Home
Search 
BLAST
Manual
DownloadDetails of Virus RNA
| Strain Information | Strain Name |
Influenza A virus
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Family |
Orthomyxoviridae
|
||||||||
| RNA Binding Site |
5'UTR - 3'UTR
|
||||||||
| Virus Information | Virus Name |
Influenza A virus (IAV)
|
|||||||
| Taxonomy ID | 11320 | ||||||||
Full list of proteins interacting with the 5'UTR - 3'UTR of this Strain
| Protein Name | Uniprot ID | Host Species | Pro Info | Detection Method | Infection Cell | Cell ID | Cell Originated Tissue | Infection Time | Interaction Score | Fold Change |
|---|---|---|---|---|---|---|---|---|---|---|
| 100 kDa coactivator | Q7KZF4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.719152226 | . |
| 13 kDa differentiation-associated protein | Q9UI09 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.589416888 | . |
| 14 kDa phosphohistidine phosphatase | Q9NRX4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.829378949 | . |
| 14-3-3 protein beta/alpha | P31946 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.916721692 | . |
| 14-3-3 protein epsilon | P62258 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.237310852 | . |
| 14-3-3 protein eta | Q04917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.073576978 | . |
| 14-3-3 protein gamma | P61981 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.717826332 | . |
| 14-3-3 protein sigma | P31947 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.481234209 | . |
| 14-3-3 protein theta | P27348 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.804882817 | . |
| 14-3-3 protein zeta/delta | P63104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.023142547 | . |
| 140 kDa Ser/Arg-rich domain protein | O15042 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.41398293 | . |
| 17-beta-hydroxysteroid dehydrogenase type 2 | P37059 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.990047315 | . |
| 2',5'-phosphodiesterase 12 | Q6L8Q7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.670466389 | . |
| 2-oxoisovalerate dehydrogenase subunit beta | P21953 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.616224772 | . |
| 26S proteasome non-ATPase regulatory subunit 11 | O00231 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.877849718 | . |
| 26S proteasome non-ATPase regulatory subunit 12 | O00232 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.144862096 | . |
| 26S proteasome non-ATPase regulatory subunit 13 | Q9UNM6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.977488976 | . |
| 26S proteasome non-ATPase regulatory subunit 14 | O00487 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.820149858 | . |
| 26S proteasome non-ATPase regulatory subunit 2 | Q13200 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.674954573 | . |
| 26S proteasome non-ATPase regulatory subunit 3 | O43242 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.567845105 | . |
| 26S proteasome non-ATPase regulatory subunit 4 | P55036 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.042071976 | . |
| 26S proteasome non-ATPase regulatory subunit 5 | Q16401 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.068195925 | . |
| 26S proteasome non-ATPase regulatory subunit 6 | Q15008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.78463145 | . |
| 26S proteasome non-ATPase regulatory subunit 7 | P51665 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.457621645 | . |
| 26S proteasome regulatory subunit 10B | P62333 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.641134457 | . |
| 26S proteasome regulatory subunit 4 | P62191 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.675484174 | . |
| 26S proteasome regulatory subunit 6A | P17980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.65620554 | . |
| 26S proteasome regulatory subunit 6B | P43686 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.526893359 | . |
| 26S proteasome regulatory subunit 7 | P35998 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.953806242 | . |
| 26S proteasome regulatory subunit 8 | P62195 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.833983982 | . |
| 28S ribosomal protein S26 | Q9BYN8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.94530507 | . |
| 28S ribosomal protein S29 | P51398 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.640212551 | . |
| 28S ribosomal protein S39 | Q96EY7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.802346921 | . |
| 28S ribosomal protein S5 | P82675 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.949584575 | . |
| 28S ribosomal protein S7 | Q9Y2R9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.3828639 | . |
| 28S ribosomal protein S9 | P82933 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.061613534 | . |
| 3'(2'),5'-bisphosphate nucleotidase 1 | O95861 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.804978204 | . |
| 3-hydroxyacyl-CoA dehydrogenase type-2 | Q99714 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.984482848 | . |
| 3-hydroxyisobutyryl-CoA hydrolase | Q6NVY1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.384314888 | . |
| 3-ketoacyl-CoA thiolase | P42765 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.551754109 | . |
| 3-oxoacyl-[acyl-carrier-protein] reductase | Q8N4T8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.555451117 | . |
| 39S ribosomal protein L1 | Q9BYD6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.167342858 | . |
| 39S ribosomal protein L11 | Q9Y3B7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.018565549 | . |
| 39S ribosomal protein L12 | P52815 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.806159532 | . |
| 39S ribosomal protein L24 | Q96A35 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.545834339 | . |
| 39S ribosomal protein L37 | Q9BZE1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.257799818 | . |
| 39S ribosomal protein L38 | Q96DV4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.89450664 | . |
| 39S ribosomal protein L39 | Q9NYK5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.043808081 | . |
| 39S ribosomal protein S30 | Q9NP92 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.087095153 | . |
| 4'-phosphopantetheinyl transferase | Q9NRN7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.936772175 | . |
| 4-aminobutyrate aminotransferase | P80404 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.238053301 | . |
| 4-trimethylaminobutyraldehyde dehydrogenase | P49189 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.368497475 | . |
| 40S ribosomal protein S10 | P46783 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.567516281 | . |
| 40S ribosomal protein S11 | P62280 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.802065477 | . |
| 40S ribosomal protein S12 | P25398 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.01370927 | . |
| 40S ribosomal protein S13 | P62277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.10861103 | . |
| 40S ribosomal protein S14 | P62263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.387635259 | . |
| 40S ribosomal protein S15 | P62841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.7722687 | . |
| 40S ribosomal protein S16 | P62249 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.764401526 | . |
| 40S ribosomal protein S17 | P08708 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.696955393 | . |
| 40S ribosomal protein S18 | P62269 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.240733032 | . |
| 40S ribosomal protein S19 | P39019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.1244808 | . |
| 40S ribosomal protein S2 | P15880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.381240483 | . |
| 40S ribosomal protein S20 | P60866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.088990455 | . |
| 40S ribosomal protein S23 | P62266 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.558422401 | . |
| 40S ribosomal protein S25 | P62851 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.66507772 | . |
| 40S ribosomal protein S26 | P62854 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.171493369 | . |
| 40S ribosomal protein S28 | P62857 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.614091912 | . |
| 40S ribosomal protein S3 | P23396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.128964557 | . |
| 40S ribosomal protein S3a | P61247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.608040949 | . |
| 40S ribosomal protein S4 | P62701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.38034325 | . |
| 40S ribosomal protein S5 | P46782 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.157252039 | . |
| 40S ribosomal protein S6 | P62753 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.528679573 | . |
| 40S ribosomal protein S8 | P62241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.162087602 | . |
| 40S ribosomal protein S9 | P46781 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.81477775 | . |
| 40S ribosomal protein SA | P08865 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.451821682 | . |
| 5'-3' exoribonuclease 2 | Q9H0D6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.683560717 | . |
| 5-aminolevulinate synthase | P13196 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.512805892 | . |
| 5-methylcytosine rRNA methyltransferase NSUN4 | Q96CB9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.430841325 | . |
| 6-phosphofructokinase type A | P08237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.403268767 | . |
| 6-phosphogluconate dehydrogenase | P52209 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.305923054 | . |
| 60S acidic ribosomal protein P0 | P05388 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.451515223 | . |
| 60S ribosomal protein L10 | P27635 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.619300951 | . |
| 60S ribosomal protein L10a | P62906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.65613787 | . |
| 60S ribosomal protein L11 | P62913 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.520501638 | . |
| 60S ribosomal protein L12 | P30050 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.33113354 | . |
| 60S ribosomal protein L13 | P26373 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.104567912 | . |
| 60S ribosomal protein L13a | P40429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.457774082 | . |
| 60S ribosomal protein L14 | P50914 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.79095451 | . |
| 60S ribosomal protein L15 | P61313 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.739886817 | . |
| 60S ribosomal protein L18 | Q07020 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.783688021 | . |
| 60S ribosomal protein L18a | Q02543 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.728054709 | . |
| 60S ribosomal protein L19 | P84098 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.099237526 | . |
| 60S ribosomal protein L21 | P46778 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.811433429 | . |
| 60S ribosomal protein L22 | P35268 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.578794168 | . |
| 60S ribosomal protein L23 | P62829 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.069957568 | . |
| 60S ribosomal protein L23a | P62750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.189491429 | . |
| 60S ribosomal protein L24 | P83731 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.177147562 | . |
| 60S ribosomal protein L26 | P61254 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.253175158 | . |
| 60S ribosomal protein L27a | P46776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.640349731 | . |
| 60S ribosomal protein L28 | P46779 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.79824713 | . |
| 60S ribosomal protein L29 | P47914 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.732648262 | . |
| 60S ribosomal protein L3 | P39023 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.259396896 | . |
| 60S ribosomal protein L30 | P62888 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.688994069 | . |
| 60S ribosomal protein L34 | P49207 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.327605087 | . |
| 60S ribosomal protein L36a | P83881 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.020116017 | . |
| 60S ribosomal protein L37a | P61513 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.612155703 | . |
| 60S ribosomal protein L4 | P36578 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.075760706 | . |
| 60S ribosomal protein L5 | P46777 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.602218497 | . |
| 60S ribosomal protein L6 | Q02878 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.26132231 | . |
| 60S ribosomal protein L7 | P18124 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.649635216 | . |
| 60S ribosomal protein L7a | P62424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.121238297 | . |
| 60S ribosomal protein L8 | P62917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.705852679 | . |
| 60S ribosomal protein L9 | P32969 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.277213969 | . |
| 7-dehydrocholesterol reductase | Q9UBM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.087578143 | . |
| A-kinase anchor protein 8 | O43823 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.178935003 | . |
| A-kinase anchor protein 8-like | Q9ULX6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.791376437 | . |
| Acetyl-CoA acetyltransferase | Q9BWD1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.106793012 | . |
| Acidic protein rich in leucines | Q92688 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.855388679 | . |
| Acrosomal protein KIAA1210 | Q9ULL0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.59245941 | . |
| Actin | P68133 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.012237137 | . |
| Actin | P63261 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.582965294 | . |
| Actin | P68032 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.432684724 | . |
| Actin-related protein 2 | P61160 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.841228125 | . |
| Actin-related protein 2/3 complex subunit 1B | O15143 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.353665057 | . |
| Actin-related protein 2/3 complex subunit 2 | O15144 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.917242916 | . |
| Actin-related protein 2/3 complex subunit 4 | P59998 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.362091546 | . |
| Actin-related protein 3 | P61158 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.89707711 | . |
| Acyl-CoA dehydrogenase family member 10 | Q6JQN1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.755848928 | . |
| Acyl-CoA-binding protein | P07108 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.535784337 | . |
| Acyl-protein thioesterase 2 | O95372 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.305210854 | . |
| Acyl-protein thioesterase ABHD10 | Q9NUJ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.168009491 | . |
| Adenine phosphoribosyltransferase | P07741 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.926833626 | . |
| Adenosylhomocysteinase | P23526 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.926031342 | . |
| Adenylate kinase isoenzyme 1 | P00568 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.859230128 | . |
| Adenylosuccinate lyase | P30566 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.129891873 | . |
| Adenylosuccinate synthetase isozyme 2 | P30520 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.63473403 | . |
| Adenylyl cyclase-associated protein 1 | Q01518 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.100117773 | . |
| Adipocyte plasma membrane-associated protein | Q9HDC9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.839519178 | . |
| ADP-ribose glycohydrolase MACROD1 | Q9BQ69 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.486051121 | . |
| ADP-ribosylation factor 3 | P61204 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.655738816 | . |
| ADP-ribosylation factor 4 | P18085 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.298514723 | . |
| ADP-ribosylation factor-like protein 1 | P40616 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.479048175 | . |
| ADP-sugar pyrophosphatase | Q9UKK9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.208675106 | . |
| ADP/ATP translocase 2 | P05141 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.044736292 | . |
| ADP/ATP translocase 3 | P12236 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.996164594 | . |
| Aflatoxin B1 aldehyde reductase member 2 | O43488 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.144573509 | . |
| Aging-associated gene 10 protein | Q9Y6H1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.534970019 | . |
| AH receptor-interacting protein | O00170 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.512808062 | . |
| AHA1 | O95433 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.013519132 | . |
| Alanine--tRNA ligase | P49588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.179100806 | . |
| Albumin | P02768 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.746220838 | . |
| Alcohol dehydrogenase class-3 | P11766 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.227189954 | . |
| Aldehyde dehydrogenase 1A1 | P00352 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.150277103 | . |
| Aldehyde dehydrogenase family 1 member A3 | P47895 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.537399844 | . |
| Aldehyde dehydrogenase family 3 member A2 | P51648 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.638743914 | . |
| Aldo-keto reductase family 1 member A1 | P14550 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.443828303 | . |
| Aldo-keto reductase family 1 member B1 | P15121 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.873965126 | . |
| Alpha-2-HS-glycoprotein | P02765 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.987449232 | . |
| Alpha-actinin-1 | P12814 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.706851403 | . |
| Alpha-actinin-3 | Q08043 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.582139844 | . |
| Alpha-actinin-4 | O43707 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.806428951 | . |
| Alpha-aminoadipic semialdehyde dehydrogenase | P49419 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.195200598 | . |
| Alpha-aminoadipic semialdehyde synthase | Q9UDR5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.606254035 | . |
| Alpha-centractin | P61163 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.022443083 | . |
| Alpha-enolase | P06733 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.710195644 | . |
| Alpha-NAC | E9PAV3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.767286207 | . |
| Alpha-soluble NSF attachment protein | P54920 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.887949743 | . |
| Amplified in liver cancer protein 1 | Q86WJ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.099077563 | . |
| Angiotensin-converting enzyme 2 | Q9BYF1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.97580375 | . |
| Annexin A1 | P04083 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.150379061 | . |
| Annexin A11 | P50995 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.486152029 | . |
| Annexin A2 | P07355 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.168565257 | . |
| Annexin A3 | P12429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.455302471 | . |
