . |
| 28S ribosomal protein S39 | Q96EY7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.63201135 | . |
| 28S ribosomal protein S5 | P82675 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.655493448 | . |
| 28S ribosomal protein S7 | Q9Y2R9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.132954752 | . |
| 28S ribosomal protein S9 | P82933 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.37491154 | . |
| 3'(2'),5'-bisphosphate nucleotidase 1 | O95861 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.32597422 | . |
| 3-hydroxyacyl-CoA dehydrogenase type-2 | Q99714 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.82250822 | . |
| 3-hydroxyisobutyryl-CoA hydrolase | Q6NVY1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.14259736 | . |
| 3-ketoacyl-CoA thiolase | P42765 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.790323477 | . |
| 3-oxoacyl-[acyl-carrier-protein] reductase | Q8N4T8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.402609504 | . |
| 39S ribosomal protein L1 | Q9BYD6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.9856227 | . |
| 39S ribosomal protein L11 | Q9Y3B7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.40650399 | . |
| 39S ribosomal protein L12 | P52815 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.267104207 | . |
| 39S ribosomal protein L24 | Q96A35 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.596832862 | . |
| 39S ribosomal protein L37 | Q9BZE1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -23.37682598 | . |
| 39S ribosomal protein L38 | Q96DV4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.930341899 | . |
| 39S ribosomal protein L39 | Q9NYK5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.22715307 | . |
| 39S ribosomal protein S30 | Q9NP92 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.66238412 | . |
| 4'-phosphopantetheinyl transferase | Q9NRN7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.18772604 | . |
| 4-aminobutyrate aminotransferase | P80404 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.780087554 | . |
| 4-trimethylaminobutyraldehyde dehydrogenase | P49189 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.793388204 | . |
| 40S ribosomal protein S10 | P46783 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.29583665 | . |
| 40S ribosomal protein S11 | P62280 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.09058338 | . |
| 40S ribosomal protein S12 | P25398 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.61370579 | . |
| 40S ribosomal protein S13 | P62277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.78170065 | . |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.230147602 | . |
| 40S ribosomal protein S15 | P62841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.527708331 | . |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.37755023 | . |
| 40S ribosomal protein S17 | P08708 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.26637623 | . |
| 40S ribosomal protein S18 | P62269 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.43062334 | . |
| 40S ribosomal protein S19 | P39019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.76501365 | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.656372658 | . |
| 40S ribosomal protein S20 | P60866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.92408677 | . |
| 40S ribosomal protein S23 | P62266 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.63263893 | . |
| 40S ribosomal protein S25 | P62851 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 7.971095749 | . |
| 40S ribosomal protein S26 | P62854 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.33700665 | . |
| 40S ribosomal protein S28 | P62857 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.24661047 | . |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -21.67144846 | . |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.920753252 | . |
| 40S ribosomal protein S4 | P62701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.9609667 | . |
| 40S ribosomal protein S5 | P46782 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.08955665 | . |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.003225094 | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -21.86330519 | . |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.29128921 | . |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.472666612 | . |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.4453075 | . |
| 5-aminolevulinate synthase | P13196 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.563360927 | . |
| 5-methylcytosine rRNA methyltransferase NSUN4 | Q96CB9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.974642188 | . |
| 6-phosphofructokinase type A | P08237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.934849594 | . |
| 6-phosphogluconate dehydrogenase | P52209 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.760152217 | . |
| 60S acidic ribosomal protein P0 | P05388 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.97792581 | . |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.11905989 | . |
| 60S ribosomal protein L10a | P62906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -23.81165071 | . |
| 60S ribosomal protein L11 | P62913 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.59383587 | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.060537072 | . |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.12646675 | . |
| 60S ribosomal protein L13a | P40429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.22434996 | . |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.55089998 | . |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.67275508 | . |
| 60S ribosomal protein L18 | Q07020 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.173565887 | . |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.860177488 | . |
| 60S ribosomal protein L19 | P84098 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.30404454 | . |
| 60S ribosomal protein L21 | P46778 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.66275474 | . |
| 60S ribosomal protein L22 | P35268 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.72512221 | . |
| 60S ribosomal protein L23 | P62829 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -22.97091208 | . |
| 60S ribosomal protein L23a | P62750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.43405483 | . |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -20.81964726 | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.70369672 | . |
| 60S ribosomal protein L27a | P46776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.32226548 | . |
| 60S ribosomal protein L28 | P46779 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.573896025 | . |
| 60S ribosomal protein L29 | P47914 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.45702781 | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.1525038 | . |
| 60S ribosomal protein L30 | P62888 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.47977105 | . |
| 60S ribosomal protein L34 | P49207 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.37077499 | . |
| 60S ribosomal protein L36a | P83881 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -23.80752663 | . |
| 60S ribosomal protein L37a | P61513 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.7323782 | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.36977065 | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.116484323 | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.12373893 | . |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.76074233 | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.29710949 | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.75428122 | . |
| 60S ribosomal protein L9 | P32969 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.96763148 | . |
| 7-dehydrocholesterol reductase | Q9UBM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.602912145 | . |
| A-kinase anchor protein 8 | O43823 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.401567958 | . |
| A-kinase anchor protein 8-like | Q9ULX6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.374380971 | . |
| Acetyl-CoA acetyltransferase | Q9BWD1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.417620317 | . |
| Acidic protein rich in leucines | Q92688 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.257221997 | . |
| Acrosomal protein KIAA1210 | Q9ULL0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.568830897 | . |
| Actin | P68133 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.24714695 | . |
| Actin | P63261 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.88025599 | . |
| Actin | P68032 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.39650653 | . |
| Actin-related protein 2 | P61160 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.99769891 | . |
| Actin-related protein 2/3 complex subunit 1B | O15143 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.456076628 | . |
| Actin-related protein 2/3 complex subunit 2 | O15144 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.633055271 | . |
| Actin-related protein 2/3 complex subunit 4 | P59998 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.80058301 | . |
| Actin-related protein 3 | P61158 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.402767161 | . |
| Acyl-CoA dehydrogenase family member 10 | Q6JQN1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.14999371 | . |
| Acyl-CoA-binding protein | P07108 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.482784542 | . |
| Acyl-protein thioesterase 2 | O95372 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.992684275 | . |
| Acyl-protein thioesterase ABHD10 | Q9NUJ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.377585063 | . |
| Adenine phosphoribosyltransferase | P07741 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.818453494 | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.986811579 | . |
| Adenylate kinase isoenzyme 1 | P00568 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.446533772 | . |
| Adenylosuccinate lyase | P30566 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.45070207 | . |
| Adenylosuccinate synthetase isozyme 2 | P30520 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.204340996 | . |
| Adenylyl cyclase-associated protein 1 | Q01518 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.42266744 | . |
| Adipocyte plasma membrane-associated protein | Q9HDC9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.934392718 | . |
| ADP-ribose glycohydrolase MACROD1 | Q9BQ69 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.295210635 | . |
| ADP-ribosylation factor 3 | P61204 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.704351945 | . |
| ADP-ribosylation factor 4 | P18085 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.904234001 | . |
| ADP-ribosylation factor-like protein 1 | P40616 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.768368484 | . |
| ADP-sugar pyrophosphatase | Q9UKK9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.386803684 | . |
| ADP/ATP translocase 2 | P05141 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.046469968 | . |
| ADP/ATP translocase 3 | P12236 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 7.969278838 | . |
| Aflatoxin B1 aldehyde reductase member 2 | O43488 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.908165161 | . |
| Aging-associated gene 10 protein | Q9Y6H1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.880690144 | . |
| AH receptor-interacting protein | O00170 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.453896684 | . |
| AHA1 | O95433 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.724701217 | . |
| Alanine--tRNA ligase | P49588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.531370098 | . |
| Albumin | P02768 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.426322668 | . |
| Alcohol dehydrogenase class-3 | P11766 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.629100462 | . |
| Aldehyde dehydrogenase 1A1 | P00352 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.972826357 | . |
| Aldehyde dehydrogenase family 1 member A3 | P47895 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.895954725 | . |
| Aldehyde dehydrogenase family 3 member A2 | P51648 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.24980595 | . |
| Aldo-keto reductase family 1 member A1 | P14550 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.602230168 | . |
| Aldo-keto reductase family 1 member B1 | P15121 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.50098667 | . |
| Alpha-2-HS-glycoprotein | P02765 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.583199273 | . |
| Alpha-actinin-1 | P12814 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.177261875 | . |
| Alpha-actinin-3 | Q08043 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.377987038 | . |
| Alpha-actinin-4 | O43707 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.258547437 | . |
| Alpha-aminoadipic semialdehyde dehydrogenase | P49419 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.252220932 | . |
| Alpha-aminoadipic semialdehyde synthase | Q9UDR5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.036818872 | . |
| Alpha-centractin | P61163 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.254708784 | . |
| Alpha-enolase | P06733 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.949383609 | . |
| Alpha-NAC | E9PAV3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.953660709 | . |
| Alpha-soluble NSF attachment protein | P54920 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.52884198 | . |
| Amplified in liver cancer protein 1 | Q86WJ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.857906463 | . |
| Angiotensin-converting enzyme 2 | Q9BYF1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.764041294 | . |
| Annexin A1 | P04083 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.77703527 | . |
| Annexin A11 | P50995 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.380370689 | . |
| Annexin A2 | P07355 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.833628592 | . |
| Annexin A3 | P12429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.106240238 | . |
| Annexin A4 | P09525 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 8.46308674 | . |
| Annexin A5 | P08758 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.396750693 | . |
| Annexin A6 | P08133 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.269167425 | . |
| Annexin A7 | P20073 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.658373711 | . |
| Anterior gradient protein 2 homolog | O95994 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.09375787 | . |
| AP-1 complex subunit gamma-1 | O43747 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 8.127957999 | . |
| AP-1 complex subunit mu-1 | Q9BXS5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 8.772464181 | . |
| AP-3 complex subunit mu-1 | Q9Y2T2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.453283022 | . |
| APC-binding protein EB1 | Q15691 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.793844145 | . |
| APOBEC1 complementation factor | Q9NQ94 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.742701114 | . |
| Apolipoprotein E | P02649 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.890419097 | . |
| Apoptosis inhibitor 5 | Q9BZZ5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.261332507 | . |
| Apoptotic chromatin condensation inducer in the nucleus | Q9UKV3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 7.283167081 | . |
| apurinic or apyrimidinic site | P27695 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.72504018 | . |
| Arginase-1 | P05089 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.04392081 | . |
| Arginine--tRNA ligase | P54136 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.655539726 | . |
| Argininosuccinate synthase | P00966 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.526669871 | . |
| ASC-1 complex subunit p100 | Q9H1I8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.858007406 | . |
| ASF/SF2-associated protein p32 | Q07021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.919900605 | . |
| Asparagine--tRNA ligase | O43776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.520957345 | . |
| Aspartate aminotransferase | P17174 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.500745039 | . |
| Aspartate--tRNA ligase | P14868 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.91598008 | . |
| Ataxin-10 | Q9UBB4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.338447562 | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.67712996 | . |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.594298994 | . |
| ATP synthase subunit alpha | P25705 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.598614791 | . |
| ATP synthase subunit b | P24539 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.925757737 | . |
| ATP synthase subunit d | O75947 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.230607234 | . |
| ATP synthase subunit gamma | P36542 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.554483627 | . |
| ATP-binding cassette sub-family E member 1 | P61221 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.917035865 | . |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.80262405 | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.94308392 | . |
| ATP-dependent 6-phosphofructokinase | Q01813 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.381887002 | . |
| ATP-dependent DNA/RNA helicase DHX36 | Q9H2U1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.95296916 | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.128074239 | . |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.1406568 | . |
| ATP-dependent RNA helicase DDX18 | Q9NVP1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.04623786 | . |
| ATP-dependent RNA helicase DDX19A | Q9NUU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.183061039 | . |
| ATP-dependent RNA helicase DDX39A | O00148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.958103306 | . |