| Annexin A4 | P09525 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.037057596 | . |
| Annexin A5 | P08758 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.813237289 | . |
| Annexin A6 | P08133 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.110305579 | . |
| Annexin A7 | P20073 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.253064516 | . |
| Anterior gradient protein 2 homolog | O95994 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.478808567 | . |
| Antiviral innate immune response receptor RIG-I | O95786 | Homo sapiens | Pro Info | . | B95a Cells (Marmoset lymphoblastoid cell line) | . | . | . | . | . |
| Antiviral innate immune response receptor RIG-I | O95786 | Homo sapiens | Pro Info | . | B95a Cells (Marmoset lymphoblastoid cell line) | . | . | . | . | . |
| AP-1 complex subunit gamma-1 | O43747 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.783542544 | . |
| AP-1 complex subunit mu-1 | Q9BXS5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.257917226 | . |
| AP-3 complex subunit mu-1 | Q9Y2T2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.544069851 | . |
| APC-binding protein EB1 | Q15691 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.411299219 | . |
| APOBEC1 complementation factor | Q9NQ94 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.241244051 | . |
| Apolipoprotein E | P02649 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.589414898 | . |
| Apoptosis inhibitor 5 | Q9BZZ5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.96614159 | . |
| Apoptotic chromatin condensation inducer in the nucleus | Q9UKV3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.759348808 | . |
| apurinic or apyrimidinic site | P27695 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.620658398 | . |
| Arginase-1 | P05089 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.594211073 | . |
| Arginine--tRNA ligase | P54136 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.051805357 | . |
| Argininosuccinate synthase | P00966 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.256363779 | . |
| ASC-1 complex subunit p100 | Q9H1I8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.099938837 | . |
| ASF/SF2-associated protein p32 | Q07021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.421355635 | . |
| Asparagine--tRNA ligase | O43776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.906410776 | . |
| Aspartate aminotransferase | P17174 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.055204092 | . |
| Aspartate--tRNA ligase | P14868 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.429414118 | . |
| Ataxin-10 | Q9UBB4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.646351832 | . |
| Ataxin-2 | Q99700 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.895222794 | . |
| Ataxin-2-like protein | Q8WWM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.525073871 | . |
| ATP synthase subunit alpha | P25705 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.333882507 | . |
| ATP synthase subunit b | P24539 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.625134094 | . |
| ATP synthase subunit d | O75947 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.345126308 | . |
| ATP synthase subunit gamma | P36542 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.708323777 | . |
| ATP-binding cassette sub-family E member 1 | P61221 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.892271565 | . |
| ATP-binding cassette sub-family F member 1 | Q8NE71 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.266621492 | . |
| ATP-citrate synthase | P53396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.388109612 | . |
| ATP-dependent 6-phosphofructokinase | Q01813 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.086230871 | . |
| ATP-dependent DNA/RNA helicase DHX36 | Q9H2U1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.282130413 | . |
| ATP-dependent RNA helicase A | Q08211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.986782313 | . |
| ATP-dependent RNA helicase DDX1 | Q92499 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.428604324 | . |
| ATP-dependent RNA helicase DDX18 | Q9NVP1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.203140707 | . |
| ATP-dependent RNA helicase DDX19A | Q9NUU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.583087993 | . |
| ATP-dependent RNA helicase DDX39A | O00148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.163949336 | . |
| ATP-dependent RNA helicase DDX3X | O00571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.352544229 | . |
| ATP-dependent RNA helicase DDX3Y | O15523 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.147231678 | . |
| ATP-dependent RNA helicase DDX42 | Q86XP3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.82323175 | . |
| ATP-dependent RNA helicase DDX50 | Q9BQ39 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.151924699 | . |
| ATP-dependent RNA helicase DHX15 | O43143 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.496623708 | . |
| ATP-dependent RNA helicase DHX30 | Q7L2E3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.759531139 | . |
| ATP-dependent RNA helicase DHX38 | Q92620 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.906184512 | . |
| ATP12 homolog | Q8N5M1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.013533499 | . |
| Atypical kinase COQ8A | Q8NI60 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.080464766 | . |
| B-cell receptor-associated protein 31 | P51572 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.796970939 | . |
| B19 | P57058 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.796356588 | . |
| BAG family molecular chaperone regulator 4 | O95429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.745276505 | . |
| Basal cell adhesion molecule | P50895 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.129981251 | . |
| Bcl-2-associated transcription factor 1 | Q9NYF8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.685598356 | . |
| Beige-like protein | P50851 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.422552766 | . |
| Beta-enolase | P13929 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.432278037 | . |
| Beta-ketoacyl-ACP synthase | Q9NWU1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.225436256 | . |
| Bifunctional coenzyme A synthase | Q13057 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.602650281 | . |
| Bifunctional glutamate/proline--tRNA ligase | P07814 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.054589699 | . |
| Bifunctional purine biosynthesis protein ATIC | P31939 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.723591941 | . |
| Biliverdin reductase A | P53004 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.642353512 | . |
| Bleomycin hydrolase | Q13867 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.060821454 | . |
| BOS complex subunit NOMO1 | Q15155 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.388868808 | . |
| Branched-chain-amino-acid aminotransferase | O15382 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.062741087 | . |
| BRCA2 and CDKN1A-interacting protein | Q9P287 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.114538569 | . |
| BRR2 homolog | O75643 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.814762582 | . |
| Butyrate-induced protein 1 | Q9P035 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.56461426 | . |
| C-1-tetrahydrofolate synthase | P11586 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.613301267 | . |
| C-terminal-binding protein 1 | Q13363 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.612788093 | . |
| CAD protein | P27708 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.382577142 | . |
| Calcineurin-binding protein cabin-1 | Q9Y6J0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.584108739 | . |
| Calcium load-activated calcium channel | Q9UM00 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.523603697 | . |
| Calcyclin-binding protein | Q9HB71 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.288221319 | . |
| Calmodulin-3 | P0DP25 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.001175328 | . |
| Calmodulin-like protein 3 | P27482 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.459308575 | . |
| Calnexin | P27824 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.24537131 | . |
| Calpain small subunit 1 | P04632 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.552495369 | . |
| Calpain-1 catalytic subunit | P07384 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.600457293 | . |
| Calpain-2 catalytic subunit | P17655 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.795527989 | . |
| Calponin-2 | Q99439 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.309504193 | . |
| Calponin-3 | Q15417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.415492289 | . |
| Calumenin | O43852 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.563643447 | . |
| CaMK-II subunit delta | Q13557 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.131430088 | . |
| cAMP-dependent protein kinase type II-alpha regulatory subunit | P13861 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.870159201 | . |
| cAMP-specific 3',5'-cyclic phosphodiesterase 4A | P27815 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.547606841 | . |
| Caprin-1 | Q14444 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.031294574 | . |
| Carbonic anhydrase 3 | P07451 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.014948709 | . |
| Carbonyl reductase [NADPH] 1 | P16152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.84702485 | . |
| Carboxypeptidase A4 | Q9UI42 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.776203576 | . |
| Carnitine O-acetyltransferase | P43155 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.926390061 | . |
| Casein kinase II subunit alpha | P68400 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.599815531 | . |
| Caspase-14 | P31944 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.305464205 | . |
| Catalase | P04040 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.504320463 | . |
| Cathepsin D | P07339 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.767884719 | . |
| CCR4-NOT transcription complex subunit 1 | A5YKK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.083751496 | . |
| CCR4-NOT transcription complex subunit 11 | Q9UKZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.012941872 | . |
| CCR4-NOT transcription complex subunit 2 | Q9NZN8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.52634831 | . |
| Cdc42-interacting protein 4 | Q15642 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.478627445 | . |
| CDK5 activator-binding protein C42 | Q96SZ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.152160581 | . |
| CDKN2A-interacting protein | Q9NXV6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.749945213 | . |
| Cell cycle and apoptosis regulator protein 2 | Q8N163 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.545061101 | . |
| Cell division control protein 42 homolog | P60953 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.388707323 | . |
| Cell proliferation-inducing gene 54 protein | Q29RF7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.632543903 | . |
| Centrosomal protein of 290 kDa | O15078 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.413477762 | . |
| Centrosomal protein of 41 kDa | Q9BYV8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.508424554 | . |
| Charged multivesicular body protein 2a | O43633 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.237573993 | . |
| Charged multivesicular body protein 4a | Q9BY43 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.722033237 | . |
| Charged multivesicular body protein 4b | Q9H444 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.15808277 | . |
| Chloride intracellular channel protein 1 | O00299 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.754483499 | . |
| Chloride intracellular channel protein 4 | Q9Y696 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.90604182 | . |
| Cholestenol Delta-isomerase | Q15125 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.113875081 | . |
| CHORD domain-containing protein 1 | Q9UHD1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.439141714 | . |
| CHRAC subunit ACF1 | Q9NRL2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.908569203 | . |
| Chromatin target of PRMT1 protein | Q9Y3Y2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.659395278 | . |
| Chromodomain-helicase-DNA-binding protein 2 | O14647 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.905006843 | . |
| Chymotrypsin-like protease CTRL-1 | P40313 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.50E-14 | . |
| Clathrin heavy chain 1 | Q00610 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.238789584 | . |
| CLE7 homolog | Q9Y224 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.637355124 | . |
| Cleavage and polyadenylation specificity factor subunit 1 | Q10570 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.034672253 | . |
| Cleavage stimulation factor subunit 1 | Q05048 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.017256493 | . |
| Cleavage stimulation factor subunit 2 | P33240 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.360592651 | . |
| Cleavage stimulation factor subunit 3 | Q12996 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.156756565 | . |
| Clustered mitochondria protein homolog | O75153 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.669685864 | . |
| Coatomer subunit alpha | P53621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.5433757 | . |
| Coatomer subunit beta' | P35606 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.650441683 | . |
| Coatomer subunit delta | P48444 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.591525697 | . |
| Coatomer subunit epsilon | O14579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.499517396 | . |
| Coatomer subunit gamma-1 | Q9Y678 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.1825424 | . |
| Coatomer subunit zeta-1 | P61923 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.404115924 | . |
| Cofilin-1 | P23528 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.922790341 | . |
| Coiled-coil domain-containing protein 44 | Q9BSH4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.176899279 | . |
| Cold shock domain-containing protein E1 | O75534 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.217997837 | . |
| Cold-inducible RNA-binding protein | Q14011 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.151804111 | . |
| Complex I subunit B13 | Q16718 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.215290557 | . |
| Complex I-23kD | O00217 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.295469724 | . |
| Complex I-B14 | P56556 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.3344382 | . |
| Condensin complex subunit 1 | Q15021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.845953958 | . |
| Copine-1 | Q99829 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.936177607 | . |
| Copine-3 | O75131 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.058227678 | . |
| Copper chaperone for superoxide dismutase | O14618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.874150833 | . |
| Corneodesmosin | Q15517 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.060533636 | . |
| Coronin-1B | Q9BR76 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.789846013 | . |
| Coronin-1C | Q9ULV4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.159805948 | . |
| Corrinoid adenosyltransferase MMAB | Q96EY8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.962051147 | . |
| CPSF 100 kDa subunit | Q9P2I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.661065002 | . |
| CPSF 25 kDa subunit | O43809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.58483908 | . |
| CPSF 30 kDa subunit | O95639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.886052406 | . |
| CPSF 59 kDa subunit | Q8N684 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.399612768 | . |
| CPSF 68 kDa subunit | Q16630 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.984567056 | . |
| CPSF 73 kDa subunit | Q9UKF6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.767391629 | . |
| Creatine kinase B-type | P12277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.692456203 | . |
| Creatine kinase M-type | P06732 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.794531154 | . |
| Creatine kinase S-type | P17540 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.094825671 | . |
| Crk-like protein | P46109 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.398537558 | . |
| Crooked neck-like protein 1 | Q9BZJ0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.597477373 | . |
| CTP synthase 1 | P17812 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.260989739 | . |
| CUGBP Elav-like family member 1 | Q92879 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.702384521 | . |
| Cullin-3 | Q13618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.071641201 | . |
| Cullin-associated NEDD8-dissociated protein 1 | Q86VP6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.86511591 | . |
| Cyclin-dependent kinase 1 | P06493 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.282628931 | . |
| Cyclin-dependent kinase 11A | Q9UQ88 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.739021722 | . |
| Cyclin-dependent kinase 18 | Q07002 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.294072843 | . |
| Cyclin-dependent kinase 2 | P24941 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.907604894 | . |
| Cyclin-dependent kinase 6 | Q00534 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.33699096 | . |
| Cystatin-A | P01040 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.811407034 | . |
| Cysteine and glycine-rich protein 1 | P21291 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.00630221 | . |
| Cysteine and glycine-rich protein 2 | Q16527 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.388543904 | . |
| Cysteine-rich protein 2 | P52943 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.064027363 | . |
| Cytochrome b-c1 complex subunit Rieske | P47985 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.035318243 | . |
| Cytochrome b5 type B | O43169 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.976734679 | . |
| Cytochrome c oxidase subunit 5A | P20674 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.835270614 | . |
| Cytoplasmic dynein 1 heavy chain 1 | Q14204 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.175935768 | . |
| Cytoskeleton-associated protein 4 | Q07065 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.72138533 | . |
| Cytoskeleton-associated protein 5 | Q14008 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.587727997 | . |
| Cytosol aminopeptidase | P28838 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.785280858 | . |
| Cytosolic 5'-nucleotidase 3 | Q9H0P0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.763565563 | . |
| Cytosolic non-specific dipeptidase | Q96KP4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.561833686 | . |
| D-3-phosphoglycerate dehydrogenase | O43175 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.320674985 | . |
| D-aminoacyl-tRNA deacylase 1 | Q8TEA8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.426403821 | . |
| D-aspartate | P22061 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.860834357 | . |
| D-fructose-6-phosphate amidotransferase 1 | Q06210 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.057810836 | . |