| ATP-dependent RNA helicase DDX3X | O00571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.18614192 | . |
| ATP-dependent RNA helicase DDX3Y | O15523 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.842068458 | . |
| ATP-dependent RNA helicase DDX42 | Q86XP3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.04937025 | . |
| ATP-dependent RNA helicase DDX50 | Q9BQ39 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.136651888 | . |
| ATP-dependent RNA helicase DHX15 | O43143 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.406054689 | . |
| ATP-dependent RNA helicase DHX30 | Q7L2E3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.28842187 | . |
| ATP-dependent RNA helicase DHX38 | Q92620 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.908921429 | . |
| ATP12 homolog | Q8N5M1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.08649546 | . |
| Atypical kinase COQ8A | Q8NI60 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.601944474 | . |
| B-cell receptor-associated protein 31 | P51572 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.295819122 | . |
| B19 | P57058 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.810804551 | . |
| BAG family molecular chaperone regulator 4 | O95429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.5085487 | . |
| Basal cell adhesion molecule | P50895 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.264962064 | . |
| Bcl-2-associated transcription factor 1 | Q9NYF8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.188895903 | . |
| Beige-like protein | P50851 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.872574055 | . |
| Beta-enolase | P13929 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.485134817 | . |
| Beta-ketoacyl-ACP synthase | Q9NWU1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.53929358 | . |
| Bifunctional coenzyme A synthase | Q13057 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.826432146 | . |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.57087398 | . |
| Bifunctional purine biosynthesis protein ATIC | P31939 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.72190201 | . |
| Biliverdin reductase A | P53004 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.774402382 | . |
| Bleomycin hydrolase | Q13867 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.756049654 | . |
| BOS complex subunit NOMO1 | Q15155 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.129228653 | . |
| Branched-chain-amino-acid aminotransferase | O15382 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.607133626 | . |
| BRCA2 and CDKN1A-interacting protein | Q9P287 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.140503495 | . |
| BRR2 homolog | O75643 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.450547859 | . |
| Butyrate-induced protein 1 | Q9P035 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.126509161 | . |
| C-1-tetrahydrofolate synthase | P11586 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.362946699 | . |
| C-terminal-binding protein 1 | Q13363 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.791576981 | . |
| CAD protein | P27708 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.289693987 | . |
| Calcineurin-binding protein cabin-1 | Q9Y6J0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.850222813 | . |
| Calcium load-activated calcium channel | Q9UM00 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.533121584 | . |
| Calcyclin-binding protein | Q9HB71 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.827943417 | . |
| Calmodulin-3 | P0DP25 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.553478772 | . |
| Calmodulin-like protein 3 | P27482 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.722311404 | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.36160259 | . |
| Calpain small subunit 1 | P04632 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.73553749 | . |
| Calpain-1 catalytic subunit | P07384 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.157609634 | . |
| Calpain-2 catalytic subunit | P17655 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.621847189 | . |
| Calponin-2 | Q99439 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.14168407 | . |
| Calponin-3 | Q15417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.630248562 | . |
| Calumenin | O43852 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.526701572 | . |
| CaMK-II subunit delta | Q13557 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.876308317 | . |
| cAMP-dependent protein kinase type II-alpha regulatory subunit | P13861 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.124310986 | . |
| cAMP-specific 3',5'-cyclic phosphodiesterase 4A | P27815 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.30129809 | . |
| Caprin-1 | Q14444 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.07897485 | . |
| Carbonic anhydrase 3 | P07451 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.981476899 | . |
| Carbonyl reductase [NADPH] 1 | P16152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.827350394 | . |
| Carboxypeptidase A4 | Q9UI42 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.946642449 | . |
| Carnitine O-acetyltransferase | P43155 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.785692349 | . |
| Casein kinase II subunit alpha | P68400 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.178959456 | . |
| Caspase-14 | P31944 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.357429213 | . |
| Catalase | P04040 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.00383571 | . |
| Cathepsin D | P07339 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.740516996 | . |
| CCR4-NOT transcription complex subunit 1 | A5YKK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.437744493 | . |
| CCR4-NOT transcription complex subunit 11 | Q9UKZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.178445455 | . |
| CCR4-NOT transcription complex subunit 2 | Q9NZN8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.222931255 | . |
| Cdc42-interacting protein 4 | Q15642 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.500607522 | . |
| CDK5 activator-binding protein C42 | Q96SZ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.631295458 | . |
| CDKN2A-interacting protein | Q9NXV6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.62050224 | . |
| Cell cycle and apoptosis regulator protein 2 | Q8N163 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.07482898 | . |
| Cell division control protein 42 homolog | P60953 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.731783481 | . |
| Cell proliferation-inducing gene 54 protein | Q29RF7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.248100007 | . |
| Centrosomal protein of 290 kDa | O15078 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.918846767 | . |
| Centrosomal protein of 41 kDa | Q9BYV8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.933038132 | . |
| Charged multivesicular body protein 2a | O43633 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.1580728 | . |
| Charged multivesicular body protein 4a | Q9BY43 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.960244583 | . |
| Charged multivesicular body protein 4b | Q9H444 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -28.07106734 | . |
| Chloride intracellular channel protein 1 | O00299 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.923117132 | . |
| Chloride intracellular channel protein 4 | Q9Y696 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.441444147 | . |
| Cholestenol Delta-isomerase | Q15125 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.450686131 | . |
| CHORD domain-containing protein 1 | Q9UHD1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.53968927 | . |
| CHRAC subunit ACF1 | Q9NRL2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.389461791 | . |
| Chromatin target of PRMT1 protein | Q9Y3Y2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.000762594 | . |
| Chromodomain-helicase-DNA-binding protein 2 | O14647 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.695741029 | . |
| Chymotrypsin-like protease CTRL-1 | P40313 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.15E-16 | . |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.26117724 | . |
| CLE7 homolog | Q9Y224 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.97356626 | . |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.896807129 | . |
| Cleavage stimulation factor subunit 1 | Q05048 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.15919027 | . |
| Cleavage stimulation factor subunit 2 | P33240 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.771573491 | . |
| Cleavage stimulation factor subunit 3 | Q12996 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.3722711 | . |
| Clustered mitochondria protein homolog | O75153 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.651574507 | . |
| Coatomer subunit alpha | P53621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.27880159 | . |
| Coatomer subunit beta' | P35606 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.40732923 | . |
| Coatomer subunit delta | P48444 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.18998253 | . |
| Coatomer subunit epsilon | O14579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.004892727 | . |
| Coatomer subunit gamma-1 | Q9Y678 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.4813676 | . |
| Coatomer subunit zeta-1 | P61923 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.83072166 | . |
| Cofilin-1 | P23528 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 10.10197013 | . |
| Coiled-coil domain-containing protein 44 | Q9BSH4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.772030543 | . |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.99067124 | . |
| Cold-inducible RNA-binding protein | Q14011 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.359140881 | . |
| Complex I subunit B13 | Q16718 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.43125948 | . |
| Complex I-23kD | O00217 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.49478009 | . |
| Complex I-B14 | P56556 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.707288697 | . |
| Condensin complex subunit 1 | Q15021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.032438768 | . |
| Copine-1 | Q99829 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.149265411 | . |
| Copine-3 | O75131 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.28861873 | . |
| Copper chaperone for superoxide dismutase | O14618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.349840062 | . |
| Corneodesmosin | Q15517 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.326509373 | . |
| Coronin-1B | Q9BR76 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.202701715 | . |
| Coronin-1C | Q9ULV4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.567908762 | . |
| Corrinoid adenosyltransferase MMAB | Q96EY8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.756117965 | . |
| CPSF 100 kDa subunit | Q9P2I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.939553145 | . |
| CPSF 25 kDa subunit | O43809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.46487773 | . |
| CPSF 30 kDa subunit | O95639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.283925136 | . |
| CPSF 59 kDa subunit | Q8N684 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.09646235 | . |
| CPSF 68 kDa subunit | Q16630 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.972933195 | . |
| CPSF 73 kDa subunit | Q9UKF6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.87605593 | . |
| Creatine kinase B-type | P12277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.134456196 | . |
| Creatine kinase M-type | P06732 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.295367213 | . |
| Creatine kinase S-type | P17540 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.574409456 | . |
| Crk-like protein | P46109 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.975542459 | . |
| Crooked neck-like protein 1 | Q9BZJ0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.86126603 | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.86821675 | . |
| CUGBP Elav-like family member 1 | Q92879 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 7.877583559 | . |
| Cullin-3 | Q13618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.216821584 | . |
| Cullin-associated NEDD8-dissociated protein 1 | Q86VP6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.481990329 | . |
| Cyclin-dependent kinase 1 | P06493 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.2668067 | . |
| Cyclin-dependent kinase 11A | Q9UQ88 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.61834576 | . |
| Cyclin-dependent kinase 18 | Q07002 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.779920592 | . |
| Cyclin-dependent kinase 2 | P24941 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.75492823 | . |
| Cyclin-dependent kinase 6 | Q00534 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.804879549 | . |
| Cystatin-A | P01040 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.001723633 | . |
| Cysteine and glycine-rich protein 1 | P21291 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.506888331 | . |
| Cysteine and glycine-rich protein 2 | Q16527 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.980055188 | . |
| Cysteine-rich protein 2 | P52943 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.460703366 | . |
| Cytochrome b-c1 complex subunit Rieske | P47985 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.372878076 | . |
| Cytochrome b5 type B | O43169 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.703301955 | . |
| Cytochrome c oxidase subunit 5A | P20674 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.5418344 | . |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.955551192 | . |
| Cytoskeleton-associated protein 4 | Q07065 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.916073462 | . |
| Cytoskeleton-associated protein 5 | Q14008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.82745625 | . |
| Cytosol aminopeptidase | P28838 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.719543362 | . |
| Cytosolic 5'-nucleotidase 3 | Q9H0P0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.634840959 | . |
| Cytosolic non-specific dipeptidase | Q96KP4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.791168184 | . |
| D-3-phosphoglycerate dehydrogenase | O43175 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 8.404078267 | . |
| D-aminoacyl-tRNA deacylase 1 | Q8TEA8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.397319009 | . |
| D-aspartate | P22061 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.63942157 | . |
| D-fructose-6-phosphate amidotransferase 1 | Q06210 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.143742992 | . |
| Damage-control phosphatase ARMT1 | Q9H993 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.61390817 | . |
| DAZ-associated protein 1 | Q96EP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.45506507 | . |
| DBIRD complex subunit ZNF326 | Q5BKZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.347596411 | . |
| DDOST 48 kDa subunit | P39656 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.752106413 | . |
| DDRGK domain-containing protein 1 | Q96HY6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.467601529 | . |
| Decreased expression in renal and prostate cancer protein | P0CG12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.622248066 | . |
| Dehydrogenase/reductase SDR family member 6 | Q9BUT1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.425497832 | . |
| Delta(24)-sterol reductase | Q15392 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.508190521 | . |
| Deoxyribose-phosphate aldolase | Q9Y315 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.117736383 | . |
| Derlin-2 | Q9GZP9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.756886344 | . |
| Dermcidin | P81605 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.816837014 | . |
| Desmocollin-1 | Q08554 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.343946593 | . |
| Desmocollin-3 | Q14574 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.836096667 | . |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.534211658 | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.530872977 | . |
| Destrin | P60981 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.665976391 | . |
| Developmentally-regulated GTP-binding protein 1 | Q9Y295 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.369801591 | . |
| Diablo IAP-binding mitochondrial protein | Q9NR28 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.844592197 | . |
| Dihydropteridine reductase | P09417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.772281136 | . |
| Dihydropyrimidinase-related protein 2 | Q16555 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.96793994 | . |
| Dihydropyrimidinase-related protein 3 | Q14195 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.949216652 | . |
| Dihydropyrimidine dehydrogenase [NADP(+)] | Q12882 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.67833316 | . |
| Dipeptidyl peptidase 4 | P27487 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.956869048 | . |
| Diphosphomevalonate decarboxylase | P53602 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.348150863 | . |
| DNA (cytosine-5)-methyltransferase 1 | P26358 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.84782878 | . |
| DNA dC->dU-editing enzyme APOBEC-3B | Q9UH17 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.844371398 | . |
| DNA dC->dU-editing enzyme APOBEC-3F | Q8IUX4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.043160658 | . |
| DNA dC->dU-editing enzyme APOBEC-3G | Q9HC16 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.56691608 | . |
| DNA fragmentation factor subunit alpha | O00273 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.146508398 | . |
| DNA ligase 3 | P49916 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.89828579 | . |
| DNA mismatch repair protein Msh6 | P52701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.016783363 | . |