| Damage-control phosphatase ARMT1 | Q9H993 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.880367777 | . |
| DAZ-associated protein 1 | Q96EP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.127951088 | . |
| DBIRD complex subunit ZNF326 | Q5BKZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.183171216 | . |
| DDOST 48 kDa subunit | P39656 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -15.80299701 | . |
| DDRGK domain-containing protein 1 | Q96HY6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.620948525 | . |
| Decreased expression in renal and prostate cancer protein | P0CG12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.033186371 | . |
| Dehydrogenase/reductase SDR family member 6 | Q9BUT1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.842395339 | . |
| Delta(24)-sterol reductase | Q15392 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.729774136 | . |
| Deoxyribose-phosphate aldolase | Q9Y315 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.190852637 | . |
| Derlin-2 | Q9GZP9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.364693053 | . |
| Dermcidin | P81605 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.112941756 | . |
| Desmocollin-1 | Q08554 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.250563565 | . |
| Desmocollin-3 | Q14574 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.039067586 | . |
| Desmoglein-1 | Q02413 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.088148852 | . |
| Desmoyokin | Q09666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.399255348 | . |
| Destrin | P60981 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.863382467 | . |
| Developmentally-regulated GTP-binding protein 1 | Q9Y295 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.718777263 | . |
| Diablo IAP-binding mitochondrial protein | Q9NR28 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.057751141 | . |
| Dihydropteridine reductase | P09417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.893930377 | . |
| Dihydropyrimidinase-related protein 2 | Q16555 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.147258767 | . |
| Dihydropyrimidinase-related protein 3 | Q14195 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.617024536 | . |
| Dihydropyrimidine dehydrogenase [NADP(+)] | Q12882 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.878548674 | . |
| Dipeptidyl peptidase 4 | P27487 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.604329636 | . |
| Diphosphomevalonate decarboxylase | P53602 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.186994166 | . |
| DNA (cytosine-5)-methyltransferase 1 | P26358 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.157292805 | . |
| DNA dC->dU-editing enzyme APOBEC-3B | Q9UH17 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.299331282 | . |
| DNA dC->dU-editing enzyme APOBEC-3F | Q8IUX4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.559270536 | . |
| DNA dC->dU-editing enzyme APOBEC-3G | Q9HC16 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.492383414 | . |
| DNA fragmentation factor subunit alpha | O00273 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.745786201 | . |
| DNA ligase 3 | P49916 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.709774594 | . |
| DNA mismatch repair protein Msh6 | P52701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.740377956 | . |
| DNA replication licensing factor MCM2 | P49736 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.975556528 | . |
| DNA replication licensing factor MCM3 | P25205 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.51296884 | . |
| DNA replication licensing factor MCM4 | P33991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.069039141 | . |
| DNA replication licensing factor MCM5 | P33992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.480986871 | . |
| DNA replication licensing factor MCM6 | Q14566 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.251461857 | . |
| DNA replication licensing factor MCM7 | P33993 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.033273672 | . |
| DNA topoisomerase 1 | P11387 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.520190652 | . |
| DNA-dependent protein kinase catalytic subunit | P78527 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.403907506 | . |
| DNA-directed RNA polymerase II subunit RPB2 | P30876 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.864512639 | . |
| DnaJ homolog subfamily A member 1 | P31689 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.474667341 | . |
| DnaJ homolog subfamily A member 2 | O60884 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.452216074 | . |
| DnaJ homolog subfamily B member 1 | P25685 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.495102716 | . |
| DnaJ homolog subfamily C member 7 | Q99615 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.123782222 | . |
| DnaJ homolog subfamily C member 8 | O75937 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.370975464 | . |
| DnaJ homolog subfamily C member 9 | Q8WXX5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.78730594 | . |
| DNL-type zinc finger protein | Q5SXM8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.02355277 | . |
| Dopamine-responsive gene 1 protein | Q9NP79 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.803331493 | . |
| Double-stranded RNA-binding protein Staufen homolog 1 | O95793 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.813730948 | . |
| Double-stranded RNA-binding protein Staufen homolog 2 | Q9NUL3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.23584561 | . |
| Drebrin | Q16643 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.206381936 | . |
| Drebrin-like protein | Q9UJU6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.038783373 | . |
| Dual specificity protein phosphatase 3 | P51452 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.609090819 | . |
| dUTPase | P33316 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.41111316 | . |
| Dynactin subunit 2 | Q13561 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.15568896 | . |
| Dynamin-2 | P50570 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.515666479 | . |
| Dynein light chain 1 | P63167 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.739803848 | . |
| Dystrophin | P11532 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.288441296 | . |
| E1B-55 kDa-associated protein 5 | Q9BUJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.824250495 | . |
| E2A-PBX1-associated protein | Q7Z6G8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.469944747 | . |
| E3 ubiquitin-protein ligase ARIH2 | O95376 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.75868511 | . |
| E3 ubiquitin-protein ligase HECTD1 | Q9ULT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.197252209 | . |
| E3 ubiquitin-protein ligase RNF213 | Q63HN8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.65887504 | . |
| E3 ubiquitin-protein ligase TRIM56 | Q9BRZ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.830879749 | . |
| E3 ubiquitin-protein ligase TRIM71 | Q2Q1W2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.724024026 | . |
| E3 ubiquitin-protein ligase UBR4 | Q5T4S7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.765779639 | . |
| E3 ubiquitin-protein ligase UHRF1 | Q96T88 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.207463621 | . |
| E3 ubiquitin/ISG15 ligase TRIM25 | Q14258 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.028159112 | . |
| EB1 protein family member 3 | Q9UPY8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.494982038 | . |
| EF-hand domain-containing protein D2 | Q96C19 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.886527501 | . |
| eIF-1A X isoform | P47813 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.502573153 | . |
| eIF-2-alpha | P05198 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.95381617 | . |
| eIF-2-alpha kinase activator GCN1 | Q92616 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.321826926 | . |
| eIF-4-gamma 1 | Q04637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.562920089 | . |
| eIF-4-gamma 3 | O43432 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.078898643 | . |
| eIF3a | Q14152 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.502601526 | . |
| eIF3b | P55884 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.00912711 | . |
| eIF3c | Q99613 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.113268638 | . |
| eIF3d | O15371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.138501141 | . |
| eIF3e | P60228 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.57423927 | . |
| eIF3f | O00303 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.014828599 | . |
| eIF3g | O75821 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.68840219 | . |
| eIF3h | O15372 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.960336355 | . |
| eIF3i | Q13347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.648675104 | . |
| eIF3j | O75822 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.720019455 | . |
| eIF3l | Q9Y262 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.19947917 | . |
| eIF3m | Q7L2H7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.986013742 | . |
| eIF5-mimic protein 1 | Q9Y6E2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.195034171 | . |
| eIF5-mimic protein 2 | Q7L1Q6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.701903657 | . |
| ELAV-like protein 1 | Q15717 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.934006802 | . |
| ELMO domain-containing protein 2 | Q8IZ81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.137268953 | . |
| Elongation factor 1-alpha 1 | P68104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.762154083 | . |
| Elongation factor 1-alpha 2 | Q05639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.784050924 | . |
| Elongation factor 1-beta | P24534 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.755485071 | . |
| Elongation factor 1-delta | P29692 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.54553228 | . |
| Elongation factor 1-gamma | P26641 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.903937728 | . |
| Elongation factor 2 | P13639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.84249427 | . |
| Elongation factor p18 | O43324 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.554712234 | . |
| Elongator complex protein 1 | O95163 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.800513344 | . |
| Emerin | P50402 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.136618383 | . |
| Endoplasmic reticulum chaperone BiP | P11021 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.363153451 | . |
| Endoplasmic reticulum resident protein 29 | P30040 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.219359808 | . |
| Endoplasmic reticulum resident protein 44 | Q9BS26 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.258791314 | . |
| Endoplasmin | P14625 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.798154919 | . |
| Endothelial differentiation-related factor 1 | O60869 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.599033698 | . |
| Enhancer of mRNA-decapping protein 3 | Q96F86 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.765961417 | . |
| Enhancer of mRNA-decapping protein 4 | Q6P2E9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.445707905 | . |
| Enhancer of rudimentary homolog | P84090 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.834047018 | . |
| Enoyl-CoA hydratase domain-containing protein 3 | Q96DC8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.359290238 | . |
| Epiplakin | P58107 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.838616334 | . |
| eRF3a | P15170 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.316081951 | . |
| Ester hydrolase C11orf54 | Q9H0W9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.76226551 | . |
| Ethanolamine-phosphate cytidylyltransferase | Q99447 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.841063807 | . |
| Eukaryotic initiation factor 4A-I | P60842 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.076112274 | . |
| Eukaryotic initiation factor 4A-II | Q14240 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.167601432 | . |
| Eukaryotic initiation factor 4A-III | P38919 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.845470088 | . |
| Eukaryotic release factor 1 | P62495 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.640582937 | . |
| Eukaryotic translation initiation factor 2 subunit 3 | P41091 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.6114274 | . |
| Eukaryotic translation initiation factor 2A | Q9BY44 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.498751214 | . |
| Eukaryotic translation initiation factor 4B | P23588 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.868394981 | . |
| Eukaryotic translation initiation factor 4E | P06730 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.629319002 | . |
| Eukaryotic translation initiation factor 4H | Q15056 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.262885368 | . |
| Eukaryotic translation initiation factor 5 | P55010 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.54861506 | . |
| Eukaryotic translation initiation factor 5A-1 | P63241 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.976206456 | . |
| Eukaryotic translation initiation factor 5B | O60841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.340612765 | . |
| Eukaryotic translation initiation factor 6 | P56537 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -16.12285799 | . |
| Exosome complex component MTR3 | Q5RKV6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.229053313 | . |
| Exosome complex component RRP42 | Q15024 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.344451188 | . |
| Exosome complex exonuclease RRP44 | Q9Y2L1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.853484714 | . |
| Exosome RNA helicase MTR4 | P42285 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.394930655 | . |
| Exportin-1 | O14980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.77347916 | . |
| Exportin-2 | P55060 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.04326532 | . |
| Extended synaptotagmin-1 | Q9BSJ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.978436978 | . |
| Ezrin | P15311 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.844188225 | . |
| F-actin-capping protein subunit alpha-1 | P52907 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.221948013 | . |
| F-actin-capping protein subunit alpha-2 | P47755 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.866216069 | . |
| F-actin-capping protein subunit beta | P47756 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.962301611 | . |
| FACT complex subunit SPT16 | Q9Y5B9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.346377497 | . |
| FACT complex subunit SSRP1 | Q08945 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.676605099 | . |
| Far upstream element-binding protein 1 | Q96AE4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.545868756 | . |
| Far upstream element-binding protein 2 | Q92945 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.579381738 | . |
| Far upstream element-binding protein 3 | Q96I24 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.073108189 | . |
| Farnesyl pyrophosphate synthase | P14324 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.373150256 | . |
| Fascin | Q16658 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.274467464 | . |
| Fatty acid synthase | P49327 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.225414654 | . |
| Fatty acid-binding protein | P07148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.245471749 | . |
| Fatty acid-binding protein 5 | Q01469 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.457545257 | . |
| Felix-ina | Q7Z2K6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.0897937 | . |
| Fibrinogen gamma chain | P02679 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.521403066 | . |
| Filamin-A | P21333 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.847523862 | . |
| Filamin-B | O75369 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.965861971 | . |
| Filamin-C | Q14315 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.468622115 | . |
| Flap endonuclease 1 | P39748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.335106204 | . |
| Flavin reductase (NADPH) | P30043 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.123169867 | . |
| FMR1-interacting protein NUFIP2 | Q7Z417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.029597698 | . |
| Fragile X messenger ribonucleoprotein 1 | Q06787 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.014180447 | . |
| Frataxin | Q16595 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.775377108 | . |
| Fructose-bisphosphate aldolase A | P04075 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.520121093 | . |
| Fructose-bisphosphate aldolase C | P09972 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.116408102 | . |
| Fumarylacetoacetate hydrolase domain-containing protein 2A | Q96GK7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.847038719 | . |
| G protein subunit beta-2 | P62879 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.761331847 | . |
| G-patch domain-containing protein 5 | Q92917 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.246973936 | . |
| G-rich sequence factor 1 | Q12849 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.756650384 | . |
| Galactokinase | P51570 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.405905571 | . |
| Galectin-1 | P09382 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.238212632 | . |
| Galectin-3 | P17931 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.213832949 | . |
| Galectin-7 | P47929 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.590336898 | . |
| Gamma-soluble NSF attachment protein | Q99747 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.443689753 | . |
| GAP-associated tyrosine phosphoprotein p62 | Q07666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.199840411 | . |
| Gasdermin-A | Q96QA5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.822677142 | . |
| Gastric cancer antigen Ga19 | Q9BXJ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.24159801 | . |
| Gem-associated protein 5 | Q8TEQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.051548608 | . |
| General transcription factor II-I | P78347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.812418347 | . |
| General vesicular transport factor p115 | O60763 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.551000021 | . |
| Glu-AdT subunit A | Q9H0R6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.223064937 | . |
| Glucose-6-phosphate 1-dehydrogenase | P11413 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.872271947 | . |
| Glucose-6-phosphate isomerase | P06744 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.049810959 | . |
| Glucosidase 2 subunit beta | P14314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.785393261 | . |
| Glutamate dehydrogenase 2 | P49448 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.060579787 | . |
| Glutamate--cysteine ligase regulatory subunit | P48507 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.721874111 | . |
| Glutamine amidotransferase-like class 1 domain-containing protein 3 | P0DPI2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.236839245 | . |