| DNA replication licensing factor MCM2 | P49736 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.33988357 | . |
| DNA replication licensing factor MCM3 | P25205 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.994249604 | . |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.82245366 | . |
| DNA replication licensing factor MCM5 | P33992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.857644009 | . |
| DNA replication licensing factor MCM6 | Q14566 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.329600881 | . |
| DNA replication licensing factor MCM7 | P33993 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.09361935 | . |
| DNA topoisomerase 1 | P11387 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.24394106 | . |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -22.04109768 | . |
| DNA-directed RNA polymerase II subunit RPB2 | P30876 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.99013223 | . |
| DnaJ homolog subfamily A member 1 | P31689 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.839523551 | . |
| DnaJ homolog subfamily A member 2 | O60884 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.77588886 | . |
| DnaJ homolog subfamily B member 1 | P25685 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.186349854 | . |
| DnaJ homolog subfamily C member 7 | Q99615 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.091114912 | . |
| DnaJ homolog subfamily C member 8 | O75937 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.87586734 | . |
| DnaJ homolog subfamily C member 9 | Q8WXX5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -23.6079469 | . |
| DNL-type zinc finger protein | Q5SXM8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -22.83096216 | . |
| Dopamine-responsive gene 1 protein | Q9NP79 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.151563593 | . |
| Double-stranded RNA-binding protein Staufen homolog 1 | O95793 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.081924662 | . |
| Double-stranded RNA-binding protein Staufen homolog 2 | Q9NUL3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.19555729 | . |
| Drebrin | Q16643 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.871248171 | . |
| Drebrin-like protein | Q9UJU6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.549025959 | . |
| Dual specificity protein phosphatase 3 | P51452 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.40895151 | . |
| dUTPase | P33316 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.43031088 | . |
| Dynactin subunit 2 | Q13561 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.510938235 | . |
| Dynamin-2 | P50570 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 16.52764339 | . |
| Dynein light chain 1 | P63167 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.68347124 | . |
| Dystrophin | P11532 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.672724062 | . |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.561914703 | . |
| E2A-PBX1-associated protein | Q7Z6G8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.926935268 | . |
| E3 ubiquitin-protein ligase ARIH2 | O95376 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.501952371 | . |
| E3 ubiquitin-protein ligase HECTD1 | Q9ULT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.465771898 | . |
| E3 ubiquitin-protein ligase RNF213 | Q63HN8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.697909651 | . |
| E3 ubiquitin-protein ligase TRIM56 | Q9BRZ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.068959305 | . |
| E3 ubiquitin-protein ligase TRIM71 | Q2Q1W2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.690416661 | . |
| E3 ubiquitin-protein ligase UBR4 | Q5T4S7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.558823939 | . |
| E3 ubiquitin-protein ligase UHRF1 | Q96T88 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.52857384 | . |
| E3 ubiquitin/ISG15 ligase TRIM25 | Q14258 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -22.35824038 | . |
| EB1 protein family member 3 | Q9UPY8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.027547068 | . |
| EF-hand domain-containing protein D2 | Q96C19 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.431780297 | . |
| eIF-1A X isoform | P47813 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -20.2861758 | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.49616525 | . |
| eIF-2-alpha kinase activator GCN1 | Q92616 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.061939437 | . |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.659277181 | . |
| eIF-4-gamma 3 | O43432 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.73279466 | . |
| eIF3a | Q14152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.678278022 | . |
| eIF3b | P55884 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.57131924 | . |
| eIF3c | Q99613 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.928075529 | . |
| eIF3d | O15371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.929984121 | . |
| eIF3e | P60228 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.42049662 | . |
| eIF3f | O00303 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.41437171 | . |
| eIF3g | O75821 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.16455439 | . |
| eIF3h | O15372 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -24.60972315 | . |
| eIF3i | Q13347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -22.58815698 | . |
| eIF3j | O75822 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.75215553 | . |
| eIF3l | Q9Y262 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.49555811 | . |
| eIF3m | Q7L2H7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.743357565 | . |
| eIF5-mimic protein 1 | Q9Y6E2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 7.431316666 | . |
| eIF5-mimic protein 2 | Q7L1Q6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.822076644 | . |
| ELAV-like protein 1 | Q15717 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.798846639 | . |
| ELMO domain-containing protein 2 | Q8IZ81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.123815906 | . |
| Elongation factor 1-alpha 1 | P68104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.62735749 | . |
| Elongation factor 1-alpha 2 | Q05639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.466577451 | . |
| Elongation factor 1-beta | P24534 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.09407019 | . |
| Elongation factor 1-delta | P29692 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.197076351 | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.164703977 | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.240118504 | . |
| Elongation factor p18 | O43324 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.690602622 | . |
| Elongator complex protein 1 | O95163 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.833205324 | . |
| Emerin | P50402 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.830027264 | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.097676983 | . |
| Endoplasmic reticulum resident protein 29 | P30040 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.728082178 | . |
| Endoplasmic reticulum resident protein 44 | Q9BS26 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.960204436 | . |
| Endoplasmin | P14625 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.780222798 | . |
| Endothelial differentiation-related factor 1 | O60869 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.135344445 | . |
| Enhancer of mRNA-decapping protein 3 | Q96F86 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.51284492 | . |
| Enhancer of mRNA-decapping protein 4 | Q6P2E9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.300620908 | . |
| Enhancer of rudimentary homolog | P84090 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.14949961 | . |
| Enoyl-CoA hydratase domain-containing protein 3 | Q96DC8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.316162533 | . |
| Epiplakin | P58107 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.591885912 | . |
| eRF3a | P15170 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.7973997 | . |
| Ester hydrolase C11orf54 | Q9H0W9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.71969569 | . |
| Ethanolamine-phosphate cytidylyltransferase | Q99447 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.849187288 | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -22.22039757 | . |
| Eukaryotic initiation factor 4A-II | Q14240 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.82121079 | . |
| Eukaryotic initiation factor 4A-III | P38919 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.080797797 | . |
| Eukaryotic release factor 1 | P62495 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.9759252 | . |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.57793428 | . |
| Eukaryotic translation initiation factor 2A | Q9BY44 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.137707663 | . |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.49322163 | . |
| Eukaryotic translation initiation factor 4E | P06730 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.53910461 | . |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.992452271 | . |
| Eukaryotic translation initiation factor 5 | P55010 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.34295295 | . |
| Eukaryotic translation initiation factor 5A-1 | P63241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.808065566 | . |
| Eukaryotic translation initiation factor 5B | O60841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.03248464 | . |
| Eukaryotic translation initiation factor 6 | P56537 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.22404977 | . |
| Exosome complex component MTR3 | Q5RKV6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.152375605 | . |
| Exosome complex component RRP42 | Q15024 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.0534037 | . |
| Exosome complex exonuclease RRP44 | Q9Y2L1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.725517154 | . |
| Exosome RNA helicase MTR4 | P42285 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.13803027 | . |
| Exportin-1 | O14980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.79760386 | . |
| Exportin-2 | P55060 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.55669944 | . |
| Extended synaptotagmin-1 | Q9BSJ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.61929749 | . |
| Ezrin | P15311 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.544975458 | . |
| F-actin-capping protein subunit alpha-1 | P52907 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.732691767 | . |
| F-actin-capping protein subunit alpha-2 | P47755 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.804875302 | . |
| F-actin-capping protein subunit beta | P47756 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.95887016 | . |
| FACT complex subunit SPT16 | Q9Y5B9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.167699496 | . |
| FACT complex subunit SSRP1 | Q08945 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.638969852 | . |
| Far upstream element-binding protein 1 | Q96AE4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.556337716 | . |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.299373368 | . |
| Far upstream element-binding protein 3 | Q96I24 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.20419353 | . |
| Farnesyl pyrophosphate synthase | P14324 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.35725515 | . |
| Fascin | Q16658 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.69437454 | . |
| Fatty acid synthase | P49327 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.684862354 | . |
| Fatty acid-binding protein | P07148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.365943479 | . |
| Fatty acid-binding protein 5 | Q01469 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.761522573 | . |
| Felix-ina | Q7Z2K6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.276022522 | . |
| Fibrinogen gamma chain | P02679 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.222089421 | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.947871847 | . |
| Filamin-B | O75369 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.65363139 | . |
| Filamin-C | Q14315 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.502227356 | . |
| Flap endonuclease 1 | P39748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.46185229 | . |
| Flavin reductase (NADPH) | P30043 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 7.27295155 | . |
| FMR1-interacting protein NUFIP2 | Q7Z417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.51905024 | . |
| Fragile X messenger ribonucleoprotein 1 | Q06787 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.333030068 | . |
| Frataxin | Q16595 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.93543407 | . |
| Fructose-bisphosphate aldolase A | P04075 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.745790446 | . |
| Fructose-bisphosphate aldolase C | P09972 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.115984913 | . |
| Fumarylacetoacetate hydrolase domain-containing protein 2A | Q96GK7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.437474049 | . |
| G protein subunit beta-2 | P62879 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.293989393 | . |
| G-patch domain-containing protein 5 | Q92917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.62918885 | . |
| G-rich sequence factor 1 | Q12849 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.150359829 | . |
| Galactokinase | P51570 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.593845525 | . |
| Galectin-1 | P09382 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.398068975 | . |
| Galectin-3 | P17931 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.55195252 | . |
| Galectin-7 | P47929 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.948794282 | . |
| Gamma-soluble NSF attachment protein | Q99747 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.12177083 | . |
| GAP-associated tyrosine phosphoprotein p62 | Q07666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.437197768 | . |
| Gasdermin-A | Q96QA5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.820731896 | . |
| Gastric cancer antigen Ga19 | Q9BXJ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -20.75225006 | . |
| Gem-associated protein 5 | Q8TEQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.313194 | . |
| General transcription factor II-I | P78347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.596377849 | . |
| General vesicular transport factor p115 | O60763 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.79836658 | . |
| Glu-AdT subunit A | Q9H0R6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.732689187 | . |
| Glucose-6-phosphate 1-dehydrogenase | P11413 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.47033513 | . |
| Glucose-6-phosphate isomerase | P06744 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.427701074 | . |
| Glucosidase 2 subunit beta | P14314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.927702671 | . |
| Glutamate dehydrogenase 2 | P49448 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.686254182 | . |
| Glutamate--cysteine ligase regulatory subunit | P48507 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.981139528 | . |
| Glutamine amidotransferase-like class 1 domain-containing protein 3 | P0DPI2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.291441945 | . |
| Glutamine synthetase | P15104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.731073716 | . |
| Glutamine--tRNA ligase | P47897 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.771613615 | . |
| Glutamyl-tRNA(Gln) amidotransferase subunit B | O75879 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.718546336 | . |
| Glutaredoxin-3 | O76003 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.12855051 | . |
| Glutaredoxin-related protein 5 | Q86SX6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.96498099 | . |
| Glutathione reductase | P00390 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.228014077 | . |
| Glutathione S-transferase LANCL1 | O43813 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.639916058 | . |
| Glutathione S-transferase omega-1 | P78417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.691649208 | . |
| Glutathione S-transferase P | P09211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.120791657 | . |
| Glutathione synthetase | P48637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.95483379 | . |
| Glycinamide ribonucleotide synthetase | P22102 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.683677246 | . |
| Glycine--tRNA ligase | P41250 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.03299967 | . |
| Glycogen debranching enzyme | P35573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.344095966 | . |
| Glycogen phosphorylase | P06737 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.57148159 | . |
| Glycogen phosphorylase | P11217 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.739480629 | . |
| Glycogen synthase kinase-3 beta | P49841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.42261505 | . |
| Glycylpeptide N-tetradecanoyltransferase 1 | P30419 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.73168058 | . |
| GMP synthase [glutamine-hydrolyzing] | P49915 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.636201238 | . |
| Golgi phosphoprotein 3 | Q9H4A6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.435288919 | . |
| Golgi reassembly-stacking protein 2 | Q9H8Y8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.639247668 | . |
| Golgi resident protein GCP60 | Q9H3P7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.082146246 | . |
| GPD-C | P21695 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.253371451 | . |
| GRB10-interacting GYF protein 2 | Q6Y7W6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.43760879 | . |
| Growth factor receptor-bound protein 7 | Q14451 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.27315935 | . |
| GrpE protein homolog 1 | Q9HAV7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.48294989 | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.775814755 | . |
| GTP-binding protein SAR1a | Q9NR31 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.254088364 | . |
| GTP:AMP phosphotransferase AK3 | Q9UIJ7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.711390899 | . |
| GTPase Era | O75616 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.795967319 | . |
| Guanidinoacetate N-methyltransferase | Q14353 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.871414401 | . |
| Guanylate-binding protein 1 | P32455 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.213827816 | . |
| Haloacid dehalogenase-like hydrolase domain-containing protein 3 | Q9BSH5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.037795793 | . |
| HBS1-like protein | Q9Y450 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.205029826 | . |
| HCDH | Q16836 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.99036335 | . |
| Heat shock 70 kDa protein 1B | P0DMV9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.210280447 | . |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.621068602 | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.501271372 | . |
| Heat shock protein 105 kDa | Q92598 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.57775153 | . |
| Heat shock protein beta-1 | P04792 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.273426564 | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.41052385 | . |
| Heat shock protein HSP 90-beta | P08238 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.033000786 | . |
| Heat shock-related 70 kDa protein 2 | P54652 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.495604585 | . |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.753200772 | . |
| Helicase with 2 CARD domains | Q9BYX4 | Homo sapiens | Pro Info | . | B95a Cells (Marmoset lymphoblastoid cell line) | . | . | . | . | . |
| Helicase with 2 CARD domains | Q9BYX4 | Homo sapiens | Pro Info | . | B95a Cells (Marmoset lymphoblastoid cell line) | . | . | . | . | . |
| Hemoglobin subunit alpha | P69905 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.512501971 | . |
| Hemoglobin subunit beta | P68871 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.243192343 | . |
| Hepatoma-derived growth factor | P51858 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.927188891 | . |
| Heterogeneous nuclear ribonucleoprotein A/B | Q99729 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.374430538 | . |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.83398473 | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.16450952 | . |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.45429961 | . |
| Heterogeneous nuclear ribonucleoprotein D-like | O14979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.067379589 | . |
| Heterogeneous nuclear ribonucleoprotein D0 | Q14103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.149743783 | . |
| Heterogeneous nuclear ribonucleoprotein F | P52597 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.54639462 | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.27178905 | . |
| Heterogeneous nuclear ribonucleoprotein H2 | P55795 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.382925676 | . |
| Heterogeneous nuclear ribonucleoprotein H3 | P31942 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.435328035 | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.73354123 | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.204047304 | . |
| Heterogeneous nuclear ribonucleoprotein L-like | Q8WVV9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.77862901 | . |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.1817915 | . |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.75113069 | . |
| Heterogeneous nuclear ribonucleoprotein R | O43390 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.580558413 | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.66560502 | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.341142619 | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.722514654 | . |
| Hexokinase HKDC1 | Q2TB90 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.45487231 | . |
| High mobility group protein B1 | P09429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.038283251 | . |
| High mobility group protein B2 | P26583 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.24477619 | . |
| Histidine--tRNA ligase | P49590 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.29109858 | . |
| Histone acetyltransferase 1 | O14929 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.39770473 | . |
| Histone deacetylase 1 | Q13547 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.599779505 | . |
| Histone deacetylase complex subunit SAP18 | O00422 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.157227215 | . |
| Histone H1.2 | P16403 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.516528206 | . |
| Histone H1.3 | P16402 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.926842446 | . |
| Histone H1.4 | P10412 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.40456048 | . |
| Histone H3.2 | Q71DI3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.37865177 | . |
| Histone-binding protein RBBP4 | Q09028 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.35157015 | . |
| Histone-binding protein RBBP7 | Q16576 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.473911691 | . |
| HMG-CoA synthase | P54868 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.843635203 | . |
| Homogentisate 1,2-dioxygenase | Q93099 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.284617961 | . |
| Hsc70-interacting protein | P50502 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.993474129 | . |
| hSIRT3 | Q9NTG7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.192241261 | . |
| Hsp70-binding protein 1 | Q9NZL4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.046568653 | . |
| Hsp90 co-chaperone Cdc37 | Q16543 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.932717566 | . |
| hTom22 | Q9NS69 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.012981652 | . |
| Hydroxyacylglutathione hydrolase | Q16775 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.23145486 | . |
| Hydroxymethylglutaryl-CoA synthase | Q01581 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.9594281 | . |
| IF-2(Mt) | P46199 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.574584706 | . |
| IGF2 mRNA-binding protein 1 | Q9NZI8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.0179771 | . |
| IGF2 mRNA-binding protein 2 | Q9Y6M1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.092557938 | . |
| IGF2 mRNA-binding protein 3 | O00425 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.558177531 | . |
| Immunoglobulin-binding protein 1 | P78318 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.933753353 | . |
| Importin subunit alpha-1 | P52292 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.99113308 | . |
| Importin subunit alpha-3 | O00629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.638790601 | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.74659348 | . |
| Importin-5 | O00410 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.36804642 | . |
| Importin-7 | O95373 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.206038026 | . |
| Importin-9 | Q96P70 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.01398708 | . |
| Inorganic pyrophosphatase | Q15181 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.985636909 | . |
| Inosine-5'-monophosphate dehydrogenase 2 | P12268 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.022711862 | . |
| Inositol monophosphatase 2 | O14732 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.821153953 | . |
| Interferon-inducible protein 4 | P55265 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.317819162 | . |
| Interleukin enhancer-binding factor 2 | Q12905 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.08172873 | . |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.181017807 | . |
| Interleukin-36 gamma | Q9NZH8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.976346369 | . |
| Inverted formin-2 | Q27J81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.488697647 | . |
| Iron-sulfur cluster assembly 1 homolog | Q9BUE6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.814362541 | . |
| Isochorismatase domain-containing protein 1 | Q96CN7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.614853158 | . |
| Isochorismatase domain-containing protein 2 | Q96AB3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.492095718 | . |
| Isocitrate dehydrogenase [NADP] cytoplasmic | O75874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.50546536 | . |
| Isocitrate dehydrogenase [NAD] subunit beta | O43837 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.568498833 | . |
| Isocitrate dehydrogenase [NAD] subunit gamma | P51553 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.912020064 | . |
| Isoleucine--tRNA ligase | P41252 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.63206895 | . |
| Isopentenyl-diphosphate Delta-isomerase 1 | Q13907 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.5011101 | . |
| IST1 homolog | P53990 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.422885867 | . |
| Jupiter microtubule associated homolog 2 | Q9H910 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.37846516 | . |
| Kelch-like protein 17 | Q6TDP4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.517963388 | . |
| Kelch-like protein 41 | O60662 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.995425353 | . |
| Keratin | P02538 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.907476186 | . |
| Keratin | P19012 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.869349854 | . |
| Keratin | P05787 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.040523149 | . |
| Keratin | P19013 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.20809304 | . |
| Keratin | P05783 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.91535351 | . |
| Keratin | Q7Z3Z0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.062726015 | . |
| Keratin | Q01546 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.409292723 | . |
| Keratin | Q8N1N4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.263400123 | . |
| Keratin-13 | P13646 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.924285008 | . |
| Keratin-73 | Q86Y46 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.699723906 | . |
| KH domain-containing RNA-binding protein QKI | Q96PU8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.838648209 | . |
| Kinectin | Q86UP2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.995049097 | . |
| Kinesin light chain 1 | Q07866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.227804278 | . |
| Kinesin light chain 2 | Q9H0B6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.861529472 | . |
| Kinesin-1 heavy chain | P33176 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.969670225 | . |
| Kinesin-like protein KIF13B | Q9NQT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.450947993 | . |
| Kinesin-like protein KIF1B | O60333 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.892361765 | . |
| Kinesin-like protein KIF21A | Q7Z4S6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.852013524 | . |
| Kinesin-like protein KIF2A | O00139 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.190764824 | . |
| Kinesin-like protein KIF2C | Q99661 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.66432753 | . |
| L-lactate dehydrogenase A chain | P00338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.55393967 | . |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.629889469 | . |
| L-lactate dehydrogenase C chain | P07864 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.274122216 | . |
| L-xylulose reductase | Q7Z4W1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.459218684 | . |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.33579156 | . |
| La-related protein 4 | Q71RC2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.408321982 | . |
| La-related protein 4B | Q92615 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.196606979 | . |
| Lamin-B1 | P20700 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.30880266 | . |
| Lamina-associated polypeptide 2 | P42166 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.201815391 | . |
| LANP-like protein | Q9BTT0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.572990251 | . |
| Large subunit GTPase 1 homolog | Q9H089 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.38731919 | . |
| Leucine--tRNA ligase | Q9P2J5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.872286026 | . |
| Leucine-rich repeat-containing protein 47 | Q8N1G4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.666820836 | . |
| Leucine-rich repeat-containing protein 59 | Q96AG4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.09216285 | . |
| Leukocyte elastase inhibitor | P30740 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.484308004 | . |
| LIM and SH3 domain protein 1 | Q14847 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.844168506 | . |
| Lipoma-preferred partner | Q93052 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.298232472 | . |
| Lipoyl synthase | O43766 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.65187692 | . |
| Lissencephaly-1 protein | P43034 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.3721771 | . |
| LMW-PTP | P24666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.467380499 | . |
| Lon protease homolog | P36776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -21.00691936 | . |
| Long-chain-fatty-acid--CoA ligase 4 | O60488 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.44280444 | . |
| Luc7-like protein 3 | O95232 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.50093419 | . |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.52243533 | . |
| Lysine--tRNA ligase | Q15046 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.870700141 | . |
| Macrophage migration inhibitory factor | P14174 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 8.537129723 | . |
| Macrophage-capping protein | P40121 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.441556592 | . |
| Malate dehydrogenase | P40925 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.278371222 | . |
| Malectin | Q14165 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.623496815 | . |
| MAP activator with WD repeats | Q9Y3F4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.11919072 | . |
| MAP kinase kinase 2 | P36507 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.122183279 | . |
| MAP kinase signal-integrating kinase 2 | Q9HBH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.146031001 | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.5067747 | . |
| Medium tumor antigen-associated 61 kDa protein | P30153 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.62502688 | . |
| Melanoma-associated antigen B2 | O15479 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.831647957 | . |
| Merlin | P35240 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.178686195 | . |
| Methionine aminopeptidase 1 | P53582 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.91873488 | . |
| Methionine aminopeptidase 2 | P50579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.977702661 | . |
| Methionine--tRNA ligase | P56192 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.61530845 | . |
| Methionine--tRNA ligase | Q96GW9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.12396099 | . |
| Methyltransferase-like protein 15 | A6NJ78 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.282604396 | . |
| Mevalonate kinase | Q03426 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.64243887 | . |
| MICAL-like protein 1 | Q8N3F8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.196732902 | . |
| MICOS complex subunit MIC60 | Q16891 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.79876817 | . |
| Microsomal glutathione S-transferase 1 | P10620 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.241963935 | . |
| Microsomal triglyceride transfer protein large subunit | P55157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.581928441 | . |
| Microtubule-associated protein 1B | P46821 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.79962974 | . |
| Microtubule-associated protein 4 | P27816 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.355680096 | . |
| Mid1-interacting protein 1 | Q9NPA3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.195908311 | . |
| Midasin | Q9NU22 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.873501404 | . |
| Mitochondrial import receptor subunit TOM34 | Q15785 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.842460842 | . |
| Mitochondrial import receptor subunit TOM70 | O94826 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.978931037 | . |
| Mitochondrial intermediate peptidase | Q99797 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.352592951 | . |
| Mitochondrial proton/calcium exchanger protein | O95202 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.20403743 | . |
| Mitochondrial tRNA-specific 2-thiouridylase 1 | O75648 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.93166459 | . |
| Mitogen-activated protein kinase 1 | P28482 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.727790429 | . |
| Mitotic checkpoint protein BUB3 | O43684 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.44522684 | . |
| Moesin | P26038 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.622880145 | . |
| Molybdenum cofactor sulfurase | Q96EN8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.029045788 | . |
| mPR | O00264 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.28404383 | . |
| mRNA cap guanine-N7 methyltransferase | O43148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.29465136 | . |
| mRNA turnover protein 4 homolog | Q9UKD2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.79213392 | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.242895046 | . |