| Glutamine synthetase | P15104 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.843052669 | . |
| Glutamine--tRNA ligase | P47897 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.997369833 | . |
| Glutamyl-tRNA(Gln) amidotransferase subunit B | O75879 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.827426572 | . |
| Glutaredoxin-3 | O76003 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.656064536 | . |
| Glutaredoxin-related protein 5 | Q86SX6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.475156003 | . |
| Glutathione reductase | P00390 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.636057109 | . |
| Glutathione S-transferase LANCL1 | O43813 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.498307826 | . |
| Glutathione S-transferase omega-1 | P78417 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.903145119 | . |
| Glutathione S-transferase P | P09211 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.383166139 | . |
| Glutathione synthetase | P48637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.954938085 | . |
| Glycinamide ribonucleotide synthetase | P22102 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.889942567 | . |
| Glycine--tRNA ligase | P41250 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.943656812 | . |
| Glycogen debranching enzyme | P35573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.655847216 | . |
| Glycogen phosphorylase | P06737 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.589172273 | . |
| Glycogen phosphorylase | P11217 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.864442642 | . |
| Glycogen synthase kinase-3 beta | P49841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.329406202 | . |
| Glycylpeptide N-tetradecanoyltransferase 1 | P30419 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.668242821 | . |
| GMP synthase [glutamine-hydrolyzing] | P49915 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.951582646 | . |
| Golgi phosphoprotein 3 | Q9H4A6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.820575346 | . |
| Golgi reassembly-stacking protein 2 | Q9H8Y8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.618356856 | . |
| Golgi resident protein GCP60 | Q9H3P7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.774750533 | . |
| GPD-C | P21695 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.615265908 | . |
| GRB10-interacting GYF protein 2 | Q6Y7W6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.595627159 | . |
| Growth factor receptor-bound protein 7 | Q14451 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.437120755 | . |
| GrpE protein homolog 1 | Q9HAV7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.435611019 | . |
| GTP-binding nuclear protein Ran | P62826 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.269221097 | . |
| GTP-binding protein SAR1a | Q9NR31 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.054475535 | . |
| GTP:AMP phosphotransferase AK3 | Q9UIJ7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.318470593 | . |
| GTPase Era | O75616 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.03185937 | . |
| Guanidinoacetate N-methyltransferase | Q14353 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.337662143 | . |
| Guanylate-binding protein 1 | P32455 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.501157794 | . |
| Haloacid dehalogenase-like hydrolase domain-containing protein 3 | Q9BSH5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.683386873 | . |
| HBS1-like protein | Q9Y450 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.30456182 | . |
| HCDH | Q16836 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.777756769 | . |
| Heat shock 70 kDa protein 1B | P0DMV9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.678310859 | . |
| Heat shock 70 kDa protein 4 | P34932 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.93434777 | . |
| Heat shock cognate 71 kDa protein | P11142 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.396464715 | . |
| Heat shock protein 105 kDa | Q92598 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.584260995 | . |
| Heat shock protein beta-1 | P04792 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.660920558 | . |
| Heat shock protein HSP 90-alpha | P07900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.563661416 | . |
| Heat shock protein HSP 90-beta | P08238 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.599328529 | . |
| Heat shock-related 70 kDa protein 2 | P54652 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.922417334 | . |
| Helicase MOV-10 | Q9HCE1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.346603644 | . |
| Hemoglobin subunit alpha | P69905 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.774197847 | . |
| Hemoglobin subunit beta | P68871 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.762379622 | . |
| Hepatoma-derived growth factor | P51858 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.124624442 | . |
| Heterogeneous nuclear ribonucleoprotein A/B | Q99729 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.158581021 | . |
| Heterogeneous nuclear ribonucleoprotein A0 | Q13151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.014170165 | . |
| Heterogeneous nuclear ribonucleoprotein A1 | P09651 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.687980027 | . |
| Heterogeneous nuclear ribonucleoprotein A3 | P51991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.089958216 | . |
| Heterogeneous nuclear ribonucleoprotein D-like | O14979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.23570821 | . |
| Heterogeneous nuclear ribonucleoprotein D0 | Q14103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.366745642 | . |
| Heterogeneous nuclear ribonucleoprotein F | P52597 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.47380857 | . |
| Heterogeneous nuclear ribonucleoprotein H | P31943 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.131920995 | . |
| Heterogeneous nuclear ribonucleoprotein H2 | P55795 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.574964323 | . |
| Heterogeneous nuclear ribonucleoprotein H3 | P31942 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.211454431 | . |
| Heterogeneous nuclear ribonucleoprotein K | P61978 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.26969719 | . |
| Heterogeneous nuclear ribonucleoprotein L | P14866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.13768243 | . |
| Heterogeneous nuclear ribonucleoprotein L-like | Q8WVV9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.145368753 | . |
| Heterogeneous nuclear ribonucleoprotein M | P52272 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.03070662 | . |
| Heterogeneous nuclear ribonucleoprotein Q | O60506 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.952545383 | . |
| Heterogeneous nuclear ribonucleoprotein R | O43390 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.517918852 | . |
| Heterogeneous nuclear ribonucleoprotein U | Q00839 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.562366516 | . |
| Heterogeneous nuclear ribonucleoproteins A2/B1 | P22626 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.565012912 | . |
| Heterogeneous nuclear ribonucleoproteins C1/C2 | P07910 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.311479366 | . |
| Hexokinase HKDC1 | Q2TB90 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.579874612 | . |
| High mobility group protein B1 | P09429 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.434698552 | . |
| High mobility group protein B2 | P26583 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.602843998 | . |
| Histidine--tRNA ligase | P49590 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.74617445 | . |
| Histone acetyltransferase 1 | O14929 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.382675658 | . |
| Histone deacetylase 1 | Q13547 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.675322766 | . |
| Histone deacetylase complex subunit SAP18 | O00422 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.318934568 | . |
| Histone H1.2 | P16403 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.125188924 | . |
| Histone H1.3 | P16402 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.407693522 | . |
| Histone H1.4 | P10412 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.557161283 | . |
| Histone H3.2 | Q71DI3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.545171545 | . |
| Histone-binding protein RBBP4 | Q09028 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.395527588 | . |
| Histone-binding protein RBBP7 | Q16576 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.230760185 | . |
| HMG-CoA synthase | P54868 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.168513024 | . |
| Homogentisate 1,2-dioxygenase | Q93099 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.252095357 | . |
| Hsc70-interacting protein | P50502 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.661453553 | . |
| hSIRT3 | Q9NTG7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.651193018 | . |
| Hsp70-binding protein 1 | Q9NZL4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.705996646 | . |
| Hsp90 co-chaperone Cdc37 | Q16543 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.548037711 | . |
| hTom22 | Q9NS69 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.180841082 | . |
| Hydroxyacylglutathione hydrolase | Q16775 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.000472605 | . |
| Hydroxymethylglutaryl-CoA synthase | Q01581 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.036153663 | . |
| IF-2(Mt) | P46199 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.248655402 | . |
| IGF2 mRNA-binding protein 1 | Q9NZI8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.82334739 | . |
| IGF2 mRNA-binding protein 2 | Q9Y6M1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.915308502 | . |
| IGF2 mRNA-binding protein 3 | O00425 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.138190719 | . |
| Immunoglobulin-binding protein 1 | P78318 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.859052876 | . |
| Importin subunit alpha-1 | P52292 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.326535491 | . |
| Importin subunit alpha-3 | O00629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.044931996 | . |
| Importin subunit beta-1 | Q14974 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.614360462 | . |
| Importin-5 | O00410 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.85461999 | . |
| Importin-7 | O95373 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.381624496 | . |
| Importin-9 | Q96P70 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.27784416 | . |
| Inorganic pyrophosphatase | Q15181 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.69264612 | . |
| Inosine-5'-monophosphate dehydrogenase 2 | P12268 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.664802463 | . |
| Inositol monophosphatase 2 | O14732 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.437904054 | . |
| Interferon-inducible protein 4 | P55265 | Homo sapiens | Pro Info | . | B95a Cells (Marmoset lymphoblastoid cell line) | . | . | . | . | . |
| Interferon-inducible protein 4 | P55265 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.042205861 | . |
| Interleukin enhancer-binding factor 2 | Q12905 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.048536975 | . |
| Interleukin enhancer-binding factor 3 | Q12906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.993191769 | . |
| Interleukin-36 gamma | Q9NZH8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.56237159 | . |
| Inverted formin-2 | Q27J81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.999899314 | . |
| Iron-sulfur cluster assembly 1 homolog | Q9BUE6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.385184219 | . |
| Isochorismatase domain-containing protein 1 | Q96CN7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.93660067 | . |
| Isochorismatase domain-containing protein 2 | Q96AB3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.140281277 | . |
| Isocitrate dehydrogenase [NADP] cytoplasmic | O75874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.714627877 | . |
| Isocitrate dehydrogenase [NAD] subunit beta | O43837 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.041538293 | . |
| Isocitrate dehydrogenase [NAD] subunit gamma | P51553 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.53541852 | . |
| Isoleucine--tRNA ligase | P41252 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.667367509 | . |
| Isopentenyl-diphosphate Delta-isomerase 1 | Q13907 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.238161825 | . |
| IST1 homolog | P53990 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.013962667 | . |
| Jupiter microtubule associated homolog 2 | Q9H910 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.454627216 | . |
| Kelch-like protein 17 | Q6TDP4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.177394004 | . |
| Kelch-like protein 41 | O60662 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.619705161 | . |
| Keratin | P05787 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.159962086 | . |
| Keratin | P05783 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.130849257 | . |
| Keratin | P19013 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.521785125 | . |
| Keratin | Q7Z3Z0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.36324111 | . |
| Keratin | P19012 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.684157853 | . |
| Keratin | Q8N1N4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.408772301 | . |
| Keratin | Q01546 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.284295465 | . |
| Keratin | P02538 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.262484788 | . |
| Keratin-13 | P13646 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.72289753 | . |
| Keratin-73 | Q86Y46 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.328451088 | . |
| KH domain-containing RNA-binding protein QKI | Q96PU8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 8.560419106 | . |
| Kinectin | Q86UP2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.398754363 | . |
| Kinesin light chain 1 | Q07866 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.653451082 | . |
| Kinesin light chain 2 | Q9H0B6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.057214738 | . |
| Kinesin-1 heavy chain | P33176 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.665052484 | . |
| Kinesin-like protein KIF13B | Q9NQT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.199284966 | . |
| Kinesin-like protein KIF1B | O60333 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.558466231 | . |
| Kinesin-like protein KIF21A | Q7Z4S6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.888856961 | . |
| Kinesin-like protein KIF2A | O00139 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.683510482 | . |
| Kinesin-like protein KIF2C | Q99661 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.16650787 | . |
| L-lactate dehydrogenase A chain | P00338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.894998621 | . |
| L-lactate dehydrogenase B chain | P07195 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.871426901 | . |
| L-lactate dehydrogenase C chain | P07864 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.68866277 | . |
| L-xylulose reductase | Q7Z4W1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.216884224 | . |
| La-related protein 1 | Q6PKG0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.745390601 | . |
| La-related protein 4 | Q71RC2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.5531731 | . |
| La-related protein 4B | Q92615 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.336750786 | . |
| Lamin-B1 | P20700 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.67465406 | . |
| Lamina-associated polypeptide 2 | P42166 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.012290815 | . |
| LANP-like protein | Q9BTT0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.238035508 | . |
| Large subunit GTPase 1 homolog | Q9H089 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.005706558 | . |
| Leucine--tRNA ligase | Q9P2J5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.723391993 | . |
| Leucine-rich repeat-containing protein 47 | Q8N1G4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.647767964 | . |
| Leucine-rich repeat-containing protein 59 | Q96AG4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.101303858 | . |
| Leukocyte elastase inhibitor | P30740 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.522294458 | . |
| LIM and SH3 domain protein 1 | Q14847 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.267893602 | . |
| Lipoma-preferred partner | Q93052 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.732340416 | . |
| Lipoyl synthase | O43766 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.975640391 | . |
| Lissencephaly-1 protein | P43034 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.829922972 | . |
| LMW-PTP | P24666 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.227861041 | . |
| Lon protease homolog | P36776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.72286315 | . |
| Long-chain-fatty-acid--CoA ligase 4 | O60488 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.293659208 | . |
| Luc7-like protein 3 | O95232 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.938965709 | . |
| Lupus La protein | P05455 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.413254685 | . |
| Lysine--tRNA ligase | Q15046 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.745170871 | . |
| Macrophage migration inhibitory factor | P14174 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.189971106 | . |
| Macrophage-capping protein | P40121 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.377789624 | . |
| Malate dehydrogenase | P40925 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.341560504 | . |
| Malectin | Q14165 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.471141188 | . |
| MAP activator with WD repeats | Q9Y3F4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.341539408 | . |
| MAP kinase kinase 2 | P36507 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.920753393 | . |
| MAP kinase signal-integrating kinase 2 | Q9HBH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.132895096 | . |
| Matrin-3 | P43243 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.614474122 | . |
| Medium tumor antigen-associated 61 kDa protein | P30153 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.11581909 | . |
| Melanoma-associated antigen B2 | O15479 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.334169045 | . |
| Merlin | P35240 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 13.27839444 | . |
| Methionine aminopeptidase 1 | P53582 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.375757223 | . |
| Methionine aminopeptidase 2 | P50579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.810921932 | . |
| Methionine--tRNA ligase | Q96GW9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.815471352 | . |
| Methionine--tRNA ligase | P56192 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.643501102 | . |
| Methyltransferase-like protein 15 | A6NJ78 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.05509687 | . |
| Mevalonate kinase | Q03426 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.875956409 | . |
| MICAL-like protein 1 | Q8N3F8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.093382268 | . |