| Multisynthase complex auxiliary component p43 | Q12904 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.70843228 | . |
| Muscleblind-like protein 1 | Q9NR56 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.699905258 | . |
| Myc box-dependent-interacting protein 1 | O00499 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.63316919 | . |
| Myelin expression factor 2 | Q9P2K5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.297307659 | . |
| Myelin regulatory factor-like protein | Q96LU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.240613923 | . |
| Myeloid leukemia factor 2 | Q15773 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.160232813 | . |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.836672062 | . |
| Myoferlin | Q9NZM1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.290899782 | . |
| Myomesin-1 | P52179 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.66720307 | . |
| Myomesin-2 | P54296 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.778074289 | . |
| Myosin light chain 1/3 | P05976 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.489612434 | . |
| Myosin light chain 3 | P08590 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.415612124 | . |
| Myosin-1 | P12882 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.00742164 | . |
| Myosin-10 | P35580 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.081757774 | . |
| Myosin-14 | Q7Z406 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.015945916 | . |
| Myosin-2 | Q9UKX2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.578457904 | . |
| Myosin-7 | P12883 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.098705731 | . |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.187887951 | . |
| Myosin-binding protein C | Q14324 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.400577426 | . |
| Myozenin-1 | Q9NP98 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.405192684 | . |
| N-acetylglutamate synthase | Q8N159 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 9.538305661 | . |
| Na(+)/H(+) exchange regulatory cofactor NHE-RF1 | O14745 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.13483644 | . |
| NAD(P)H dehydrogenase [quinone] 1 | P15559 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -20.06524617 | . |
| NAD-dependent malic enzyme | P23368 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.9036821 | . |
| NADH dehydrogenase 1 alpha subcomplex assembly factor 3 | Q9BU61 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.795386145 | . |
| NADH dehydrogenaseiron-sulfur protein 2 | O75306 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.43575397 | . |
| NADH-ubiquinone oxidoreductase 24 kDa subunit | P19404 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.77243435 | . |
| NADPH--cytochrome P450 reductase | P16435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.104683211 | . |
| Nebulin-related-anchoring protein | Q86VF7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.74408404 | . |
| NEDD8-conjugating enzyme Ubc12 | P61081 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.108168111 | . |
| Nesprin-2 | Q8WXH0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.421122485 | . |
| Nestin | P48681 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.694469437 | . |
| Neurolysin | Q9BYT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.247958259 | . |
| Neutral alpha-glucosidase AB | Q14697 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.275521628 | . |
| NF-X1-type zinc finger protein NFXL1 | Q6ZNB6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.15124812 | . |
| NHP2-like protein 1 | P55769 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.93191468 | . |
| Nicotinamide phosphoribosyltransferase | P43490 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.955192449 | . |
| Nicotinate phosphoribosyltransferase | Q6XQN6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.091055443 | . |
| Non-histone chromosomal protein HMG-14 | P05114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.337694944 | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.861750284 | . |
| Nonsense-mediated mRNA decay factor SMG8 | Q8ND04 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.254187646 | . |
| Notchless protein homolog 1 | Q9NVX2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.78129992 | . |
| NSFL1 cofactor p47 | Q9UNZ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.012382479 | . |
| Nuclear cap-binding protein subunit 1 | Q09161 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.08322074 | . |
| Nuclear cap-binding protein subunit 3 | Q53F19 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.330950389 | . |
| Nuclear migration protein nudC | Q9Y266 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.879879029 | . |
| Nuclear receptor coactivator 5 | Q9HCD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.993617263 | . |
| Nuclear RNA export factor 1 | Q9UBU9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.81110226 | . |
| Nucleic acid dioxygenase ALKBH1 | Q13686 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.893212383 | . |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.13682882 | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.39578614 | . |
| Nucleolysin TIA-1 isoform p40 | P31483 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.415028292 | . |
| Nucleolysin TIAR | Q01085 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.713359154 | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.572937496 | . |
| Nucleoporin Nup43 | Q8NFH3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.491128336 | . |
| Nucleoside diphosphate kinase 6 | O75414 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.20662959 | . |
| Nucleoside diphosphate kinase B | P22392 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.149827941 | . |
| Nucleosome assembly protein 1-like 1 | P55209 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.999435596 | . |
| Nucleosome assembly protein 1-like 4 | Q99733 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.156199532 | . |
| Obg-like ATPase 1 | Q9NTK5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.404373546 | . |
| Occludin | Q16625 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.08815937 | . |
| OGCP | Q02978 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.557037165 | . |
| OGDC-E2 | P36957 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.50647359 | . |
| Olfactory receptor 5AK2 | Q8NH90 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.066570664 | . |
| Oligosaccharyl transferase subunit DAD1 | P61803 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.93693126 | . |
| Oligosaccharyl transferase subunit STT3A | P46977 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.223049746 | . |
| Oligosaccharyl transferase subunit STT3B | Q8TCJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.231997037 | . |
| Oligosaccharyltransferase complex subunit OSTC | Q9NRP0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.524312219 | . |
| Opioid growth factor receptor | Q9NZT2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.519307805 | . |
| Oxidative stress-associated Src activator | Q9NZB2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.068016222 | . |
| Oxidoreductase HTATIP2 | Q9BUP3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.245907211 | . |
| Oxygen-dependent coproporphyrinogen-III oxidase | P36551 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.785241523 | . |
| PABP-interacting protein 1 | Q9H074 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.916766065 | . |
| PAF acetylhydrolase 29 kDa subunit | Q15102 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.49496818 | . |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.592750858 | . |
| PAICS | P22234 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.04746759 | . |
| PAPSS 1 | O43252 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.697944886 | . |
| Paraspeckle component 1 | Q8WXF1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.55223662 | . |
| Parkinson disease protein 7 | Q99497 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.466658785 | . |
| Partner of Y14 and mago | Q9BRP8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.985915545 | . |
| Parvalbumin alpha | P20472 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.135803845 | . |
| Parvulin-14 | Q9Y237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.205222528 | . |
| PAT complex subunit CCDC47 | Q96A33 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.77211037 | . |
| PDZ and LIM domain protein 1 | O00151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.751573252 | . |
| PDZ domain-containing protein GIPC1 | O14908 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.80689959 | . |
| Peptidyl-prolyl cis-trans isomerase A | P62937 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.846987272 | . |
| Peptidyl-prolyl cis-trans isomerase B | P23284 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.047415774 | . |
| Peptidyl-prolyl cis-trans isomerase FKBP11 | Q9NYL4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.762860373 | . |
| Peptidyl-prolyl cis-trans isomerase FKBP1A | P62942 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.80483542 | . |
| Peptidyl-prolyl cis-trans isomerase FKBP3 | Q00688 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.950216865 | . |
| Peptidyl-prolyl cis-trans isomerase FKBP4 | Q02790 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.327668314 | . |
| Pericentriolar material 1 protein | Q15154 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.765508532 | . |
| Perilipin-2 | Q99541 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.119664285 | . |
| Perilipin-3 | O60664 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.322489322 | . |
| Peroxiredoxin-1 | Q06830 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.7906201 | . |
| Peroxiredoxin-2 | P32119 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.292181052 | . |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.414614571 | . |
| Peroxiredoxin-5 | P30044 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.17988553 | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.848320859 | . |
| Peroxiredoxin-like 2A | Q9BRX8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.604052884 | . |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.67580643 | . |
| Phenylalanine--tRNA ligase | O95363 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.7256514 | . |
| Phenylalanine--tRNA ligase beta subunit | Q9NSD9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.13460724 | . |
| Phosphate carrier protein | Q00325 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.3690624 | . |
| Phosphatidylethanolamine-binding protein 1 | P30086 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.11521675 | . |
| Phosphoglucomutase-1 | P36871 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.558157928 | . |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.79711606 | . |
| Phosphoglycerate kinase 2 | P07205 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.568885785 | . |
| Phosphoglycerate mutase 1 | P18669 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.338755593 | . |
| Phosphoglycerate mutase 2 | P15259 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.653258804 | . |
| Phosphopentomutase | Q96G03 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.054961183 | . |
| Phosphoserine aminotransferase | Q9Y617 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.958552937 | . |
| Phosphoserine phosphatase | P78330 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.377034201 | . |
| Phytanoyl-CoA hydroxylase-interacting protein-like | Q96FC7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.000311259 | . |
| Pinin | Q9H307 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.300582029 | . |
| PKA C-beta | P22694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.164598859 | . |
| PKR-associated protein X | O75569 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.13556108 | . |
| Plakophilin-1 | Q13835 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.693257164 | . |
| Plakophilin-2 | Q99959 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.996286776 | . |
| Plectin | Q15149 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.456639185 | . |
| Pleiotropic regulator 1 | O43660 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.377512962 | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.060856106 | . |
| Poly(A) polymerase alpha | P51003 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.68912826 | . |
| Poly(rC)-binding protein 1 | Q15365 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.317976941 | . |
| Poly(rC)-binding protein 2 | Q15366 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.50463917 | . |
| Poly(rC)-binding protein 3 | P57721 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.554661714 | . |
| Poly(U)-binding-splicing factor | Q9UHX1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.556661968 | . |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.842172136 | . |
| Polyadenylate-binding protein 2 | Q86U42 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.36360904 | . |
| Polyadenylate-binding protein 4 | Q13310 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.118541974 | . |
| Polymerase delta-interacting protein 3 | Q9BY77 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.267888324 | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.59048213 | . |
| Polypyrimidine tract-binding protein 3 | O95758 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.50508464 | . |
| Positive cofactor 4 | P53999 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.472112793 | . |
| PP-1A | P62136 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.709481562 | . |
| PP-1B | P62140 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.836536365 | . |
| PP-1G | P36873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.731924089 | . |
| PP2A-alpha | P67775 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.6416185 | . |
| PP4C | P60510 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.977480605 | . |
| PP6C | O00743 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -25.43301089 | . |
| PPIase D | Q08752 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.970010838 | . |
| PQBP-1 | O60828 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.583197078 | . |
| pre-mRNA 3' end processing protein WDR33 | Q9C0J8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.67093355 | . |
| Pre-mRNA 3'-end-processing factor FIP1 | Q6UN15 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.73653382 | . |
| Pre-mRNA-processing factor 17 | O60508 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.627532102 | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.06079199 | . |
| Pre-mRNA-processing factor 40 homolog A | O75400 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.42467036 | . |
| Pre-mRNA-processing factor 6 | O94906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -20.95834454 | . |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -23.20662617 | . |
| Pre-mRNA-splicing factor 38A | Q8NAV1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.313288485 | . |
| Pre-mRNA-splicing factor RBM22 | Q9NW64 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.460304488 | . |
| Pre-mRNA-splicing factor SPF27 | O75934 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.65828795 | . |
| Pre-mRNA-splicing factor SYF1 | Q9HCS7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.893460198 | . |
| Prefoldin subunit 3 | P61758 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.63497883 | . |
| Prelamin-A/C | P02545 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.437559585 | . |
| Presequence protease | Q5JRX3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.532050293 | . |
| Probable arginine--tRNA ligase | Q5T160 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.39192427 | . |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.679750709 | . |
| Probable ATP-dependent RNA helicase DDX23 | Q9BUQ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.55461946 | . |
| Probable ATP-dependent RNA helicase DDX47 | Q9H0S4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.1028388 | . |
| Probable ATP-dependent RNA helicase DDX5 | P17844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.681055731 | . |
| Probable ATP-dependent RNA helicase DDX6 | P26196 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.24079219 | . |
| Probable helicase with zinc finger domain | P42694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.073400313 | . |
| Probable phosphoglycerate mutase 4 | Q8N0Y7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.047824548 | . |
| Procathepsin L | P07711 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.018958351 | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.202290231 | . |
| Programmed cell death 6-interacting protein | Q8WUM4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.56906595 | . |
| Programmed cell death protein 6 | O75340 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.160543277 | . |
| Prohibitin 1 | P35232 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.12983991 | . |
| Prohibitin-2 | Q99623 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.372754981 | . |
| Prolactin-inducible protein | P12273 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.612972798 | . |
| Proliferating cell nuclear antigen | P12004 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -26.30368657 | . |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.45496899 | . |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 36.33231009 | . |
| Prolyl endopeptidase | P48147 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.766759166 | . |
| Prostaglandin E synthase 2 | Q9H7Z7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.78112883 | . |
| Prostaglandin E synthase 3 | Q15185 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.118015896 | . |
| Prostaglandin G/H synthase 2 | P35354 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.67925785 | . |
| Prostaglandin reductase 1 | Q14914 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.384563172 | . |
| Proteasomal ubiquitin receptor ADRM1 | Q16186 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.626786962 | . |
| Proteasome activator complex subunit 1 | Q06323 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.911901553 | . |
| Proteasome activator complex subunit 3 | P61289 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.26744003 | . |
| Proteasome assembly chaperone 1 | O95456 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.631588197 | . |
| Proteasome subunit alpha type-1 | P25786 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.095507301 | . |
| Proteasome subunit alpha type-3 | P25788 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.619929086 | . |
| Proteasome subunit alpha type-4 | P25789 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.13874659 | . |
| Proteasome subunit alpha type-6 | P60900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -20.68746011 | . |
| Proteasome subunit alpha type-7 | O14818 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.14791077 | . |
| Proteasome subunit beta type-1 | P20618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.381352901 | . |
| Proteasome subunit beta type-2 | P49721 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.162653123 | . |
| Proteasome subunit beta type-3 | P49720 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.55912301 | . |
| Proteasome subunit beta type-5 | P28074 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.89892874 | . |
| Protein adenylyltransferase SelO | Q9BVL4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.70791494 | . |
| Protein arginine N-methyltransferase 1 | Q99873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.61167103 | . |
| Protein argonaute-1 | Q9UL18 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.293823588 | . |
| Protein argonaute-2 | Q9UKV8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.8538059 | . |
| Protein CDV3 homolog | Q9UKY7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.784721817 | . |
| Protein DDI1 homolog 2 | Q5TDH0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.173524991 | . |
| Protein disulfide-isomerase | P07237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.321764949 | . |
| Protein disulfide-isomerase A4 | P13667 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.830158818 | . |
| Protein disulfide-isomerase A6 | Q15084 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.943656855 | . |
| Protein FAM120C | Q9NX05 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.673312304 | . |
| Protein FAM50A | Q14320 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.692148288 | . |
| Protein FAM98A | Q8NCA5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.350766555 | . |
| Protein FAM98B | Q52LJ0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.892204571 | . |
| Protein flightless-1 homolog | Q13045 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.169765621 | . |
| Protein FMC1 homolog | Q96HJ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.912577447 | . |
| Protein HIRA | P54198 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.449023281 | . |
| Protein jagunal homolog 1 | Q8N5M9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.644555215 | . |
| Protein JTV-1 | Q13155 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.2590936 | . |
| Protein lin-28 homolog B | Q6ZN17 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.748527236 | . |
| Protein LSM12 | Q3MHD2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.92496373 | . |
| Protein LSM14 homolog A | Q8ND56 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.95687218 | . |
| Protein LSM14 homolog B | Q9BX40 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.780829314 | . |
| Protein mago nashi homolog | P61326 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.93055522 | . |
| Protein mago nashi homolog 2 | Q96A72 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.667338395 | . |
| Protein NipSnap homolog 2 | O75323 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.136700116 | . |
| Protein pelota homolog | Q9BRX2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.783460607 | . |
| Protein phosphatase 1 regulatory subunit 7 | Q15435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.483281876 | . |
| Protein POF1B | Q8WVV4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.478995928 | . |
| Protein PRRC2A | P48634 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.846334791 | . |
| Protein RCC2 | Q9P258 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.446719478 | . |
| Protein S100-A11 | P31949 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.13813305 | . |
| Protein S100-A4 | P26447 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.735738897 | . |
| Protein S100-A6 | P06703 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.511643288 | . |
| Protein S100-P | P25815 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.525059371 | . |
| Protein SET | Q01105 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.811808648 | . |
| Protein SGT1 homolog | Q9Y2Z0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.90810266 | . |
| Protein TMED10 | P49755 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.60262407 | . |
| Protein TRAM1 | Q15629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.172754006 | . |
| Protein transport protein Sec24C | P53992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.43313477 | . |
| Protein transport protein Sec61 subunit beta | P60468 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.099674672 | . |
| Protein virilizer homolog | Q69YN4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.262951519 | . |
| Protein-glutamine gamma-glutamyltransferase 2 | P21980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.500946401 | . |
| Protein-glutamine gamma-glutamyltransferase E | Q08188 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.06695693 | . |
| Protein-tyrosine phosphatase 1B | P18031 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.8341446 | . |
| Proton-coupled zinc antiporter SLC30A1 | Q9Y6M5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.87022869 | . |
| Pseudouridylate synthase 1 homolog | Q9Y606 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.498311491 | . |
| Pumilio homolog 1 | Q14671 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.50223516 | . |
| Pumilio homolog 2 | Q8TB72 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.085860566 | . |
| Purine nucleoside phosphorylase | P00491 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.593546156 | . |
| Puromycin-sensitive aminopeptidase | P55786 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.47155825 | . |
| Putative RNA-binding protein Luc7-like 1 | Q9NQ29 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.058435238 | . |
| Putative RNA-binding protein Luc7-like 2 | Q9Y383 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.37352649 | . |
| Pyrroline-5-carboxylate reductase 2 | Q96C36 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.846843352 | . |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -23.38557859 | . |
| Quinone oxidoreductase | Q08257 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.063783064 | . |
| Rab GDP dissociation inhibitor alpha | P31150 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.986945777 | . |
| Rab GDP dissociation inhibitor beta | P50395 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.425166892 | . |
| Ran GTPase-activating protein 1 | P46060 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.68892346 | . |
| Ran-specific GTPase-activating protein | P43487 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.252694713 | . |
| Ras GTPase-activating protein-binding protein 1 | Q13283 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.73186719 | . |
| Ras GTPase-activating protein-binding protein 2 | Q9UN86 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.726883232 | . |
| Ras GTPase-activating-like protein IQGAP1 | P46940 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.786637078 | . |
| Ras-related protein Rab-10 | P61026 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.188383229 | . |
| Ras-related protein Rab-11A | P62491 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.048404325 | . |
| Ras-related protein Rab-14 | P61106 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.345782906 | . |
| Ras-related protein Rab-1A | P62820 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.47751705 | . |
| Ras-related protein Rab-1B | Q9H0U4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.006401231 | . |
| Ras-related protein Rab-2A | P61019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.235593295 | . |
| Ras-related protein Rab-5A | P20339 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.44308115 | . |
| Ras-related protein Rab-5B | P61020 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.27026676 | . |
| Ras-related protein Rab-5C | P51148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.653807924 | . |
| Ras-related protein Rab-6A | P20340 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.507896271 | . |
| Ras-related protein Rab-6D | Q53S08 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.45562081 | . |
| Ras-related protein Rab-7a | P51149 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.46303856 | . |
| Ras-related protein Rab-8A | P61006 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.28931813 | . |
| Receptor expression-enhancing protein 6 | Q96HR9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.621253319 | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.797334004 | . |
| Regulator of chromosome condensation | P18754 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.75430055 | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.15901474 | . |
| REST corepressor 2 | Q8IZ40 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.883809855 | . |
| Reticulocalbin-2 | Q14257 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.75316801 | . |
| Reticulon-4 | Q9NQC3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.692115593 | . |
| Retinol dehydrogenase 11 | Q8TC12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.191415529 | . |
| Retrotransposon-derived protein PEG10 | Q86TG7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.371679889 | . |
| Rho family-interacting cell polarization regulator 1 | Q6ZS17 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.353714124 | . |
| Rho GDP-dissociation inhibitor 1 | P52565 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.245632464 | . |
| Rho GTPase-activating protein 1 | Q07960 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.443803703 | . |
| Rho GTPase-activating protein 23 | Q9P227 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.077834935 | . |
| Rho GTPase-activating protein 5 | Q13017 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.862627385 | . |
| Rho-related GTP-binding protein RhoC | P08134 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.948842179 | . |
| RIBIIR | P04844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.50652803 | . |
| Ribonuclease inhibitor | P13489 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.700256235 | . |
| Ribonucleoprotein PTB-binding 1 | Q8IY67 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.882917074 | . |
| Ribonucleoprotein PTB-binding 2 | Q9HCJ3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.948758562 | . |
| Ribonucleoside-diphosphate reductase subunit M1 | P23921 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.48214104 | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.802093851 | . |
| Ribose-phosphate pyrophosphokinase 1 | P60891 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.654696378 | . |
| Ribose-phosphate pyrophosphokinase 2 | P11908 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.401542824 | . |
| Ribosomal protein S6 kinase alpha-3 | P51812 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 10.11893138 | . |
| Ribosome biogenesis inhibitor MINAS-60 | P0DW28 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.134812273 | . |
| Ribosome biogenesis protein WDR12 | Q9GZL7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.512554275 | . |
| Ribosome maturation protein SBDS | Q9Y3A5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.12450528 | . |
| Ribosome-binding protein 1 | Q9P2E9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.201032207 | . |
| RNA 3'-terminal phosphate cyclase | O00442 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.44507442 | . |
| RNA binding motif protein | Q96E39 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.081918403 | . |
| RNA binding protein fox-1 homolog 2 | O43251 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.694690846 | . |
| RNA demethylase ALKBH5 | Q6P6C2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.039333944 | . |
| RNA helicase aquarius | O60306 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.669479639 | . |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.555971049 | . |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.28292771 | . |
| RNA-binding protein 12B | Q8IXT5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.365038921 | . |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.73011424 | . |
| RNA-binding protein 15 | Q96T37 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.287638361 | . |
| RNA-binding protein 25 | P49756 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.45838939 | . |
| RNA-binding protein 26 | Q5T8P6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.87382862 | . |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.513109403 | . |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.433513109 | . |
| RNA-binding protein 4 | Q9BWF3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.30780156 | . |
| RNA-binding protein 45 | Q8IUH3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.153211665 | . |
| RNA-binding protein 47 | A0AV96 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.532818919 | . |
| RNA-binding protein 4B | Q9BQ04 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.672579349 | . |
| RNA-binding protein 8A | Q9Y5S9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.32718549 | . |
| RNA-binding protein EWS | Q01844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.336870034 | . |
| RNA-binding protein FUS | P35637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.353363435 | . |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.894800835 | . |
| RNA-binding protein FXR2 | P51116 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.05979555 | . |
| RNA-binding protein Musashi homolog 1 | O43347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.881154218 | . |
| RNA-binding protein Musashi homolog 2 | Q96DH6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.514989002 | . |
| RNA-binding protein Nova-1 | P51513 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.957396329 | . |
| RNA-binding protein PNO1 | Q9NRX1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.141126165 | . |
| RNA-binding protein Raly | Q9UKM9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.969759809 | . |
| RNA-binding protein RO60 | P10155 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.317580856 | . |
| RNA-binding protein with multiple splicing | Q93062 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.692999505 | . |
| RNA-binding protein with multiple splicing 2 | Q6ZRY4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.157394151 | . |
| RNA-binding protein with serine-rich domain 1 | Q15287 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.105323184 | . |
| RNA-splicing ligase RtcB homolog | Q9Y3I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.38591357 | . |
| Rootletin | Q5TZA2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.219230573 | . |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.758547902 | . |
| rRNA 2'-O-methyltransferase fibrillarin | P22087 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.696560736 | . |
| rRNA methyltransferase 2 | Q9UI43 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.607941913 | . |
| rRNA methyltransferase 2 | Q9UI43 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.202362367 | . |
| RuvB-like 1 | Q9Y265 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.3162419 | . |
| RuvB-like 2 | Q9Y230 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.81106092 | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.35737431 | . |
| S-formylglutathione hydrolase | P10768 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.723211446 | . |
| S1 RNA-binding domain-containing protein 1 | Q8N5C6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.55632556 | . |
| Saccharopine dehydrogenase-like oxidoreductase | Q8NBX0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.518372353 | . |
| SAFB-like transcription modulator | Q9NWH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.053098714 | . |
| SAP domain-containing ribonucleoprotein | P82979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.090580679 | . |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.379070374 | . |
| Scaffold attachment factor B2 | Q14151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.89243188 | . |
| Scaffold-attachment factor A2 | Q1KMD3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.861252757 | . |
| Scinderin | Q9Y6U3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.017639727 | . |
| Sec1 family domain-containing protein 1 | Q8WVM8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.24272493 | . |
| Sepiapterin reductase | P35270 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.604560786 | . |
| Septin-10 | Q9P0V9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.216329125 | . |
| Septin-11 | Q9NVA2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.577819304 | . |
| Septin-2 | Q15019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.417504019 | . |