| MICOS complex subunit MIC60 | Q16891 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.823477298 | . |
| Microsomal glutathione S-transferase 1 | P10620 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.87682901 | . |
| Microsomal triglyceride transfer protein large subunit | P55157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.833241838 | . |
| Microtubule-associated protein 1B | P46821 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.311898947 | . |
| Microtubule-associated protein 4 | P27816 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.231330516 | . |
| Mid1-interacting protein 1 | Q9NPA3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.812737466 | . |
| Midasin | Q9NU22 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.875702688 | . |
| Mitochondrial import receptor subunit TOM34 | Q15785 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.927584722 | . |
| Mitochondrial import receptor subunit TOM70 | O94826 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.188413279 | . |
| Mitochondrial intermediate peptidase | Q99797 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.52377741 | . |
| Mitochondrial proton/calcium exchanger protein | O95202 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.37183544 | . |
| Mitochondrial tRNA-specific 2-thiouridylase 1 | O75648 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.341733347 | . |
| Mitogen-activated protein kinase 1 | P28482 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.787325221 | . |
| Mitotic checkpoint protein BUB3 | O43684 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.998321882 | . |
| Moesin | P26038 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.620584854 | . |
| Molybdenum cofactor sulfurase | Q96EN8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.19475799 | . |
| mPR | O00264 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.094837198 | . |
| mRNA cap guanine-N7 methyltransferase | O43148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.304371957 | . |
| mRNA turnover protein 4 homolog | Q9UKD2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.154680522 | . |
| Mt-SSB | Q04837 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.507448848 | . |
| Multisynthase complex auxiliary component p43 | Q12904 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.278684805 | . |
| Muscleblind-like protein 1 | Q9NR56 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.754397269 | . |
| Myc box-dependent-interacting protein 1 | O00499 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.914836735 | . |
| Myelin expression factor 2 | Q9P2K5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.728559709 | . |
| Myelin regulatory factor-like protein | Q96LU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.55591337 | . |
| Myeloid leukemia factor 2 | Q15773 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.401077186 | . |
| Myeloid-associated differentiation marker | Q96S97 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.159240074 | . |
| Myoferlin | Q9NZM1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.215135239 | . |
| Myomesin-1 | P52179 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.764100819 | . |
| Myomesin-2 | P54296 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.038935144 | . |
| Myosin light chain 1/3 | P05976 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.581575586 | . |
| Myosin light chain 3 | P08590 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.819564863 | . |
| Myosin-1 | P12882 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.027957533 | . |
| Myosin-10 | P35580 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.003702961 | . |
| Myosin-14 | Q7Z406 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.958152522 | . |
| Myosin-2 | Q9UKX2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.59286109 | . |
| Myosin-7 | P12883 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.821342224 | . |
| Myosin-9 | P35579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.914358886 | . |
| Myosin-binding protein C | Q14324 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.362878985 | . |
| Myozenin-1 | Q9NP98 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.798353275 | . |
| N-acetylglutamate synthase | Q8N159 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.268110047 | . |
| Na(+)/H(+) exchange regulatory cofactor NHE-RF1 | O14745 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.15114581 | . |
| NAD(P)H dehydrogenase [quinone] 1 | P15559 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.124810859 | . |
| NAD-dependent malic enzyme | P23368 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.452844501 | . |
| NADH dehydrogenase 1 alpha subcomplex assembly factor 3 | Q9BU61 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.583713026 | . |
| NADH dehydrogenaseiron-sulfur protein 2 | O75306 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.878412091 | . |
| NADH-ubiquinone oxidoreductase 24 kDa subunit | P19404 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.905978455 | . |
| NADPH--cytochrome P450 reductase | P16435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.907575245 | . |
| Nebulin-related-anchoring protein | Q86VF7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.758885183 | . |
| NEDD8-conjugating enzyme Ubc12 | P61081 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.371046028 | . |
| Nesprin-2 | Q8WXH0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.051204263 | . |
| Nestin | P48681 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.067697875 | . |
| Neurolysin | Q9BYT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.749970657 | . |
| Neutral alpha-glucosidase AB | Q14697 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.204245752 | . |
| NF-X1-type zinc finger protein NFXL1 | Q6ZNB6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.749217733 | . |
| NHP2-like protein 1 | P55769 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.186396399 | . |
| Nicotinamide phosphoribosyltransferase | P43490 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.147745206 | . |
| Nicotinate phosphoribosyltransferase | Q6XQN6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.052984204 | . |
| Non-histone chromosomal protein HMG-14 | P05114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.301188099 | . |
| NonO protein | Q15233 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.234844187 | . |
| Nonsense-mediated mRNA decay factor SMG8 | Q8ND04 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.60588671 | . |
| Notchless protein homolog 1 | Q9NVX2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.276186035 | . |
| NSFL1 cofactor p47 | Q9UNZ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.630431351 | . |
| Nuclear cap-binding protein subunit 1 | Q09161 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.138338835 | . |
| Nuclear cap-binding protein subunit 3 | Q53F19 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.622258157 | . |
| Nuclear migration protein nudC | Q9Y266 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.649339566 | . |
| Nuclear receptor coactivator 5 | Q9HCD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.367939783 | . |
| Nuclear RNA export factor 1 | Q9UBU9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.132885263 | . |
| Nucleic acid dioxygenase ALKBH1 | Q13686 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.400579137 | . |
| Nucleolar RNA helicase 2 | Q9NR30 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.921777596 | . |
| Nucleolin | P19338 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.864444358 | . |
| Nucleolysin TIA-1 isoform p40 | P31483 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.644452536 | . |
| Nucleolysin TIAR | Q01085 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.93011709 | . |
| Nucleophosmin | P06748 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.132743348 | . |
| Nucleoporin Nup43 | Q8NFH3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.227466113 | . |
| Nucleoside diphosphate kinase 6 | O75414 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.003582115 | . |
| Nucleoside diphosphate kinase B | P22392 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.92224801 | . |
| Nucleosome assembly protein 1-like 1 | P55209 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.34746489 | . |
| Nucleosome assembly protein 1-like 4 | Q99733 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.660668251 | . |
| Obg-like ATPase 1 | Q9NTK5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.597613424 | . |
| Occludin | Q16625 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.761117297 | . |
| OGCP | Q02978 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.928649377 | . |
| OGDC-E2 | P36957 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.80175322 | . |
| Olfactory receptor 5AK2 | Q8NH90 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.740055422 | . |
| Oligosaccharyl transferase subunit DAD1 | P61803 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.61985103 | . |
| Oligosaccharyl transferase subunit STT3A | P46977 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.74875091 | . |
| Oligosaccharyl transferase subunit STT3B | Q8TCJ2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.970761901 | . |
| Oligosaccharyltransferase complex subunit OSTC | Q9NRP0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.812959422 | . |
| Opioid growth factor receptor | Q9NZT2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.574484973 | . |
| Oxidative stress-associated Src activator | Q9NZB2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.264174135 | . |
| Oxidoreductase HTATIP2 | Q9BUP3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.07266466 | . |
| Oxygen-dependent coproporphyrinogen-III oxidase | P36551 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.961029351 | . |
| PABP-interacting protein 1 | Q9H074 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.220977268 | . |
| PAF acetylhydrolase 29 kDa subunit | Q15102 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.563860923 | . |
| PAI1 RNA-binding protein 1 | Q8NC51 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.860149225 | . |
| PAICS | P22234 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.013301377 | . |
| PAPSS 1 | O43252 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.745912926 | . |
| Paraspeckle component 1 | Q8WXF1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.205199677 | . |
| Parkinson disease protein 7 | Q99497 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.628267683 | . |
| Partner of Y14 and mago | Q9BRP8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.115979578 | . |
| Parvalbumin alpha | P20472 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.170290228 | . |
| Parvulin-14 | Q9Y237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.846853482 | . |
| PAT complex subunit CCDC47 | Q96A33 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 7.118666205 | . |
| PDZ and LIM domain protein 1 | O00151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.547461952 | . |
| PDZ domain-containing protein GIPC1 | O14908 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.321064956 | . |
| Peptidyl-prolyl cis-trans isomerase A | P62937 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.579685936 | . |
| Peptidyl-prolyl cis-trans isomerase B | P23284 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.159993074 | . |
| Peptidyl-prolyl cis-trans isomerase FKBP11 | Q9NYL4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.217802137 | . |
| Peptidyl-prolyl cis-trans isomerase FKBP1A | P62942 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.909154622 | . |
| Peptidyl-prolyl cis-trans isomerase FKBP3 | Q00688 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.857812218 | . |
| Peptidyl-prolyl cis-trans isomerase FKBP4 | Q02790 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.693298428 | . |
| Pericentriolar material 1 protein | Q15154 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.885780176 | . |
| Perilipin-2 | Q99541 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.974197893 | . |
| Perilipin-3 | O60664 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.081784911 | . |
| Peroxiredoxin-1 | Q06830 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.836101622 | . |
| Peroxiredoxin-2 | P32119 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.017930507 | . |
| Peroxiredoxin-4 | Q13162 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.482111535 | . |
| Peroxiredoxin-5 | P30044 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.130987369 | . |
| Peroxiredoxin-6 | P30041 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.37330509 | . |
| Peroxiredoxin-like 2A | Q9BRX8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.224296496 | . |
| Peroxisomal multifunctional enzyme type 2 | P51659 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.40545335 | . |
| Phenylalanine--tRNA ligase | O95363 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.956024601 | . |
| Phenylalanine--tRNA ligase beta subunit | Q9NSD9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.515980522 | . |
| Phosphate carrier protein | Q00325 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.221705041 | . |
| Phosphatidylethanolamine-binding protein 1 | P30086 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.479494015 | . |
| Phosphoglucomutase-1 | P36871 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.899908414 | . |
| Phosphoglycerate kinase 1 | P00558 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.372275439 | . |
| Phosphoglycerate kinase 2 | P07205 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.971381132 | . |
| Phosphoglycerate mutase 1 | P18669 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.12850838 | . |
| Phosphoglycerate mutase 2 | P15259 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.914011173 | . |
| Phosphopentomutase | Q96G03 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.960307361 | . |
| Phosphoserine aminotransferase | Q9Y617 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.641505414 | . |
| Phosphoserine phosphatase | P78330 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.875245143 | . |
| Phytanoyl-CoA hydroxylase-interacting protein-like | Q96FC7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.328187366 | . |
| Pinin | Q9H307 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.802327686 | . |
| PKA C-beta | P22694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.17733093 | . |
| PKR-associated protein X | O75569 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.744698499 | . |
| Plakophilin-1 | Q13835 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.517712033 | . |
| Plakophilin-2 | Q99959 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.964350136 | . |
| Plectin | Q15149 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.184777935 | . |
| Pleiotropic regulator 1 | O43660 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.620939115 | . |
| Poly [ADP-ribose] polymerase 1 | P09874 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.483999746 | . |
| Poly(A) polymerase alpha | P51003 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.114335853 | . |
| Poly(rC)-binding protein 1 | Q15365 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.67167657 | . |
| Poly(rC)-binding protein 2 | Q15366 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.238248925 | . |
| Poly(rC)-binding protein 3 | P57721 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.212741906 | . |
| Poly(U)-binding-splicing factor | Q9UHX1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.142603711 | . |
| Polyadenylate-binding protein 1 | P11940 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.232149487 | . |
| Polyadenylate-binding protein 2 | Q86U42 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.806749736 | . |
| Polyadenylate-binding protein 4 | Q13310 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.899679734 | . |
| Polymerase delta-interacting protein 3 | Q9BY77 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.676470433 | . |
| Polypyrimidine tract-binding protein 1 | P26599 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.159679485 | . |
| Polypyrimidine tract-binding protein 3 | O95758 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.873174998 | . |
| Positive cofactor 4 | P53999 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.973943447 | . |
| PP-1A | P62136 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.627342272 | . |
| PP-1B | P62140 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.274148479 | . |
| PP-1G | P36873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.783023394 | . |
| PP2A-alpha | P67775 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.44186801 | . |
| PP4C | P60510 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.277104362 | . |
| PP6C | O00743 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.626901363 | . |
| PPIase D | Q08752 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.48199438 | . |
| PQBP-1 | O60828 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.168192021 | . |
| pre-mRNA 3' end processing protein WDR33 | Q9C0J8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.046722487 | . |
| Pre-mRNA 3'-end-processing factor FIP1 | Q6UN15 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.309177213 | . |
| Pre-mRNA-processing factor 17 | O60508 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.517146716 | . |
| Pre-mRNA-processing factor 19 | Q9UMS4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.347169803 | . |
| Pre-mRNA-processing factor 40 homolog A | O75400 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.796298903 | . |
| Pre-mRNA-processing factor 6 | O94906 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.613138194 | . |
| Pre-mRNA-processing-splicing factor 8 | Q6P2Q9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.044377924 | . |
| Pre-mRNA-splicing factor 38A | Q8NAV1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.774434015 | . |
| Pre-mRNA-splicing factor RBM22 | Q9NW64 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.651359512 | . |
| Pre-mRNA-splicing factor SPF27 | O75934 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.687528123 | . |
| Pre-mRNA-splicing factor SYF1 | Q9HCS7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.16608077 | . |
| Prefoldin subunit 3 | P61758 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.650531799 | . |
| Prelamin-A/C | P02545 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.769144796 | . |
| Presequence protease | Q5JRX3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.348869089 | . |
| Probable arginine--tRNA ligase | Q5T160 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.348967437 | . |
| Probable ATP-dependent RNA helicase DDX17 | Q92841 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.055848328 | . |
| Probable ATP-dependent RNA helicase DDX23 | Q9BUQ8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.92740243 | . |
| Probable ATP-dependent RNA helicase DDX47 | Q9H0S4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.324538024 | . |
| Probable ATP-dependent RNA helicase DDX5 | P17844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.07564792 | . |
| Probable ATP-dependent RNA helicase DDX6 | P26196 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.575128211 | . |
| Probable helicase with zinc finger domain | P42694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.777846332 | . |
| Probable phosphoglycerate mutase 4 | Q8N0Y7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.373791186 | . |
| Procathepsin L | P07711 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.546543426 | . |
| Profilin-1 | P07737 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.987549217 | . |
| Programmed cell death 6-interacting protein | Q8WUM4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.753271167 | . |
| Programmed cell death protein 6 | O75340 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.568384051 | . |
| Prohibitin 1 | P35232 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.448226788 | . |
| Prohibitin-2 | Q99623 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.346916721 | . |
| Prolactin-inducible protein | P12273 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.16134714 | . |
| Proliferating cell nuclear antigen | P12004 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.919243603 | . |
| Proliferation marker protein Ki-67 | P46013 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.201319609 | . |
| Proliferation-associated protein 2G4 | Q9UQ80 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.585869178 | . |
| Prolyl endopeptidase | P48147 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.193587073 | . |
| Prostaglandin E synthase 2 | Q9H7Z7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.703997877 | . |
| Prostaglandin E synthase 3 | Q15185 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.751357494 | . |
| Prostaglandin G/H synthase 2 | P35354 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.931397405 | . |
| Prostaglandin reductase 1 | Q14914 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.792546332 | . |
| Proteasomal ubiquitin receptor ADRM1 | Q16186 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.461214409 | . |
| Proteasome activator complex subunit 1 | Q06323 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.689741765 | . |
| Proteasome activator complex subunit 3 | P61289 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.12030045 | . |
| Proteasome assembly chaperone 1 | O95456 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.213440958 | . |
| Proteasome subunit alpha type-1 | P25786 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.732849272 | . |
| Proteasome subunit alpha type-3 | P25788 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.850909076 | . |
| Proteasome subunit alpha type-4 | P25789 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.66085126 | . |
| Proteasome subunit alpha type-6 | P60900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.513042035 | . |
| Proteasome subunit alpha type-7 | O14818 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.902292513 | . |
| Proteasome subunit beta type-1 | P20618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.542231873 | . |
| Proteasome subunit beta type-2 | P49721 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.76990487 | . |
| Proteasome subunit beta type-3 | P49720 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.174086395 | . |
| Proteasome subunit beta type-5 | P28074 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.431071885 | . |
| Protein adenylyltransferase SelO | Q9BVL4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.291287052 | . |
| Protein arginine N-methyltransferase 1 | Q99873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.66318599 | . |
| Protein argonaute-1 | Q9UL18 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.954258757 | . |
| Protein argonaute-2 | Q9UKV8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.359659069 | . |
| Protein CDV3 homolog | Q9UKY7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.840464425 | . |
| Protein DDI1 homolog 2 | Q5TDH0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.529774408 | . |
| Protein disulfide-isomerase | P07237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.80225564 | . |
| Protein disulfide-isomerase A4 | P13667 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.712727701 | . |
| Protein disulfide-isomerase A6 | Q15084 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.514256083 | . |
| Protein FAM120C | Q9NX05 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.494777166 | . |
| Protein FAM50A | Q14320 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.746050747 | . |
| Protein FAM98A | Q8NCA5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.396889658 | . |
| Protein FAM98B | Q52LJ0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.278597419 | . |
| Protein flightless-1 homolog | Q13045 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.430834197 | . |
| Protein FMC1 homolog | Q96HJ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.080729685 | . |
| Protein HIRA | P54198 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.331210157 | . |
| Protein jagunal homolog 1 | Q8N5M9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.53054985 | . |
| Protein JTV-1 | Q13155 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.000592657 | . |
| Protein lin-28 homolog B | Q6ZN17 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.490143751 | . |
| Protein LSM12 | Q3MHD2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.244524297 | . |
| Protein LSM14 homolog A | Q8ND56 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.276768849 | . |
| Protein LSM14 homolog B | Q9BX40 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.853470965 | . |
| Protein mago nashi homolog | P61326 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.785403959 | . |
| Protein mago nashi homolog 2 | Q96A72 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.317370931 | . |
| Protein NipSnap homolog 2 | O75323 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.014852961 | . |
| Protein pelota homolog | Q9BRX2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.66156022 | . |
| Protein phosphatase 1 regulatory subunit 7 | Q15435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.685613067 | . |
| Protein POF1B | Q8WVV4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 6.069435163 | . |
| Protein PRRC2A | P48634 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.666397467 | . |
| Protein RCC2 | Q9P258 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.376515784 | . |
| Protein S100-A11 | P31949 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.804515263 | . |
| Protein S100-A4 | P26447 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.28164778 | . |
| Protein S100-A6 | P06703 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.086369753 | . |
| Protein S100-P | P25815 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.358097897 | . |
| Protein SET | Q01105 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.396305044 | . |
| Protein SGT1 homolog | Q9Y2Z0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.248757506 | . |
| Protein TMED10 | P49755 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.310518708 | . |
| Protein TRAM1 | Q15629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.43245171 | . |
| Protein transport protein Sec24C | P53992 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.002637563 | . |
| Protein transport protein Sec61 subunit beta | P60468 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.878050417 | . |
| Protein virilizer homolog | Q69YN4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.111195319 | . |
| Protein-glutamine gamma-glutamyltransferase 2 | P21980 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.8997981 | . |
| Protein-glutamine gamma-glutamyltransferase E | Q08188 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.329252742 | . |
| Protein-tyrosine phosphatase 1B | P18031 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.660333987 | . |
| Proton-coupled zinc antiporter SLC30A1 | Q9Y6M5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.110775337 | . |
| Pseudouridylate synthase 1 homolog | Q9Y606 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.342106487 | . |
| Pumilio homolog 1 | Q14671 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.539588434 | . |
| Pumilio homolog 2 | Q8TB72 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.846737132 | . |
| Purine nucleoside phosphorylase | P00491 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.964323999 | . |
| Puromycin-sensitive aminopeptidase | P55786 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.89806899 | . |
| Putative RNA-binding protein Luc7-like 1 | Q9NQ29 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.991649479 | . |
| Putative RNA-binding protein Luc7-like 2 | Q9Y383 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.990776099 | . |
| Pyrroline-5-carboxylate reductase 2 | Q96C36 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.605406701 | . |
| Pyruvate kinase PKM | P14618 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.02005883 | . |
| Quinone oxidoreductase | Q08257 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.919834441 | . |
| Rab GDP dissociation inhibitor alpha | P31150 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.128379243 | . |
| Rab GDP dissociation inhibitor beta | P50395 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.293254374 | . |
| Ran GTPase-activating protein 1 | P46060 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.358113219 | . |
| Ran-specific GTPase-activating protein | P43487 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.164780417 | . |
| Ras GTPase-activating protein-binding protein 1 | Q13283 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.068097482 | . |
| Ras GTPase-activating protein-binding protein 2 | Q9UN86 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.860962143 | . |
| Ras GTPase-activating-like protein IQGAP1 | P46940 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.425203587 | . |
| Ras-related protein Rab-10 | P61026 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.482191042 | . |
| Ras-related protein Rab-11A | P62491 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.427408298 | . |
| Ras-related protein Rab-14 | P61106 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.092660995 | . |
| Ras-related protein Rab-1A | P62820 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.707501673 | . |
| Ras-related protein Rab-1B | Q9H0U4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.462286194 | . |
| Ras-related protein Rab-2A | P61019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 7.96904085 | . |
| Ras-related protein Rab-5A | P20339 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.290487253 | . |
| Ras-related protein Rab-5B | P61020 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.06175516 | . |
| Ras-related protein Rab-5C | P51148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.677758348 | . |
| Ras-related protein Rab-6A | P20340 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.014437819 | . |
| Ras-related protein Rab-6D | Q53S08 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.746883173 | . |
| Ras-related protein Rab-7a | P51149 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.854901631 | . |
| Ras-related protein Rab-8A | P61006 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.081044217 | . |
| Receptor expression-enhancing protein 6 | Q96HR9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.527052497 | . |
| Receptor of activated protein C kinase 1 | P63244 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.16318259 | . |
| Regulator of chromosome condensation | P18754 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.498992943 | . |
| Regulator of nonsense transcripts 1 | Q92900 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.220895788 | . |
| REST corepressor 2 | Q8IZ40 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.983700689 | . |
| Reticulocalbin-2 | Q14257 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.281913878 | . |
| Reticulon-4 | Q9NQC3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.990618283 | . |
| Retinol dehydrogenase 11 | Q8TC12 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.908207442 | . |
| Retrotransposon-derived protein PEG10 | Q86TG7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.312591637 | . |
| Rho family-interacting cell polarization regulator 1 | Q6ZS17 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.390155086 | . |
| Rho GDP-dissociation inhibitor 1 | P52565 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.551930596 | . |
| Rho GTPase-activating protein 1 | Q07960 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.52981086 | . |
| Rho GTPase-activating protein 23 | Q9P227 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.127937103 | . |
| Rho GTPase-activating protein 5 | Q13017 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.136791537 | . |
| Rho-related GTP-binding protein RhoC | P08134 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.092681207 | . |
| RIBIIR | P04844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.22316991 | . |
| Ribonuclease inhibitor | P13489 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.665204652 | . |
| Ribonucleoprotein PTB-binding 1 | Q8IY67 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.1686341 | . |
| Ribonucleoprotein PTB-binding 2 | Q9HCJ3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.623172687 | . |
| Ribonucleoside-diphosphate reductase subunit M1 | P23921 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.088661698 | . |
| Ribophorin I | P04843 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.27801217 | . |
| Ribose-phosphate pyrophosphokinase 1 | P60891 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.139377913 | . |
| Ribose-phosphate pyrophosphokinase 2 | P11908 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.839776035 | . |
| Ribosomal protein S6 kinase alpha-3 | P51812 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.860166733 | . |
| Ribosome biogenesis inhibitor MINAS-60 | P0DW28 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.625743879 | . |
| Ribosome biogenesis protein WDR12 | Q9GZL7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.813025038 | . |
| Ribosome maturation protein SBDS | Q9Y3A5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.994497257 | . |
| Ribosome-binding protein 1 | Q9P2E9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.698885039 | . |
| RNA 3'-terminal phosphate cyclase | O00442 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.535365754 | . |
| RNA binding motif protein | Q96E39 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.714273003 | . |
| RNA binding protein fox-1 homolog 2 | O43251 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.562909871 | . |
| RNA demethylase ALKBH5 | Q6P6C2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.516961361 | . |
| RNA helicase aquarius | O60306 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.065796523 | . |
| RNA-binding motif protein | P38159 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.641356539 | . |
| RNA-binding protein 12 | Q9NTZ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.068389228 | . |
| RNA-binding protein 12B | Q8IXT5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.055601385 | . |
| RNA-binding protein 14 | Q96PK6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.960420257 | . |
| RNA-binding protein 15 | Q96T37 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.33131384 | . |
| RNA-binding protein 25 | P49756 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.9432246 | . |
| RNA-binding protein 26 | Q5T8P6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.052932212 | . |
| RNA-binding protein 3 | P98179 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.492098977 | . |
| RNA-binding protein 39 | Q14498 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.026634631 | . |
| RNA-binding protein 4 | Q9BWF3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.090729994 | . |
| RNA-binding protein 45 | Q8IUH3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.542681108 | . |
| RNA-binding protein 47 | A0AV96 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.743418116 | . |
| RNA-binding protein 4B | Q9BQ04 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.885858057 | . |
| RNA-binding protein 8A | Q9Y5S9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.159665879 | . |
| RNA-binding protein EWS | Q01844 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.10838879 | . |
| RNA-binding protein FUS | P35637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.788321776 | . |
| RNA-binding protein FXR1 | P51114 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.882583759 | . |
| RNA-binding protein FXR2 | P51116 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.372669 | . |
| RNA-binding protein Musashi homolog 1 | O43347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.75189041 | . |
| RNA-binding protein Musashi homolog 2 | Q96DH6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.176051262 | . |
| RNA-binding protein Nova-1 | P51513 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.930512148 | . |
| RNA-binding protein PNO1 | Q9NRX1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.968977988 | . |
| RNA-binding protein Raly | Q9UKM9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.743060252 | . |
| RNA-binding protein RO60 | P10155 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.170954436 | . |
| RNA-binding protein with multiple splicing | Q93062 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.326672582 | . |
| RNA-binding protein with multiple splicing 2 | Q6ZRY4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.102864061 | . |
| RNA-binding protein with serine-rich domain 1 | Q15287 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.669682362 | . |
| RNA-splicing ligase RtcB homolog | Q9Y3I0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.884928399 | . |
| Rootletin | Q5TZA2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.765137852 | . |
| RP-A p70 | P27694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.783792098 | . |
| rRNA 2'-O-methyltransferase fibrillarin | P22087 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.716683315 | . |
| rRNA methyltransferase 2 | Q9UI43 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.875766208 | . |
| rRNA methyltransferase 2 | Q9UI43 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.630711808 | . |
| RuvB-like 1 | Q9Y265 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.814619268 | . |
| RuvB-like 2 | Q9Y230 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.907603252 | . |
| S-adenosylmethionine synthase isoform type-2 | P31153 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.839539114 | . |
| S-formylglutathione hydrolase | P10768 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.064813195 | . |
| S1 RNA-binding domain-containing protein 1 | Q8N5C6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.666634488 | . |
| Saccharopine dehydrogenase-like oxidoreductase | Q8NBX0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.514554988 | . |
| SAFB-like transcription modulator | Q9NWH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.907718935 | . |
| SAP domain-containing ribonucleoprotein | P82979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.552545019 | . |
| Scaffold attachment factor B1 | Q15424 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.480821391 | . |
| Scaffold attachment factor B2 | Q14151 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.346317362 | . |
| Scaffold-attachment factor A2 | Q1KMD3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.588319381 | . |