| Septin-6 | Q14141 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.490762215 | . |
| Septin-7 | Q16181 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.69943906 | . |
| Septin-9 | Q9UHD8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.071694209 | . |
| Sequestosome-1 | Q13501 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.573112881 | . |
| SERCA1 | O14983 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.166183764 | . |
| SERCA2 | P16615 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.41390729 | . |
| Serine hydroxymethyltransferase | P34896 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.075467834 | . |
| Serine palmitoyltransferase 1 | O15269 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.908031309 | . |
| Serine--tRNA ligase | Q9NP81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.2192 | . |
| Serine/arginine repetitive matrix protein 1 | Q8IYB3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.098890774 | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.41235159 | . |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.93199049 | . |
| Serine/arginine-rich splicing factor 10 | O75494 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.91936246 | . |
| Serine/arginine-rich splicing factor 11 | Q05519 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.42926464 | . |
| Serine/arginine-rich splicing factor 12 | Q8WXF0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.790267915 | . |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.251960417 | . |
| Serine/arginine-rich splicing factor 3 | P84103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.69089552 | . |
| Serine/arginine-rich splicing factor 4 | Q08170 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.660918984 | . |
| Serine/arginine-rich splicing factor 5 | Q13243 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.716353794 | . |
| Serine/arginine-rich splicing factor 6 | Q13247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.12551354 | . |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.33735056 | . |
| Serine/arginine-rich splicing factor 9 | Q13242 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.432374853 | . |
| Serine/threonine-protein kinase mTOR | P42345 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.0869972 | . |
| Serine/threonine-protein kinase N2 | Q16513 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.544476616 | . |
| Serine/threonine-protein kinase PRP4 homolog | Q13523 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.378148478 | . |
| Serine/threonine-protein kinase SMG1 | Q96Q15 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.80911038 | . |
| Serpin B6 | P35237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.731899382 | . |
| Serpin H1 | P50454 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.061988447 | . |
| Serrate RNA effector molecule homolog | Q9BXP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.29925547 | . |
| Serum paraoxonase/arylesterase 2 | Q15165 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.854009871 | . |
| SFL | Q9NUL5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.540316618 | . |
| SH3 domain-binding protein 1 | Q9H299 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.049095035 | . |
| Sialic acid synthase | Q9NR45 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.261201657 | . |
| Sideroflexin-1 | Q9H9B4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.596960079 | . |
| Signal recognition particle 14 kDa protein | P37108 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.29274827 | . |
| Signal recognition particle 9 kDa protein | P49458 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.932976225 | . |
| Signal recognition particle subunit SRP54 | P61011 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.46339112 | . |
| Signal recognition particle subunit SRP72 | O76094 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.96916832 | . |
| Single-stranded DNA-binding protein MSSP-1 | P29558 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.842835361 | . |
| SLCO2A1 | Q92959 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.866892944 | . |
| Small nuclear ribonucleoprotein E | P62304 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.92613446 | . |
| Small nuclear ribonucleoprotein F | P62306 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.587953616 | . |
| Small nuclear ribonucleoprotein Sm D1 | P62314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -23.64820743 | . |
| Small nuclear ribonucleoprotein Sm D2 | P62316 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.93477434 | . |
| Small nuclear ribonucleoprotein Sm D3 | P62318 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -22.94233517 | . |
| Small ubiquitin-related modifier 2 | P61956 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.37991434 | . |
| snRNP-B | P14678 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.22083652 | . |
| snRNP-N | P63162 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.313805808 | . |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.98906899 | . |
| SNW domain-containing protein 1 | Q13573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -21.31633214 | . |
| Solute carrier family 25 member 13 | Q9UJS0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.118371808 | . |
| Sorbitol dehydrogenase | Q00796 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.055421632 | . |
| Sorcin | P30626 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.677402098 | . |
| Sorting nexin-5 | Q9Y5X3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.036118428 | . |
| SPATS2-like protein | Q9NUQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.651156483 | . |
| Spectrin alpha chain | Q13813 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.203225717 | . |
| Spectrin beta chain | Q01082 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.702273873 | . |
| Sperm-associated antigen 17 | Q6Q759 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.942601784 | . |
| Spermatid perinuclear RNA-binding protein | Q96SI9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.991168419 | . |
| Spermine synthase | P52788 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.926851372 | . |
| Spliceosome RNA helicase DDX39B | Q13838 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.02198808 | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.51004384 | . |
| Splicing factor 1 | Q15637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.00694928 | . |
| Splicing factor 3A subunit 1 | Q15459 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.62697201 | . |
| Splicing factor 3B subunit 1 | O75533 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.106017966 | . |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.999798657 | . |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -21.06334992 | . |
| Splicing factor 3B subunit 4 | Q15427 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.07757943 | . |
| Splicing factor U2AF 35 kDa subunit | Q01081 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.891923711 | . |
| Splicing factor U2AF 65 kDa subunit | P26368 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.41505083 | . |
| Squalene synthase | P37268 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 10.73182869 | . |
| SR-beta | Q9Y5M8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.54417451 | . |
| SR-related and CTD-associated factor 8 | Q9UPN6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.928207182 | . |
| SRA stem-loop-interacting RNA-binding protein | Q9GZT3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.752115446 | . |
| Src substrate cortactin | Q14247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.319597905 | . |
| Stathmin-2 | Q93045 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.509355567 | . |
| Sterol O-acyltransferase 1 | P35610 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.23853001 | . |
| Stomatin-like protein 2 | Q9UJZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.71700991 | . |
| Stress-induced-phosphoprotein 1 | P31948 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.818843972 | . |
| Structural maintenance of chromosomes protein 2 | O95347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.30389982 | . |
| Structural maintenance of chromosomes protein 4 | Q9NTJ3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -21.27195794 | . |
| Sucrose nonfermenting protein 2 homolog | O60264 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.413590973 | . |
| Sulfotransferase 2A1 | Q06520 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.798763002 | . |
| Sulfotransferase 2B1 | O00204 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.051496752 | . |
| SUMO-activating enzyme subunit 1 | Q9UBE0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.20257021 | . |
| SUMO-activating enzyme subunit 2 | Q9UBT2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.56523377 | . |
| Suppressor of CDC2 with RNA-binding motif 3 | Q15434 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.468721847 | . |
| Surfeit locus protein 4 | O15260 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.548130122 | . |
| SURP and G-patch domain-containing protein 2 | Q8IX01 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.16785454 | . |
| Symplekin | Q92797 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.48327631 | . |
| Synaptic vesicle membrane protein VAT-1 homolog | Q99536 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.398838474 | . |
| Syntaxin-7 | O15400 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.21814996 | . |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.03622388 | . |
| T-complex protein 1 subunit beta | P78371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.59667297 | . |
| T-complex protein 1 subunit delta | P50991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.670715859 | . |
| T-complex protein 1 subunit epsilon | P48643 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.00091094 | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.557864487 | . |
| T-complex protein 1 subunit gamma | P49368 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -21.71195229 | . |
| T-complex protein 1 subunit zeta | P40227 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.8428509 | . |
| Talin-1 | Q9Y490 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.02534752 | . |
| TAR DNA-binding protein 43 | Q13148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -21.2309524 | . |
| TATA-binding protein-associated factor 2N | Q92804 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.410369903 | . |
| Telomerase-binding protein EST1A | Q86US8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.110984796 | . |
| TERF2-interacting telomeric protein 1 | Q9NYB0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.335600193 | . |
| Testin | Q9UGI8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.507740197 | . |
| Thioredoxin | P10599 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.92707854 | . |
| Thioredoxin domain-containing protein 5 | Q8NBS9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.781941658 | . |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.79909876 | . |
| Thioredoxin-like protein 1 | O43396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.343690016 | . |
| THO complex subunit 2 | Q8NI27 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.03422048 | . |
| THO complex subunit 4 | Q86V81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.52022378 | . |
| Threonine--tRNA ligase | Q9BW92 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -20.29088888 | . |
| Threonine--tRNA ligase 1 | P26639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.98885048 | . |
| THUMP domain-containing protein 1 | Q9NXG2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.32845253 | . |
| Thymidylate kinase | P23919 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -21.03014692 | . |
| Thyroid hormone receptor-associated protein 3 | Q9Y2W1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.303590803 | . |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.679831803 | . |
| TIP41-like protein | O75663 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.85693186 | . |
| Tissue-specific extinguisher 1 | P10644 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.92262312 | . |
| Titin | Q8WZ42 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.73651183 | . |
| Transaldolase | P37837 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.51410238 | . |
| Transcription activator BRG1 | P51532 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.93572475 | . |
| Transcription elongation regulator 1 | O14776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.250933025 | . |
| Transcription factor A | Q00059 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.572495296 | . |
| Transcription factor BTF3 | P20290 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.60591474 | . |
| Transcription factor ISGF-3 components p91/p84 | P42224 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.381538847 | . |
| Transcription intermediary factor 1-beta | Q13263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.228579622 | . |
| Transcriptional activator protein Pur-alpha | Q00577 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.56525684 | . |
| Transcriptional activator protein Pur-beta | Q96QR8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.422463093 | . |
| Transducin beta chain 1 | P62873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.966405708 | . |
| Transducin beta-like protein 2 | Q9Y4P3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.2975553 | . |
| Transformer-2 protein homolog alpha | Q13595 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.099767317 | . |
| Transformer-2 protein homolog beta | P62995 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 9.461694567 | . |
| Transforming protein RhoA | P61586 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.741426846 | . |
| Transgelin-2 | P37802 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.616220762 | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.55739458 | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.169643971 | . |
| Translationally-controlled tumor protein | P13693 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.1926923 | . |
| Translin | Q15631 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.436576078 | . |
| Translocation protein SEC63 homolog | Q9UGP8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.61936423 | . |
| Translocon-associated protein subunit delta | P51571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.320707068 | . |
| Translocon-associated protein subunit gamma | Q9UNL2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.560458838 | . |
| Transmembrane protease serine 2 | O15393 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.441151827 | . |
| Transmembrane protein 109 | Q9BVC6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.865001835 | . |
| Transmembrane protein 209 | Q96SK2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.3321484 | . |
| Transmembrane protein 33 | P57088 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.645042306 | . |
| Transmembrane protein 40 | Q8WWA1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.365419381 | . |
| Transportin-1 | Q92973 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -19.116897 | . |
| Tricarboxylate transport protein | P53007 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.810546672 | . |
| Triosephosphate isomerase | P60174 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.48846216 | . |
| tRNA (guanine(26)-N(2))-dimethyltransferase | Q9NXH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.408159665 | . |
| tRNA methyltransferase 10 homolog C | Q7L0Y3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.556878275 | . |
| tRNA methyltransferase 112 homolog | Q9UI30 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.668205976 | . |
| Tropomyosin alpha-1 chain | P09493 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.91156507 | . |
| Tropomyosin alpha-3 chain | P06753 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.822719651 | . |
| Tropomyosin alpha-4 chain | P67936 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.138679471 | . |
| Tropomyosin beta chain | P07951 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.358268542 | . |
| Troponin T | P45378 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.454639804 | . |
| Trypsin-3 | P35030 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.573157668 | . |
| Tryptophan--tRNA ligase | P23381 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.593072801 | . |
| Tubulin alpha-1A chain | Q71U36 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.29092042 | . |
| Tubulin alpha-1B chain | P68363 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.84050927 | . |
| Tubulin alpha-1C chain | Q9BQE3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.492181676 | . |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.19157054 | . |
| Tubulin beta-2A chain | Q13885 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.403777465 | . |
| Tubulin beta-2B chain | Q9BVA1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.1098631 | . |
| Tubulin beta-3 chain | Q13509 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.224221823 | . |
| Tubulin beta-4B chain | P68371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.687203483 | . |
| Tubulin beta-6 chain | Q9BUF5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.154718578 | . |
| Tubulin beta-8 chain | Q3ZCM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.69910469 | . |
| Tubulin-folding cofactor B | Q99426 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.37404256 | . |
| Tubulin-specific chaperone D | Q9BTW9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.991752878 | . |
| Tubulin-specific chaperone E | Q15813 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -20.94785306 | . |
| Tudor domain-containing protein 3 | Q9H7E2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.17744014 | . |
| Twinfilin-1 | Q12792 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.74416834 | . |
| Tyrosine--tRNA ligase | P54577 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.808720454 | . |
| Tyrosine-protein kinase CSK | P41240 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.45314026 | . |
| U1 small nuclear ribonucleoprotein 70 kDa | P08621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.190271713 | . |
| U1 small nuclear ribonucleoprotein A | P09012 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.56552209 | . |
| U1 small nuclear ribonucleoprotein C | P09234 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.339660403 | . |
| U2 small nuclear ribonucleoprotein A' | P09661 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.70607296 | . |
| U2 small nuclear ribonucleoprotein B'' | P08579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.59503283 | . |
| UAP56-interacting factor | Q96QD9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.151837814 | . |
| Ubiquinone biosynthesis methyltransferase COQ5 | Q5HYK3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.470386836 | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.29616496 | . |
| Ubiquitin carboxyl-terminal hydrolase 14 | P54578 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.860701443 | . |
| Ubiquitin carboxyl-terminal hydrolase 5 | P45974 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.956431669 | . |
| Ubiquitin carboxyl-terminal hydrolase 7 | Q93009 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.61012747 | . |
| Ubiquitin thioesterase OTUB1 | Q96FW1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.514291868 | . |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.5087297 | . |
| Ubiquitin-associated protein 2 | Q5T6F2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.394477851 | . |
| Ubiquitin-associated protein 2-like | Q14157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 8.110475484 | . |
| Ubiquitin-conjugating enzyme E2 D2 | P62837 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.920156082 | . |
| Ubiquitin-conjugating enzyme E2 K | P61086 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.211990754 | . |
| Ubiquitin-conjugating enzyme E2 L3 | P68036 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -21.92050607 | . |
| Ubiquitin-conjugating enzyme E2 N | P61088 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -23.50462188 | . |
| Ubiquitin-conjugating enzyme E2 variant 1 | Q13404 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.90778539 | . |
| Ubiquitin-like modifier-activating enzyme 1 | P22314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.16831972 | . |
| Ubiquitin-like modifier-activating enzyme 5 | Q9GZZ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.1279238 | . |
| Ubiquitin-like-conjugating enzyme ATG3 | Q9NT62 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.33141398 | . |
| UBX domain-containing protein 1 | Q04323 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.420792809 | . |
| UCH-L1 | P09936 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.099496309 | . |
| UDP-glucose 6-dehydrogenase | O60701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.415871683 | . |
| UMP-CMP kinase | P30085 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -20.67943413 | . |
| Upstream-binding protein 1 | Q9NZI7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.958615037 | . |
| Uridine 5'-monophosphate synthase | P11172 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.252109225 | . |
| Uridine phosphorylase 1 | Q16831 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.718945181 | . |
| UTP--glucose-1-phosphate uridylyltransferase | Q16851 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.50559951 | . |
| UV excision repair protein RAD23 homolog B | P54727 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.461476771 | . |
| V-type proton ATPase subunit E 1 | P36543 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.006346651 | . |
| Vacuolar protein sorting-associated protein 35 | Q96QK1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.94994821 | . |
| Valacyclovir hydrolase | Q86WA6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.725034722 | . |
| Valine--tRNA ligase | P26640 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.87601606 | . |
| VAMP-A | Q9P0L0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.646715357 | . |
| Vasodilator-stimulated phosphoprotein | P50552 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.455569137 | . |
| VDAC-1 | P21796 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.010686415 | . |
| VDAC-2 | P45880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.442904439 | . |
| VDAC-3 | Q9Y277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.251736292 | . |
| Very-long-chain enoyl-CoA reductase | Q9NZ01 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.68395009 | . |
| Vesicle-trafficking protein SEC22b | O75396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.02903377 | . |
| Vesicular integral-membrane protein VIP36 | Q12907 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.603199079 | . |
| Vigilin | Q00341 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.14418508 | . |
| Villin-1 | P09327 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.841371989 | . |
| Vimentin | P08670 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.759531183 | . |
| Vinculin | P18206 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.909403876 | . |
| Vinexin | O60504 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.829204337 | . |
| WD repeat-containing protein 1 | O75083 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.70821295 | . |
| WD repeat-containing protein 5 | P61964 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -14.27818132 | . |
| WD40 repeat-containing protein SMU1 | Q2TAY7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -17.91867247 | . |
| WW domain-binding protein 11 | Q9Y2W2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.72782854 | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.66743073 | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.931166264 | . |
| Xaa-Pro aminopeptidase 3 | Q9NQH7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.656721692 | . |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.16970029 | . |
| Y-box-binding protein 3 | P16989 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.987640948 | . |
| YLP motif-containing protein 1 | P49750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.114217649 | . |
| YTH domain-containing family protein 1 | Q9BYJ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.861869253 | . |
| YTH domain-containing family protein 2 | Q9Y5A9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.608927965 | . |
| YTH domain-containing family protein 3 | Q7Z739 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.183655394 | . |
| YTH domain-containing protein 1 | Q96MU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -18.93588347 | . |
| Zinc finger C4H2 domain-containing protein | Q9NQZ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.748895077 | . |
| Zinc finger CCCH domain-containing protein 15 | Q8WU90 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.128050366 | . |
| Zinc finger CCCH domain-containing protein 4 | Q9UPT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.887842214 | . |
| Zinc finger CCCH domain-containing protein 7A | Q8IWR0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.329003195 | . |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.872372824 | . |
| Zinc finger CCCH-type antiviral protein 1-like | Q96H79 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 7.011977219 | . |
| Zinc finger CCHC domain-containing protein 3 | Q9NUD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.455765287 | . |
| Zinc finger protein 385B | Q569K4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.120078903 | . |
| Zinc finger protein 438 | Q7Z4V0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.761520878 | . |
| Zinc finger protein 638 | Q14966 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.410913014 | . |
| Zinc finger protein 749 | O43361 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.647690085 | . |
| Zinc finger protein 787 | Q6DD87 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.780254871 | . |
| Zinc finger protein 9 | P62633 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.346696142 | . |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.516586908 | . |
| Zinc finger SWIM domain-containing protein 8 | A7E2V4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.564914358 | . |
Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| Spliceosome | KEGG Pathway | 7.71E-49 | 15.94292689 | 1856.732409 |
| Ribosome | KEGG Pathway | 7.90E-32 | 9.898198904 | 758.1992253 |
| mRNA surveillance pathway | KEGG Pathway | 9.17E-31 | 15.01662148 | 1107.36361 |
| Parkinson disease | KEGG Pathway | 1.33E-21 | 5.339067918 | 279.5586603 |
| Coronavirus disease | KEGG Pathway | 2.41E-21 | 5.516202409 | 284.3069763 |
| RNA transport | KEGG Pathway | 1.04E-20 | 6.211457647 | 309.9436937 |
| Amyotrophic lateral sclerosis | KEGG Pathway | 1.21E-20 | 4.174255427 | 207.0128127 |
| Proteasome | KEGG Pathway | 7.01E-19 | 20.15861572 | 915.1834992 |
| Prion disease | KEGG Pathway | 3.27E-18 | 4.518759796 | 197.6586757 |
| Pathways of neurodegeneration | KEGG Pathway | 4.01E-18 | 3.41474353 | 148.3114135 |
| Alzheimer disease | KEGG Pathway | 3.48E-15 | 3.507796643 | 128.2822187 |
| Protein processing in endoplasmic reticulum | KEGG Pathway | 3.95E-15 | 5.266804633 | 191.4882371 |
| Huntington disease | KEGG Pathway | 1.70E-14 | 3.735929983 | 130.0715057 |
| Spinocerebellar ataxia | KEGG Pathway | 2.21E-12 | 5.153323831 | 153.9538302 |
| Glycolysis / Gluconeogenesis | KEGG Pathway | 7.75E-12 | 8.42062889 | 240.4271132 |
| Aminoacyl-tRNA biosynthesis | KEGG Pathway | 4.12E-11 | 8.07766569 | 216.6082635 |
| Salmonella infection | KEGG Pathway | 5.00E-09 | 3.229457748 | 70.91352714 |
| Pentose phosphate pathway | KEGG Pathway | 2.96E-08 | 12.29285983 | 247.3635354 |
| Tight junction | KEGG Pathway | 4.10E-06 | 3.175965262 | 48.07538782 |
| Cysteine and methionine metabolism | KEGG Pathway | 4.82E-05 | 5.457632086 | 68.87965637 |
Virus RNA Sequence Information
|
>NC_001479.1 Encephalomyocarditis virus, complete genome
TTGAAAGCCGGGGGTGGGAGATCCGGATTGCCAGTCTGCTCGATATCGCAGGCTGGGTCCGTGACTACCC
ACTCCCCCTTTCAACGTGAAGGCTACGATAGTGCCAGGGCGGGTACTGCCGTAAGTGCCACCCCAAAATA
ACAACAGACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCTCTCCCTCCCCCCCCCC
TAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATA
TTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTC
TTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTC
TTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTC
TGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTT
GGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAA
GGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTA
AAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCA
CAACCATGGAACAAGAGACTTGCGCGCACTCTCTCACTTTTGAGGAATGCCCAAAATGCTCTGCTCTACA
ATACCGTAATGGATTTTACCTGCTAAAGTATGATGAAGAATGGTACCCAGAGGAGTTATTGACTGATGGA
GAGGATGATGTCTTTGATCCCGAATTAGACATGGAAGTCGTTTTCGAGTTACAGGGCAATTCCACCTCCT
CAGACAAGAATAACTCCTCCTCGGAAGGCAATGAAGGTGTGATCATCAATAACTTTTACTCCAACCAATA
TCAAAACTCCATTGACCTCTCTGCTAATGCAGCCGGGTCTGACCCACCCAGAACCTACGGTCAATTTTCG
AATCTCTTTTCGGGCGCAGTGAATGCCTTTTCTAATATGCTTCCATTGCTAGCTGATCAAAATACAGAAG
AAATGGAGAATCTGTCTGATCGAGTGTCTCAAGACACTGCCGGCAATACGGTCACAAACACCCAGTCAAC
AGTGGGCCGTCTTGTCGGTTATGGTACCGTTCATGATGGAGAGCATCCGGCATCATGTGCTGACACTGCT
TCAGAAAAGATCCTGGCGGTGGAAAGGTACTACACCTTCAAGGTTAATGATTGGACATCAACACAAAAGC
CCTTTGAGTACATCCGCATTCCCCTTCCTCACGTCCTGTCCGGTGAAGATGGTGGTGTCTTTGGTGCGGC
CCTCCGCCGGCACTACCTGGTGAAAACTGGATGGCGGGTGCAAGTTCAGTGCAACGCCTCTCAATTCCAC
GCTGGAGGTTTGCTGGTGTTCATGGCACCAGAGTATCCAACCTTAGATGCTTTTGCCATGGACAACCGTT
GGTCCAAGGATAACCTGCCTAATGGAACCAGAACTCAGACAAACAAAAAGGGACCATTTGCCATGGACCA
TCAGAACTTCTGGCAGTGGACCTTGTATCCCCATCAATTCCTGAATCTGAGAACTAACACCACAGTGGAT
CTTGAGGTGCCATATGTAAACATAGCCCCCACTTCCTCCTGGACACAACATGCTTCCTGGACTTTGGTGA
TTGCAGTGGTTGCTCCCCTGACATACTCAACCGGGGCTTCTACCAGTTTGGATATCACCGCTTCTATTCA
GCCAGTAAGGCCTGTCTTTAATGGCCTCCGGCATGAGACACTTTCTAGACAGTCGCCCATTCCGGTCACA
ATTAGAGAACATGCTGGTACCTGGTATTCTACTCTGCCAGACAGCACAGTGCCTATTTATGGCAAGACTC
CTGTTGCTCCATCCAATTACATGGTAGGCGAATACAAGGACTTCCTGGAGATAGCTCAGATTCCAACCTT
TATTGGGAATAAGATCCCTAATGCTGTCCCCTACATTGAGGCATCCAACACAGCCGTCAAGACCCAACCG
CTGGCCACCTATCAAGTGACCTTGTCCTGCTCCTGTCTGGCCAATACATTCTTGGCCGCTTTGTCTAGAA
ACTTTGCTCAGTACCGGGGATCATTGGTTTATACCTTTGTGTTCACTGGGACCGCGATGATGAAGGGCAA
GTTCCTCATTGCCTACACCCCACCTGGAGCGGGCAAGCCCACTAGTCGAGACCAAGCCATGCAGGCGACT
TATGCGATTTGGGATTTGGGGCTAAATTCTTCTTACTCCTTCACTGTGCCTTTTATTTCTCCCACTCACT
TCCGCATGGTAGGTACTGACCAAGTCAACATCACTAATGCGGATGGCTGGGTTACCGTGTGGCAGCTCAC
TCCCCTCACTTACCCACCAGGATGCCCGACCTCTGCTAAGATACTAACAATGGTGAGCGCAGGGAAGGAT
TTCTCACTCAAGATGCCTATCTCACCTGCCCCCTGGAGCCCTCAGGGAGTAGAAAACGCTGAAAAAGGGG
TCACTGAAAACACAAACGCAACTGCTGACTTTGTGGCTCAACCAGTTTACTTGCCTGAGAACCAAACGAA
GGTGGCTTTCTTCTATAATAGGTCCAGTCCCATTGGTGCCTTCACCGTGAAGTCCGGCAGTCTAGAATCT
GGTTTTGCCCCGTTCTCTAATGGGACTTGCCCGAACTCAGTGATACTGACCCCTGGGCCCCAATTTGACC
CCGCCTATGACCAACTCAGGCCACAGCGTCTGACAGAAATTTGGGGCAATGGAAATGAGGAGACCTCAAA
AGTCTTTCCGCTTAAATCCAAACAGGATTATTCCTTCTGCCTCTTCTCCCCCTTTGTGTATTATAAATGT
GATTTAGAAGTGACTCTTAGTCCTCACACTTCAGGCAACCATGGGCTGTTGGTGAGGTGGTGTCCCACTG
GTACACCAACCAAGCCCACTACCCAGGTTCTCCATGAAGTAAGTTCCCTCTCAGAAGGCAGAACCCCCCA
GGTTTATAGTGCCGGACCTGGCATTTCAAATCAGATTTCCTTTGTAGTTCCTTACAATTCTCCACTTTCA
GTCCTATCAGCTGTCTGGTATAATGGACACAAGAGATTTGACAACACTGGGAGCTTGGGCATTGCCCCTA
ATTCTGATTTCGGCACTCTGTTCTTTGCTGGCACAAAGCCTGACATTAAATTCACAGTCTACTTGAGATA
CAAGAATAAGAGAGTTTTTTGCCCACGTCCGACTGTCTTTTTCCCCTGGCCCACTTCCGGAGACAAGATT
GATATGACCCCGAGAGCTGGAGTCTTGATGCTAGAGAGTCCAAATGCCCTAGACATTTCAAGAACATACC
CCACGTTACATGTTCTCATTCAATTCAACCATAGAGGTTTGGAGGTTAGATTGTTTAGACATGGACACTT
TTGGGCTGAAACACGTGCGGACGTGATTCTGAGATCAAAGACCAAACAGGTCTCTTTCCTGAGCAACGGG
AACTACCCGTCAATGGACTCTAGAGCTCCCTGGAATCCTTGGAAGAATACCTACCAGGCGGTTCTAAGAG
CAGAACCATGTAGAGTGACCATGGATATATATTATAAGAGAGTCAGGCCTTTTAGACTGCCCCTGGTTCA
GAAGGAATGGCCCGTGCGAGAGGAGAACGTTTTCGGTTTGTACCGGATCTTCAATGCCCACTACGCTGGT
TACTTTGCGGACCTACTGATTCATGACATTGAGACAAATCCAGGGCCCTTCATGTTTAGACCAAGGAAAC
AGGTTTTCCAGACCCAAGGAGCGGCAGTGTCATCAATGGCTCAAACCCTACTGCCGAACGACCTTGCCAG
CAAAGCTATGGGATCAGCTTTTACGGCTTTGCTCGATGCCAACGAGGACGCCCAAAAAGCAATGAAGATT
ATAAAGACATTAAGTTCTCTATCGGATGCATGGGAAAATGTAAAAGAAACACTAAACAACCCAGAGTTCT
GGAAGCAGCTCTTGAGCAGATGTGTGCAGCTGATTGCAGGGATGACAATAGCAGTGATGCATCCGGACCC
TTTGACTCTGCTCTGCTTAGGAACATTGACGGCCGCCGAGATTACAAGCCAGACAAGTCTGTGCGAAGAA
ATAGCAGCTAAGTTCAAGACAATTTTCATCACTCCTCCACCACGGTTTCCCACAATCTCTCTTTTCCAAC
AACAATCCCCCTTGAAACAGGTAAATGATATTTTCTCCCTAGCCAAGAACCTGGACTGGGCCGTCAAGAC
TGTGGAAAAGGTGGTTGATTGGTTTGGGACATGGATAGTACAGGAGGAAAAGGAACAGACCCTAGATCAG
CTCTTGCAGCGTTTCCCCGAACATGCGAAGCGCATTTCTGATCTCCGGAATGGAATGGCCGCCTATGTAG
AGTGCAAGGAGAGTTTTGATTTCTTTGAAAAGCTGTACAATCAGGCAGTGAAAGAGAAGAGAACGGGTAT
CGCCGCCGTCTGTGAAAAATTCAGACAGAAGCATGACCACGCCACCGCTCGGTGTGAGCCAGTCGTGATT
GTGCTCCGCGGAGACGCGGGGCAAGGGAAATCTTTATCAAGTCAGGTTATTGCCCAGGCCGTCTCCAAGA
CCATTTTCGGCCGGCAATCTGTGTATTCCCTTCCCCCCGATTCGGATTTCTTTGATGGCTATGAAAATCA
GTTTGCAGCAATAATGGATGATCTAGGGCAAAATCCTGATGGCTCTGATTTCACTACGTTCTGTCAGATG
GTTTCGACTACCAATTTTCTCCCCAATATGGCTAGTCTAGAGAGAAAGGGCACCCCCTTTACATCTCAGC
TTGTGGTGGCAACTACCAATCTGCCTGAGTTTAGACCTGTCACAATAGCCCATTACCCTGCTGTTGAGAG
AAGGATAACTTTCGACTATTCAGTGTCTGCTGGTCCAGTCTGCTCCAAAACAGAGGCCGGGTATAAGGTT
TTGGATGTTGAAAGAGCCTTTAGGCCTACCGGTGAGGCTCCTCTTCCATGCTTCCAGAATAACTGCCTTT
TCCTTGAGAAAGCTGGGCTCCAGTTCAGAGATAACCGAACTAAAGAGATCATTTCCCTGGTAGATGTGAT
TGAGAGAGCCGTGGCTAGGATTGAAAGGAAGAAGAAAGTTCTCACAACCGTGCAGACCCTTGTGGCACAA
GGTCCAGTAGACGAGGTCAGTTTCCATTCCGTAGTCCAGCAGCTTAAAGCAAGACAGCAAGCGACAGATG
AACAGCTTGAGGAATTGCAAGAGGCTTTCGCGAAAGTACAGGAGCGTAACTCTGTGTTTTCTGATTGGTT
GAAGATTTCTGCAATGTTGTGTGCTGCGACTCTGGCACTTTCCCAAGTTGTCAAGATGGCCAAGGCGGTG
AAGCAGATGGTCAAGCCTGATCTGGTTCGTGTGCAATTGGATGAGCAGGAGCAGGGACCTTACAATGAGA
CAGCGAGAGTTAAACCAAAAACACTGCAGTTGTTGGACATTCAGGGACCAAACCCTGTGATGGACTTTGA
AAAATATGTAGCCAAACATGTAACCGCCCCCATTGGTTTTGTCTACCCCACTGGGGTGAGCACCCAGACT
TGCCTCCTTGTGAGAGGCCGCACCTTGGTAGTAAATAGACACATGGCCGAGTCTGACTGGACTTCCATAG
TAGTGCGTGGAGTCACACACGCCCGCTCTACTGTTAAAATTTTGGCCATAGCTAAAGCAGGCAAAGAGAC
TGACGTATCTTTCATCCGCCTCTCTTCTGGTCCTCTATTCAGAGACAATACATCCAAATTTGTCAAGGCT
GGTGATGTACTTCCTACTGGTGCCGCTCCAGTCACGGGGATAATGAACACGGACATACCCATGATGTACA
CAGGAACCTTCCTGAAAGCTGGTGTGTCAGTCCCAGTGGAAACCGGCCAGACCTTTAATCACTGTATTCA
TTACAAGGCTAACACACGAAAGGGCTGGTGTGGATCAGCCCTACTGGCAGATCTTGGAGGAAGCAAGAAA
ATCCTTGGCATCCATTCTGCTGGCTCTATGGGAATAGCCGCCGCCTCGATTGTGTCACAGGAGATGATTC
GGGCGGTAGTGAATGCCTTTGAGCCACAGGGTGCTCTCGAGAGATTGCCAGATGGGCCCCGTATTCACGT
ACCACGTAAAACAGCACTACGCCCCACCGTTGCCCGTCAAGTCTTCCAACCAGCATATGCCCCGGCTGTT
CTATCGAAATTTGACCCTAGAACAGAGGCTGATGTAGATGAAGTGGCTTTCTCCAAACATACCTCCAACC
AGGAAAGCCTCCCACCAGTGTTTAGAATGGTAGCCAAAGAGTATGCCAATAGAGTTTTCACCTTGCTGGG
AAAAGACAATGGCCGTCTGACTGTAAAGCAGGCTTTGGAAGGACTGGAGGGGATGGACCCCATGGACAGG
AACACCTCCCCGGGGCTTCCATATACTGCGCTAGGAATGCGCAGAACAGATGTCGTAGATTGGGAATCAG
CCACCCTGATCCCGTTTGCGGCAGAAAGATTAAGAAAAATGAATGAAGGAGACTTTTCCGAAGTTGTCTA
TCAAACATTCCTCAAGGATGAGCTTAGACCGATAGAGAAGGTTCAAGCCGCCAAGACACGGATTGTAGAT
GTTCCACCATTTGAGCATTGCATTCTGGGTAGACAATTGTTGGGAAAGTTTGCATCAAAGTTCCAGACCC
AACCGGGTCTGGAACTAGGATCAGCCATTGGATGTGACCCAGATGTACACTGGACTGCCTTCGGTGTCGC
CATGCAAGGTTTTGAGCGTGTCTACGATGTGGACTACTCCAACTTTGATTCGACCCATTCGGTGGCAATG
TTCCGCTTATTGGCTGAGGAATTTTTCACTCCAGAGAATGGTTTTGACCCCCTGACTAGAGAATATCTTG
AGTCATTAGCCATTTCAACCCATGCGTTTGAGGAGAAGCGCTTTCTGATAACCGGTGGTCTCCCATCAGG
TTGTGCAGCGACCTCAATGCTAAACACTATAATGAATAATATAATAATTAGGGCGGGTTTGTATCTCACG
TATAAAAATTTTGAATTTGATGATGTGAAGGTGTTGTCGTACGGAGATGATCTCCTTGTGGCCACAAATT
ACCAATTGGATTTTGATAAGGTGAGAGCAAGCCTCGCAAAGACAGGATATAAGATAACTCCCGCTAACAC
AACTTCTACCTTTCCTCTTAATTCGACGCTTGAAGACGTTGTCTTCTTAAAAAGAAAGTTTAAGAAAGAG
GGCCCTCTGTATCGGCCTGTCATGAACAGAGAGGCGTTGGAAGCAATGTTGTCATACTATCGTCCAGGGA
CTCTATCTGAGAAACTCACTTCGATCACTATGCTTGCCGTTCATTCTGGCAAGCAGGAATATGATCGGCT
CTTTGCCCCATTCCGTGAGGTAGGGGTTGTCGTGCCATCATTCGAGAGTGTGGAGTACAGATGGAGGAGT
CTGTTCTGGTAGTAGTGTAGTCACTGGCACAACGCGTTACCCGGTAAGCCAATCGGGTATACACGGTCGT
CATACTGCAGACAGGGTTCTTCTACTTTGCAAGATAGTCTAGAGTAGTAAAATAAATAGATAGAG
Click to Show/Hide
|