| Scinderin | Q9Y6U3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.838985008 | . |
| Sec1 family domain-containing protein 1 | Q8WVM8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.484573753 | . |
| Sepiapterin reductase | P35270 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.150034079 | . |
| Septin-10 | Q9P0V9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.413628441 | . |
| Septin-11 | Q9NVA2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.244210762 | . |
| Septin-2 | Q15019 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.412137018 | . |
| Septin-6 | Q14141 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.776794031 | . |
| Septin-7 | Q16181 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.364046478 | . |
| Septin-9 | Q9UHD8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.009281025 | . |
| Sequestosome-1 | Q13501 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.793784059 | . |
| SERCA1 | O14983 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.999750674 | . |
| SERCA2 | P16615 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.177441589 | . |
| Serine hydroxymethyltransferase | P34896 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.888169445 | . |
| Serine palmitoyltransferase 1 | O15269 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.754853222 | . |
| Serine--tRNA ligase | Q9NP81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.354501769 | . |
| Serine/arginine repetitive matrix protein 1 | Q8IYB3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.266941347 | . |
| Serine/arginine repetitive matrix protein 2 | Q9UQ35 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.036558632 | . |
| Serine/arginine-rich splicing factor 1 | Q07955 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.23999344 | . |
| Serine/arginine-rich splicing factor 10 | O75494 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.669079705 | . |
| Serine/arginine-rich splicing factor 11 | Q05519 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.217339053 | . |
| Serine/arginine-rich splicing factor 12 | Q8WXF0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.54956024 | . |
| Serine/arginine-rich splicing factor 2 | Q01130 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.627796859 | . |
| Serine/arginine-rich splicing factor 3 | P84103 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.293146712 | . |
| Serine/arginine-rich splicing factor 4 | Q08170 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.45643575 | . |
| Serine/arginine-rich splicing factor 5 | Q13243 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.171958259 | . |
| Serine/arginine-rich splicing factor 6 | Q13247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.901234813 | . |
| Serine/arginine-rich splicing factor 7 | Q16629 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.230898015 | . |
| Serine/arginine-rich splicing factor 9 | Q13242 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.097739447 | . |
| Serine/threonine-protein kinase mTOR | P42345 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.686074196 | . |
| Serine/threonine-protein kinase N2 | Q16513 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.054062785 | . |
| Serine/threonine-protein kinase PRP4 homolog | Q13523 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.966415375 | . |
| Serine/threonine-protein kinase SMG1 | Q96Q15 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.251498738 | . |
| Serpin B6 | P35237 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.149847167 | . |
| Serpin H1 | P50454 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.495905462 | . |
| Serrate RNA effector molecule homolog | Q9BXP5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.266414111 | . |
| Serum paraoxonase/arylesterase 2 | Q15165 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.652155194 | . |
| SFL | Q9NUL5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.360633627 | . |
| SH3 domain-binding protein 1 | Q9H299 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.444579795 | . |
| Sialic acid synthase | Q9NR45 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.264368147 | . |
| Sideroflexin-1 | Q9H9B4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.648607256 | . |
| Signal recognition particle 14 kDa protein | P37108 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.312042197 | . |
| Signal recognition particle 9 kDa protein | P49458 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.334356956 | . |
| Signal recognition particle subunit SRP54 | P61011 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.469909666 | . |
| Signal recognition particle subunit SRP72 | O76094 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.722488168 | . |
| Single-stranded DNA-binding protein MSSP-1 | P29558 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.75032519 | . |
| SLCO2A1 | Q92959 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.895641415 | . |
| Small nuclear ribonucleoprotein E | P62304 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.993788472 | . |
| Small nuclear ribonucleoprotein F | P62306 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.094401575 | . |
| Small nuclear ribonucleoprotein Sm D1 | P62314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.516701511 | . |
| Small nuclear ribonucleoprotein Sm D2 | P62316 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.7653183 | . |
| Small nuclear ribonucleoprotein Sm D3 | P62318 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.23224428 | . |
| Small ubiquitin-related modifier 2 | P61956 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.275957209 | . |
| snRNP-B | P14678 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.068062364 | . |
| snRNP-N | P63162 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.254927788 | . |
| SNU114 homolog | Q15029 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.66674764 | . |
| SNW domain-containing protein 1 | Q13573 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.70891979 | . |
| Solute carrier family 25 member 13 | Q9UJS0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.835316166 | . |
| Sorbitol dehydrogenase | Q00796 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.0832064 | . |
| Sorcin | P30626 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.903426769 | . |
| Sorting nexin-5 | Q9Y5X3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.117590504 | . |
| SPATS2-like protein | Q9NUQ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.0726733 | . |
| Spectrin alpha chain | Q13813 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.507590574 | . |
| Spectrin beta chain | Q01082 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.158155475 | . |
| Sperm-associated antigen 17 | Q6Q759 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.358898056 | . |
| Spermatid perinuclear RNA-binding protein | Q96SI9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.71318522 | . |
| Spermine synthase | P52788 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.308176584 | . |
| Spliceosome RNA helicase DDX39B | Q13838 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.603623814 | . |
| Splicing factor | P23246 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.06695423 | . |
| Splicing factor 1 | Q15637 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.317202417 | . |
| Splicing factor 3A subunit 1 | Q15459 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.61758491 | . |
| Splicing factor 3B subunit 1 | O75533 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.88164884 | . |
| Splicing factor 3B subunit 2 | Q13435 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.966177758 | . |
| Splicing factor 3B subunit 3 | Q15393 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.722029714 | . |
| Splicing factor 3B subunit 4 | Q15427 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.55266534 | . |
| Splicing factor U2AF 35 kDa subunit | Q01081 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.408976702 | . |
| Splicing factor U2AF 65 kDa subunit | P26368 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.67941533 | . |
| Squalene synthase | P37268 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.393793548 | . |
| SR-beta | Q9Y5M8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.761706553 | . |
| SR-related and CTD-associated factor 8 | Q9UPN6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.621698494 | . |
| SRA stem-loop-interacting RNA-binding protein | Q9GZT3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.291202995 | . |
| Src substrate cortactin | Q14247 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.766424831 | . |
| Stathmin-2 | Q93045 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.021591722 | . |
| Sterol O-acyltransferase 1 | P35610 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.093006433 | . |
| Stomatin-like protein 2 | Q9UJZ1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.10262626 | . |
| Stress-induced-phosphoprotein 1 | P31948 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.470634356 | . |
| Structural maintenance of chromosomes protein 2 | O95347 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.46459609 | . |
| Structural maintenance of chromosomes protein 4 | Q9NTJ3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.23498518 | . |
| Sucrose nonfermenting protein 2 homolog | O60264 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.777137578 | . |
| Sulfotransferase 2A1 | Q06520 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.117235278 | . |
| Sulfotransferase 2B1 | O00204 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.252443189 | . |
| SUMO-activating enzyme subunit 1 | Q9UBE0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.979426328 | . |
| SUMO-activating enzyme subunit 2 | Q9UBT2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.11009068 | . |
| Suppressor of CDC2 with RNA-binding motif 3 | Q15434 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.321211221 | . |
| Surfeit locus protein 4 | O15260 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.949417332 | . |
| SURP and G-patch domain-containing protein 2 | Q8IX01 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.145590322 | . |
| Symplekin | Q92797 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.725279906 | . |
| Synaptic vesicle membrane protein VAT-1 homolog | Q99536 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.812878797 | . |
| Syntaxin-7 | O15400 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.346024031 | . |
| T-complex protein 1 subunit alpha | P17987 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.13147368 | . |
| T-complex protein 1 subunit beta | P78371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -13.88231808 | . |
| T-complex protein 1 subunit delta | P50991 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.878766676 | . |
| T-complex protein 1 subunit epsilon | P48643 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.159838588 | . |
| T-complex protein 1 subunit eta | Q99832 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.985759233 | . |
| T-complex protein 1 subunit gamma | P49368 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.64797148 | . |
| T-complex protein 1 subunit zeta | P40227 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.672300381 | . |
| Talin-1 | Q9Y490 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.894133142 | . |
| TAR DNA-binding protein 43 | Q13148 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.877707124 | . |
| TATA-binding protein-associated factor 2N | Q92804 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.009438759 | . |
| Telomerase-binding protein EST1A | Q86US8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.368916288 | . |
| TERF2-interacting telomeric protein 1 | Q9NYB0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.36062021 | . |
| Testin | Q9UGI8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.180450195 | . |
| Thioredoxin | P10599 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.563357871 | . |
| Thioredoxin domain-containing protein 5 | Q8NBS9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.688587124 | . |
| Thioredoxin reductase 1 | Q16881 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.163231672 | . |
| Thioredoxin-like protein 1 | O43396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.096514732 | . |
| THO complex subunit 2 | Q8NI27 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.780074654 | . |
| THO complex subunit 4 | Q86V81 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.239175119 | . |
| Threonine--tRNA ligase | Q9BW92 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.650442032 | . |
| Threonine--tRNA ligase 1 | P26639 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.567147987 | . |
| THUMP domain-containing protein 1 | Q9NXG2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.147930704 | . |
| Thymidylate kinase | P23919 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.00638686 | . |
| Thyroid hormone receptor-associated protein 3 | Q9Y2W1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.762709658 | . |
| Tight junction protein ZO-2 | Q9UDY2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.623417313 | . |
| TIP41-like protein | O75663 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.941591913 | . |
| Tissue-specific extinguisher 1 | P10644 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.902568588 | . |
| Titin | Q8WZ42 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.344930555 | . |
| Transaldolase | P37837 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.73468996 | . |
| Transcription activator BRG1 | P51532 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.392942979 | . |
| Transcription elongation regulator 1 | O14776 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.955718748 | . |
| Transcription factor A | Q00059 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.913832374 | . |
| Transcription factor BTF3 | P20290 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.674372354 | . |
| Transcription factor ISGF-3 components p91/p84 | P42224 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.321756 | . |
| Transcription intermediary factor 1-beta | Q13263 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.933881442 | . |
| Transcriptional activator protein Pur-alpha | Q00577 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.230315332 | . |
| Transcriptional activator protein Pur-beta | Q96QR8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.5940584 | . |
| Transducin beta chain 1 | P62873 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.711443487 | . |
| Transducin beta-like protein 2 | Q9Y4P3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.643346294 | . |
| Transformer-2 protein homolog alpha | Q13595 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.189276454 | . |
| Transformer-2 protein homolog beta | P62995 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.488954831 | . |
| Transforming protein RhoA | P61586 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.272472603 | . |
| Transgelin-2 | P37802 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.675278014 | . |
| Transitional endoplasmic reticulum ATPase | P55072 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.654786175 | . |
| Transketolase | P29401 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.093013244 | . |
| Translationally-controlled tumor protein | P13693 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.087003039 | . |
| Translin | Q15631 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.1731187 | . |
| Translocation protein SEC63 homolog | Q9UGP8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.960884236 | . |
| Translocon-associated protein subunit delta | P51571 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.834944014 | . |
| Translocon-associated protein subunit gamma | Q9UNL2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.862909284 | . |
| Transmembrane protease serine 2 | O15393 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.043545219 | . |
| Transmembrane protein 109 | Q9BVC6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.720416542 | . |
| Transmembrane protein 209 | Q96SK2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.958303031 | . |
| Transmembrane protein 33 | P57088 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.218288883 | . |
| Transmembrane protein 40 | Q8WWA1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.607904962 | . |
| Transportin-1 | Q92973 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.411924727 | . |
| Tricarboxylate transport protein | P53007 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.51849334 | . |
| Triosephosphate isomerase | P60174 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.769978751 | . |
| tRNA (guanine(26)-N(2))-dimethyltransferase | Q9NXH9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.561223069 | . |
| tRNA methyltransferase 10 homolog C | Q7L0Y3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.330615647 | . |
| tRNA methyltransferase 112 homolog | Q9UI30 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.069083772 | . |
| Tropomyosin alpha-1 chain | P09493 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.576552995 | . |
| Tropomyosin alpha-3 chain | P06753 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.000954553 | . |
| Tropomyosin alpha-4 chain | P67936 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.78255655 | . |
| Tropomyosin beta chain | P07951 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.00488962 | . |
| Troponin T | P45378 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.39019731 | . |
| Trypsin-3 | P35030 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.522407599 | . |
| Tryptophan--tRNA ligase | P23381 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.923252699 | . |
| Tubulin alpha-1A chain | Q71U36 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.693929155 | . |
| Tubulin alpha-1B chain | P68363 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.807683132 | . |
| Tubulin alpha-1C chain | Q9BQE3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.880972003 | . |
| Tubulin beta chain | P07437 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.753337482 | . |
| Tubulin beta-2A chain | Q13885 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.519638794 | . |
| Tubulin beta-2B chain | Q9BVA1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.463452922 | . |
| Tubulin beta-3 chain | Q13509 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.214211472 | . |
| Tubulin beta-4B chain | P68371 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.458968588 | . |
| Tubulin beta-6 chain | Q9BUF5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.203606512 | . |
| Tubulin beta-8 chain | Q3ZCM7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.245159186 | . |
| Tubulin-folding cofactor B | Q99426 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.07776868 | . |
| Tubulin-specific chaperone D | Q9BTW9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.088917825 | . |
| Tubulin-specific chaperone E | Q15813 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.854050509 | . |
| Tudor domain-containing protein 3 | Q9H7E2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.491846581 | . |
| Twinfilin-1 | Q12792 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.801738241 | . |
| Tyrosine--tRNA ligase | P54577 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.286739945 | . |
| Tyrosine-protein kinase CSK | P41240 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.865737868 | . |
| U1 small nuclear ribonucleoprotein 70 kDa | P08621 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.007868262 | . |
| U1 small nuclear ribonucleoprotein A | P09012 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.978871359 | . |
| U1 small nuclear ribonucleoprotein C | P09234 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.157459194 | . |
| U2 small nuclear ribonucleoprotein A' | P09661 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.89641433 | . |
| U2 small nuclear ribonucleoprotein B'' | P08579 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.768867647 | . |
| UAP56-interacting factor | Q96QD9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.104515431 | . |
| Ubiquinone biosynthesis methyltransferase COQ5 | Q5HYK3 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.603782839 | . |
| Ubiquitin carboxyl-terminal hydrolase 10 | Q14694 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.988772135 | . |
| Ubiquitin carboxyl-terminal hydrolase 14 | P54578 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.436886096 | . |
| Ubiquitin carboxyl-terminal hydrolase 5 | P45974 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.347241242 | . |
| Ubiquitin carboxyl-terminal hydrolase 7 | Q93009 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.232759285 | . |
| Ubiquitin thioesterase OTUB1 | Q96FW1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.998869007 | . |
| Ubiquitin-40S ribosomal protein S27a | P62979 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.802652027 | . |
| Ubiquitin-associated protein 2 | Q5T6F2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.750694376 | . |
| Ubiquitin-associated protein 2-like | Q14157 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.980075483 | . |
| Ubiquitin-conjugating enzyme E2 D2 | P62837 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.361797962 | . |
| Ubiquitin-conjugating enzyme E2 K | P61086 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.994339717 | . |
| Ubiquitin-conjugating enzyme E2 L3 | P68036 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.277499682 | . |
| Ubiquitin-conjugating enzyme E2 N | P61088 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.965175599 | . |
| Ubiquitin-conjugating enzyme E2 variant 1 | Q13404 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 2.217593135 | . |
| Ubiquitin-like modifier-activating enzyme 1 | P22314 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -9.889815423 | . |
| Ubiquitin-like modifier-activating enzyme 5 | Q9GZZ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.582577666 | . |
| Ubiquitin-like-conjugating enzyme ATG3 | Q9NT62 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.803087411 | . |
| UBX domain-containing protein 1 | Q04323 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.399098181 | . |
| UCH-L1 | P09936 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.037429538 | . |
| UDP-glucose 6-dehydrogenase | O60701 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.512773924 | . |
| UMP-CMP kinase | P30085 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -10.34686583 | . |
| Upstream-binding protein 1 | Q9NZI7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.672961032 | . |
| Uridine 5'-monophosphate synthase | P11172 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.145127076 | . |
| Uridine phosphorylase 1 | Q16831 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.89097306 | . |
| UTP--glucose-1-phosphate uridylyltransferase | Q16851 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.183845249 | . |
| UV excision repair protein RAD23 homolog B | P54727 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.812993554 | . |
| V-type proton ATPase subunit E 1 | P36543 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.828224471 | . |
| Vacuolar protein sorting-associated protein 35 | Q96QK1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -12.22802287 | . |
| Valacyclovir hydrolase | Q86WA6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.620769924 | . |
| Valine--tRNA ligase | P26640 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.479250904 | . |
| VAMP-A | Q9P0L0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.516330022 | . |
| Vasodilator-stimulated phosphoprotein | P50552 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.160367604 | . |
| VDAC-1 | P21796 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.217108159 | . |
| VDAC-2 | P45880 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 5.798730531 | . |
| VDAC-3 | Q9Y277 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.358960869 | . |
| Very-long-chain enoyl-CoA reductase | Q9NZ01 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -3.930683434 | . |
| Vesicle-trafficking protein SEC22b | O75396 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -6.327662189 | . |
| Vesicular integral-membrane protein VIP36 | Q12907 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.608711938 | . |
| Vigilin | Q00341 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -1.573175232 | . |
| Villin-1 | P09327 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.095671242 | . |
| Vimentin | P08670 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.016201152 | . |
| Vinculin | P18206 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.649294614 | . |
| Vinexin | O60504 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.198135394 | . |
| WD repeat-containing protein 1 | O75083 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.100816002 | . |
| WD repeat-containing protein 5 | P61964 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.210331926 | . |
| WD40 repeat-containing protein SMU1 | Q2TAY7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.070754527 | . |
| WW domain-binding protein 11 | Q9Y2W2 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.231990165 | . |
| X-ray repair cross-complementing protein 5 | P13010 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.708489151 | . |
| X-ray repair cross-complementing protein 6 | P12956 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.205478045 | . |
| Xaa-Pro aminopeptidase 3 | Q9NQH7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.420909524 | . |
| Y-box-binding protein 1 | P67809 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -5.696741129 | . |
| Y-box-binding protein 3 | P16989 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.676627163 | . |
| YLP motif-containing protein 1 | P49750 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.459295921 | . |
| YTH domain-containing family protein 1 | Q9BYJ9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.261861826 | . |
| YTH domain-containing family protein 2 | Q9Y5A9 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -11.23902452 | . |
| YTH domain-containing family protein 3 | Q7Z739 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.604118641 | . |
| YTH domain-containing protein 1 | Q96MU7 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -8.332355277 | . |
| Zinc finger C4H2 domain-containing protein | Q9NQZ6 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.005152601 | . |
| Zinc finger CCCH domain-containing protein 15 | Q8WU90 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 4.62524848 | . |
| Zinc finger CCCH domain-containing protein 4 | Q9UPT8 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.322449387 | . |
| Zinc finger CCCH domain-containing protein 7A | Q8IWR0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.066240085 | . |
| Zinc finger CCCH-type antiviral protein 1 | Q7Z2W4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.662622583 | . |
| Zinc finger CCCH-type antiviral protein 1-like | Q96H79 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.709106949 | . |
| Zinc finger CCHC domain-containing protein 3 | Q9NUD5 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -2.601739962 | . |
| Zinc finger protein 385B | Q569K4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.55777371 | . |
| Zinc finger protein 438 | Q7Z4V0 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.054240028 | . |
| Zinc finger protein 638 | Q14966 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 3.275469693 | . |
| Zinc finger protein 749 | O43361 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 0.85748576 | . |
| Zinc finger protein 787 | Q6DD87 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = 1.099947884 | . |
| Zinc finger protein 9 | P62633 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -0.191473474 | . |
| Zinc finger RNA-binding protein | Q96KR1 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -7.053396413 | . |
| Zinc finger SWIM domain-containing protein 8 | A7E2V4 | Homo sapiens | Pro Info | Comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS) | HuH-7.5 Cells (Human hepatocellular carcinoma cell) | . | Liver | . | Z-score = -4.536874407 | . |
Functional Go Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| GO Term | GO Category | GO ID | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|---|
| RNA Binding | Molecular Function |
GO:0003723
|
7.34248865074541e-309 | 14.55982068 | 10424.32231 |
| mRNA Binding | Molecular Function |
GO:0003729
|
3.10E-88 | 15.6660193 | 3246.983813 |
| Cadherin Binding | Molecular Function |
GO:0045296
|
1.42E-70 | 11.08630287 | 1842.42286 |
| mRNA 3'-UTR Binding | Molecular Function |
GO:0003730
|
8.28E-23 | 11.79694788 | 659.6717966 |
| Purine Ribonucleoside Triphosphate Binding | Molecular Function |
GO:0035639
|
6.92E-17 | 3.356300204 | 141.1667759 |
| Ribosome Binding | Molecular Function |
GO:0043022
|
1.94E-16 | 9.491456261 | 387.6988264 |
| aminoacyl-tRNA Ligase Activity | Molecular Function |
GO:0004812
|
4.14E-15 | 20.73126106 | 780.1391397 |
| Translation Initiation Factor Activity | Molecular Function |
GO:0003743
|
4.24E-15 | 18.07212106 | 677.2319097 |
| Double-Stranded RNA Binding | Molecular Function |
GO:0003725
|
1.35E-12 | 9.439797212 | 298.213155 |
| mRNA 5'-UTR Binding | Molecular Function |
GO:0048027
|
4.31E-12 | 28.15245283 | 853.8133491 |
| Single-Stranded RNA Binding | Molecular Function |
GO:0003727
|
3.70E-11 | 12.26738637 | 344.5021863 |
| Poly-Purine Tract Binding | Molecular Function |
GO:0070717
|
9.35E-10 | 15.00900629 | 371.7024347 |
| Adenyl Ribonucleotide Binding | Molecular Function |
GO:0032559
|
1.18E-09 | 3.099016054 | 75.77276236 |
| ATP Binding | Molecular Function |
GO:0005524
|
2.15E-09 | 3.195909833 | 75.99641035 |
| Single-Stranded DNA Binding | Molecular Function |
GO:0003697
|
3.99E-09 | 5.536033353 | 127.8386092 |
| N6-methyladenosine-containing RNA Binding | Molecular Function |
GO:1990247
|
1.00E-08 | 126.0675676 | 2786.779236 |
| miRNA Binding | Molecular Function |
GO:0035198
|
3.90E-08 | 13.11308716 | 271.2762778 |
| Actin Binding | Molecular Function |
GO:0003779
|
4.06E-08 | 3.59789163 | 73.86769183 |
| poly Binding | Molecular Function |
GO:0008143
|
4.06E-08 | 15.21153363 | 311.5844155 |
| Poly-Pyrimidine Tract Binding | Molecular Function |
GO:0008187
|
4.06E-08 | 15.21153363 | 311.5844155 |
| Nucleus | Cellular Component |
GO:0005634
|
5.79E-81 | 3.171043676 | 604.3172417 |
| Intracellular Membrane-Bounded Organelle | Cellular Component |
GO:0043231
|
2.33E-71 | 2.890438266 | 484.9191936 |
| Cell-Substrate Junction | Cellular Component |
GO:0030055
|
1.69E-44 | 6.486091345 | 684.3597414 |
| Focal Adhesion | Cellular Component |
GO:0005925
|
3.31E-43 | 6.425206717 | 656.966504 |
| Cytoplasmic Stress Granule | Cellular Component |
GO:0010494
|
1.12E-35 | 24.70135897 | 2091.932478 |
| Ficolin-1-Rich Granule Lumen | Cellular Component |
GO:1904813
|
3.64E-26 | 10.20604005 | 638.9413484 |
| Intracellular Non-Membrane-Bounded Organelle | Cellular Component |
GO:0043232
|
5.74E-25 | 2.73542481 | 163.2834003 |
| Cytoplasmic Vesicle Lumen | Cellular Component |
GO:0060205
|
7.02E-25 | 10.30134709 | 611.4517187 |
| Ribosome | Cellular Component |
GO:0005840
|
4.56E-24 | 19.20588409 | 1101.795782 |
| Ficolin-1-Rich Granule | Cellular Component |
GO:0101002
|
1.38E-23 | 6.82375039 | 383.2035055 |
| Secretory Granule Lumen | Cellular Component |
GO:0034774
|
2.48E-22 | 4.694997617 | 249.6416274 |
| Intracellular Organelle Lumen | Cellular Component |
GO:0070013
|
4.90E-22 | 2.921238819 | 153.0823125 |
| U2-type Spliceosomal Complex | Cellular Component |
GO:0005684
|
4.29E-21 | 10.9290684 | 548.1214975 |
| Cytosolic Large Ribosomal Subunit | Cellular Component |
GO:0022625
|
1.22E-19 | 17.90972959 | 835.7447783 |
| Large Ribosomal Subunit | Cellular Component |
GO:0015934
|
1.22E-19 | 17.90972959 | 835.7447783 |
| Cytosolic Small Ribosomal Subunit | Cellular Component |
GO:0022627
|
1.22E-19 | 24.57510773 | 1145.145869 |
| Small Ribosomal Subunit | Cellular Component |
GO:0015935
|
2.82E-19 | 23.03792776 | 1052.790069 |
| Nuclear Lumen | Cellular Component |
GO:0031981
|
1.54E-18 | 2.796225224 | 122.8708083 |
| Nucleolus | Cellular Component |
GO:0005730
|
9.17E-17 | 2.689487464 | 107.0503642 |
| Polymeric Cytoskeletal Fiber | Cellular Component |
GO:0099513
|
1.35E-16 | 4.311255362 | 169.7009299 |
| Gene Expression | Biological Process |
GO:0010467
|
9.96E-64 | 10.95138637 | 1677.794594 |
| Translation | Biological Process |
GO:0006412
|
1.48E-59 | 12.65281589 | 1808.183988 |
| mRNA Processing | Biological Process |
GO:0006397
|
8.94E-57 | 13.10841568 | 1783.991436 |
| mRNA Splicing, Via Spliceosome | Biological Process |
GO:0000398
|
4.24E-52 | 12.18786323 | 1523.991978 |
| RNA Splicing, Via Transesterification Reactions With Bulged Adenosine As Nucleophile | Biological Process |
GO:0000377
|
5.48E-52 | 14.17377425 | 1765.502219 |
| Regulation Of Translation | Biological Process |
GO:0006417
|
6.30E-49 | 11.9135406 | 1397.843828 |
| Cytoplasmic Translation | Biological Process |
GO:0002181
|
3.67E-46 | 27.74040527 | 3073.892066 |
| Macromolecule Biosynthetic Process | Biological Process |
GO:0009059
|
7.60E-46 | 12.24480922 | 1346.302314 |
| RNA Processing | Biological Process |
GO:0006396
|
9.73E-44 | 11.69558824 | 1227.783345 |
| Peptide Biosynthetic Process | Biological Process |
GO:0043043
|
3.94E-43 | 13.25872209 | 1371.941059 |
| protein-RNA Complex Assembly | Biological Process |
GO:0022618
|
8.30E-42 | 13.51591198 | 1356.069158 |
| Regulation Of mRNA Splicing, Via Spliceosome | Biological Process |
GO:0048024
|
1.12E-32 | 17.1158464 | 1355.928451 |
| RNA Splicing | Biological Process |
GO:0008380
|
7.02E-27 | 13.25235627 | 871.9154136 |
| Positive Regulation Of Translation | Biological Process |
GO:0045727
|
1.28E-25 | 11.50750193 | 722.8626131 |
| Regulation Of Alternative mRNA Splicing, Via Spliceosome | Biological Process |
GO:0000381
|
1.43E-19 | 18.54143866 | 905.1694744 |
| Spliceosomal Complex Assembly | Biological Process |
GO:0000245
|
2.64E-19 | 15.18023937 | 730.8243523 |
| mRNA Metabolic Process | Biological Process |
GO:0016071
|
3.62E-18 | 10.47712878 | 476.3465469 |
| Negative Regulation Of Translation | Biological Process |
GO:0017148
|
5.32E-17 | 8.189312822 | 349.8486051 |
| Regulation Of RNA Splicing | Biological Process |
GO:0043484
|
6.00E-17 | 8.473354758 | 360.5037843 |
| RNA Metabolic Process | Biological Process |
GO:0016070
|
2.14E-16 | 7.732686892 | 318.7521188 |
Functional KEGG Enrichment analysis of those proteins interacting with the 5'UTR - 3'UTR of this Strain
| Pathways | Category | Adjusted P-value | Odds Ratio | Combined Score |
|---|---|---|---|---|
| Spliceosome | KEGG Pathway | 7.71E-49 | 15.94292689 | 1856.732409 |
| Ribosome | KEGG Pathway | 7.90E-32 | 9.898198904 | 758.1992253 |
| mRNA surveillance pathway | KEGG Pathway | 9.17E-31 | 15.01662148 | 1107.36361 |
| Parkinson disease | KEGG Pathway | 1.33E-21 | 5.339067918 | 279.5586603 |
| RNA transport | KEGG Pathway | 1.11E-20 | 6.211457647 | 309.9436937 |
| Coronavirus disease | KEGG Pathway | 1.11E-20 | 5.393366114 | 268.775431 |
| Amyotrophic lateral sclerosis | KEGG Pathway | 1.21E-20 | 4.174255427 | 207.0128127 |
| Proteasome | KEGG Pathway | 7.01E-19 | 20.15861572 | 915.1834992 |
| Prion disease | KEGG Pathway | 3.27E-18 | 4.518759796 | 197.6586757 |
| Pathways of neurodegeneration | KEGG Pathway | 4.01E-18 | 3.41474353 | 148.3114135 |
| Alzheimer disease | KEGG Pathway | 3.48E-15 | 3.507796643 | 128.2822187 |
| Protein processing in endoplasmic reticulum | KEGG Pathway | 3.95E-15 | 5.266804633 | 191.4882371 |
| Huntington disease | KEGG Pathway | 1.70E-14 | 3.735929983 | 130.0715057 |
| Spinocerebellar ataxia | KEGG Pathway | 2.21E-12 | 5.153323831 | 153.9538302 |
| Glycolysis / Gluconeogenesis | KEGG Pathway | 7.75E-12 | 8.42062889 | 240.4271132 |
| Aminoacyl-tRNA biosynthesis | KEGG Pathway | 4.12E-11 | 8.07766569 | 216.6082635 |
| Salmonella infection | KEGG Pathway | 5.00E-09 | 3.229457748 | 70.91352714 |
| Pentose phosphate pathway | KEGG Pathway | 2.96E-08 | 12.29285983 | 247.3635354 |
| Tight junction | KEGG Pathway | 4.10E-06 | 3.175965262 | 48.07538782 |
| Cysteine and methionine metabolism | KEGG Pathway | 4.82E-05 | 5.457632086 | 68.87965637 |
Virus RNA Sequence Information
|
>NC_002023.1 Influenza A virus (A/Puerto Rico/8/1934(H1N1)) segment 1, complete sequence
AGCGAAAGCAGGTCAATTATATTCAATATGGAAAGAATAAAAGAACTAAGAAATCTAATGTCGCAGTCTC
GCACCCGCGAGATACTCACAAAAACCACCGTGGACCATATGGCCATAATCAAGAAGTACACATCAGGAAG
ACAGGAGAAGAACCCAGCACTTAGGATGAAATGGATGATGGCAATGAAATATCCAATTACAGCAGACAAG
AGGATAACGGAAATGATTCCTGAGAGAAATGAGCAAGGACAAACTTTATGGAGTAAAATGAATGATGCCG
GATCAGACCGAGTGATGGTATCACCTCTGGCTGTGACATGGTGGAATAGGAATGGACCAATGACAAATAC
AGTTCATTATCCAAAAATCTACAAAACTTATTTTGAAAGAGTCGAAAGGCTAAAGCATGGAACCTTTGGC
CCTGTCCATTTTAGAAACCAAGTCAAAATACGTCGGAGAGTTGACATAAATCCTGGTCATGCAGATCTCA
GTGCCAAGGAGGCACAGGATGTAATCATGGAAGTTGTTTTCCCTAACGAAGTGGGAGCCAGGATACTAAC
ATCGGAATCGCAACTAACGATAACCAAAGAGAAGAAAGAAGAACTCCAGGATTGCAAAATTTCTCCTTTG
ATGGTTGCATACATGTTGGAGAGAGAACTGGTCCGCAAAACGAGATTCCTCCCAGTGGCTGGTGGAACAA
GCAGTGTGTACATTGAAGTGTTGCATTTGACTCAAGGAACATGCTGGGAACAGATGTATACTCCAGGAGG
GGAAGTGAAGAATGATGATGTTGATCAAAGCTTGATTATTGCTGCTAGGAACATAGTGAGAAGAGCTGCA
GTATCAGCAGACCCACTAGCATCTTTATTGGAGATGTGCCACAGCACACAGATTGGTGGAATTAGGATGG
TAGACATCCTTAAGCAGAACCCAACAGAAGAGCAAGCCGTGGGTATATGCAAGGCTGCAATGGGACTGAG
AATTAGCTCATCCTTCAGTTTTGGTGGATTCACATTTAAGAGAACAAGCGGATCATCAGTCAAGAGAGAG
GAAGAGGTGCTTACGGGCAATCTTCAAACATTGAAGATAAGAGTGCATGAGGGATATGAAGAGTTCACAA
TGGTTGGGAGAAGAGCAACAGCCATACTCAGAAAAGCAACCAGGAGATTGATTCAGCTGATAGTGAGTGG
GAGAGACGAACAGTCGATTGCCGAAGCAATAATTGTGGCCATGGTATTTTCACAAGAGGATTGTATGATA
AAAGCAGTTAGAGGTGATCTGAATTTCGTCAATAGGGCGAATCAGCGACTGAATCCTATGCATCAACTTT
TAAGACATTTTCAGAAGGATGCGAAAGTGCTTTTTCAAAATTGGGGAGTTGAACCTATCGACAATGTGAT
GGGAATGATTGGGATATTGCCCGACATGACTCCAAGCATCGAGATGTCAATGAGAGGAGTGAGAATCAGC
AAAATGGGTGTAGATGAGTACTCCAGCACGGAGAGGGTAGTGGTGAGCATTGACCGGTTCTTGAGAGTCC
GGGACCAACGAGGAAATGTACTACTGTCTCCCGAGGAGGTCAGTGAAACACAGGGAACAGAGAAACTGAC
AATAACTTACTCATCGTCAATGATGTGGGAGATTAATGGTCCTGAATCAGTGTTGGTCAATACCTATCAA
TGGATCATCAGAAACTGGGAAACTGTTAAAATTCAGTGGTCCCAGAACCCTACAATGCTATACAATAAAA
TGGAATTTGAACCATTTCAGTCTTTAGTACCTAAGGCCATTAGAGGCCAATACAGTGGGTTTGTGAGAAC
TCTGTTCCAACAAATGAGGGATGTGCTTGGGACATTTGATACCGCACAGATAATAAAACTTCTTCCCTTC
GCAGCCGCTCCACCAAAGCAAAGTAGAATGCAGTTCTCCTCATTTACTGTGAATGTGAGGGGATCAGGAA
TGAGAATACTTGTAAGGGGCAATTCTCCTGTATTCAACTACAACAAGGCCACGAAGAGACTCACAGTTCT
CGGAAAGGATGCTGGCACTTTAACCGAAGACCCAGATGAAGGCACAGCTGGAGTGGAGTCCGCTGTTCTG
AGGGGATTCCTCATTCTGGGCAAAGAAGACAGGAGATATGGGCCAGCATTAAGCATCAATGAACTGAGCA
ACCTTGCGAAAGGAGAGAAGGCTAATGTGCTAATTGGGCAAGGAGACGTGGTGTTGGTAATGAAACGAAA
ACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAGTGT
CGAATAGTTTAAAAACGACCTTGTTTCTACT
Click to Show/Hide
|